COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..1428645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1141..2136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2220..4766) product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4789..5973) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 6179..6877 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6887..7444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7510..7752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7788..8684 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8695..9882) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10169..13069) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(13137..13649) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene nrdR CDS complement(13926..14249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 14521..15306 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene lexA CDS complement(15372..17339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(17409..18827) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene hflX CDS 19005..20468 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(20591..20833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(21388..21699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21931..23139) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 23342..24223 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene miaA CDS 24231..25061 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene dapF CDS 25061..25783 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(25854..26402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 26355..26543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(26540..27511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 27567..28484 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(28408..29892) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene miaB CDS complement(29919..30398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 30528..31271 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 31327..32211 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 32257..32967 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 32964..33938 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 34009..34509 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(34483..36204) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene rny CDS complement(36663..37862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(38035..38805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(38808..39863) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene recA CDS complement(40054..40254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(40264..41046) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(41043..41981) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 42059..42823 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(42795..43457) product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(43532..44878) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 44949..46205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(46531..47547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(47638..48777) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(48774..50066) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(50165..51823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(51888..52898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(52909..53757) product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 53952..58481 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(58521..59444) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 59519..60316 product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(60313..60978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 61018..63804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 63808..64617 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(64559..65353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(65388..66251) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene pspA CDS complement(66564..66959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(67119..67610) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(67603..68220) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene pgsA CDS complement(68217..69677) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rimO CDS 69760..71100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(71397..73937) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 73994..74407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(74491..76011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(76102..77790) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(77812..78705) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene dapA CDS complement(78732..79295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(79362..80576) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 80671..81234 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 81239..81634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(81670..82326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(82323..83066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(83063..83854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(84053..84925) product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(84910..85347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(85362..86195) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(86196..87197) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(87200..88444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(88465..89445) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 89568..91631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(91782..92486) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene dapB CDS complement(92524..93513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(93516..94808) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(94905..97232) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(97429..97698) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene rpsO CDS complement(97815..98747) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(99086..99967) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene truB CDS complement(99985..101331) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(101960..103012) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(103024..103476) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene rbfA CDS complement(103573..103866) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(103901..104923) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742064.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(105007..108078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(108172..108573) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209441410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(108551..109579) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene nusA CDS complement(109576..110196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 110350..110859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 110856..111281 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(111282..111983) product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(111980..112837) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene map CDS 112947..113258 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(113248..116826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(116900..117649) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(117680..118363) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(118582..119346) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(119351..120712) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(120908..122254) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(122392..123915) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 124621..124992 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 125024..126304 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 126301..126960 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 127048..127932 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 127929..128999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(129028..129630) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(129639..131783) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(131780..132391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 132506..133486 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 133655..134302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(134360..134953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 135079..135918 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(135968..137140) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ispG CDS complement(137149..138414) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(138414..139613) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene dxr CDS 139689..140510 product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 140576..142180 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(142521..144080) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 144209..144442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(144500..145654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(145692..146870) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rlmN CDS complement(146911..147915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(147915..148472) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene frr CDS complement(148534..149295) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene pyrH CDS complement(149398..150225) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene tsf CDS complement(150261..151187) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene rpsB CDS complement(151413..152057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 152178..152573 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 152578..154104 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 154094..155257 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene dprA CDS complement(155341..155526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 156244..157074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 157420..157824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(158017..158478) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(158611..159120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 159154..160116 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 160113..161324 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(161333..161767) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(161827..162150) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(162147..162947) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(162998..163444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(163489..164130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(164127..165005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(165184..165540) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rplS CDS complement(165658..166416) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene trmD CDS complement(166417..166983) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene rimM CDS complement(166983..167240) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(167218..167727) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rpsP CDS 168042..168653 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(168663..169316) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(169316..170722) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene proS CDS 170800..171315 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155369284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 171305..172702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(172728..173807) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(173834..174439) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(174650..175246) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(175311..176870) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene ffh CDS complement(176934..177164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 177350..179050 product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 179047..180309 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(180353..180499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(180754..182484) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(182481..184346) product maleylacetate reductase and hydroxyquinol 1,2-dioxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(184351..185271) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(185304..186278) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(186309..186875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(186877..188460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 188696..189181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(189175..189993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(189993..192269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 tRNA complement(191444..191535) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(192266..192868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(192858..194837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 194973..197153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(197278..198285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(198249..200738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(200782..203049) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(203049..203387) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(203423..204793) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(205043..205834) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(205883..207085) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene ftsY CDS 207225..208895 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 209119..210021 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(210031..210648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(210653..214231) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene smc CDS complement(214490..214684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 215400..216884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 217034..218317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 218314..218883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(218837..219691) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene mutM CDS complement(219701..220861) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(220858..221637) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rnc CDS complement(221634..222644) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene plsX CDS complement(222656..222829) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rpmF CDS complement(222881..223477) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(223567..224064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(224211..224690) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene coaD CDS complement(224687..225250) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rsmD CDS 225598..226761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(226832..227188) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(227185..229380) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene recG CDS complement(229377..230990) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 231170..231361 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rpmB CDS complement(231417..231875) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(231889..232827) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 232926..233159 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 233161..233796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(233803..234897) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 234981..235484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 235506..235862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 235954..236304 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 236304..237179 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 237176..237856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 237860..238174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 238168..238488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(238601..239710) product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(239707..240702) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(240699..241427) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 241604..242251 product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene cofC CDS 242269..242466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 242521..244782 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 244779..245651 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(245608..246045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(246151..247008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(247243..247830) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene leuD CDS complement(247849..249288) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene leuC CDS 249338..250024 product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene ndgR CDS 250079..252769 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 252822..253610 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 253871..254344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 note possible pseudo, internal stop codon tRNA complement(254840..254913) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(255011..255083) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(255178..255981) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 256028..256786 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(256757..257548) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(257592..257843) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(257843..258685) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(258682..259602) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 259800..260741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(260728..261252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(261254..262009) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(262073..262282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(262215..262574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 262591..262962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(263112..263963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(264177..264683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(265250..265672) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene arfB CDS 265804..267126 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 267123..268469 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 268500..269525 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(269609..269827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 270732..271343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 271500..272444 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 272441..272956 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 273128..274309 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene thrS CDS complement(274287..274667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(274654..276234) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene cimA CDS 276565..277317 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(277314..278411) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145785146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(278543..279574) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 279979..280341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(280277..281929) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene serA CDS complement(282063..283076) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ilvC CDS complement(283127..283642) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene ilvN CDS complement(283645..285474) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(285677..287986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 288130..289935 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ilvD CDS complement(289994..295798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(296053..296811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(296811..298481) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 298619..300316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 300699..302084 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene tnpB CDS 302121..302921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, internal stop codon CDS complement(302980..305445) product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(305498..306340) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(306349..307332) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(307391..308680) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 309006..310019 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(310022..312652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(312762..313046) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(313046..314131) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 314195..314569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 314633..315811 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 315868..317469 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 317515..318528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(318549..320048) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene gatB CDS 320154..321620 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(321669..323132) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene gatA tRNA 322532..322624 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(323137..323436) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene gatC CDS 323657..323962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 323866..325947 product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rmdB CDS complement(325960..328308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(328455..329465) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(329458..330540) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene mnmA CDS complement(330613..331788) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(331865..332815) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(332830..333582) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 333983..334363 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 334360..334674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 334713..335060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(335061..336698) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(336758..338380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(338407..338946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(338986..339759) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 339815..340276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 340333..340866 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 340867..341754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 note possible pseudo, internal stop codon CDS complement(341751..342644) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rbsK CDS complement(342649..343461) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(343494..344684) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 344807..346243 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 346385..347104 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(347412..349547) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(349685..354616) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 354805..356733 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(356745..358448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(358464..359399) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(359574..361256) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(361295..361765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(361925..363091) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 363145..363744 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(363741..364688) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene meaB CDS complement(364685..365860) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 365955..366437 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene mce CDS 366704..368020 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 368254..369621 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019261882.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 369745..370884 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(370888..371481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(371481..371999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(372038..372517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(372597..373391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(373442..373834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 373853..375343 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 375375..376022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 376019..377515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(377523..378182) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene nucS CDS 378253..378867 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 378864..380186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 380244..382844 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 382841..383599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 383748..384608 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 384605..385390 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 385465..386754 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(386751..386999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(387095..387943) product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 388077..388430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(388436..389698) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene murA CDS 389766..390338 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 390314..390727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 390902..392092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072478723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(392209..392676) product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(392685..392966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(393080..394135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(394378..395820) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene atpD CDS complement(395820..396749) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(396752..398401) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene atpA CDS complement(398488..399309) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(399309..399872) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(399904..400128) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene atpE CDS complement(400206..401000) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene atpB CDS complement(401015..401248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(401458..401958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(401955..403244) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 403350..404789 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(404782..405738) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(405735..406322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(406324..406968) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(407006..407716) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene prmC CDS 407603..407953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 407950..409485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 409493..410824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(410828..411916) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene prfA CDS complement(411998..412222) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpmE CDS 412448..413344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 413348..413965 product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(413966..415132) product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(415258..417303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(417657..418616) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene thrB CDS 418650..418985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(418965..420131) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(420732..424004) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 424061..424636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(424622..425671) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene thrC CDS complement(425761..427110) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(427107..428492) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene lysA CDS complement(428495..430159) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene argS CDS 430246..431064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 431064..431726 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 tRNA 431792..431864 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 432068..432361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(432415..434511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(434595..434987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 435108..435368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 435374..435790 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(435840..436151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(436256..437845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 437986..439707 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(439756..440169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(440171..441346) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 441414..441884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 441923..442294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 442356..442925 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 442978..443655 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 443652..445337 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(445549..445884) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(446031..446387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 446781..447692 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(447798..448151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 448451..448753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(448774..449529) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(449526..450134) product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene sigK CDS complement(450217..451113) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 451224..451589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 451582..452001 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(452005..453366) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(453468..453878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(453916..454680) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene fabG CDS complement(454729..456375) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(456368..457321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(457318..457650) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 457723..458391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(458414..459631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 459633..460928 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 460938..462308 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 462528..463715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(463693..464505) product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 464620..465969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 466186..467031 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 467031..468098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(468084..468890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 469083..470231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(470654..471868) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rocD CDS complement(471865..472671) product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(472938..473522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(473631..474239) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(474394..474906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(474925..475140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(475181..478321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(478517..480226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(480266..481846) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(481855..482577) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene phoP CDS complement(482648..483415) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(483412..484176) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 484271..484927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 484969..485889 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 485886..486704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 486816..490553 product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 490615..490794 product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 490870..492957 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene pta CDS 492954..494069 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(494131..494307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 494601..495578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(495592..496542) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(496597..497829) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(497972..498280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 498367..498771 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene sodN CDS 498845..499258 product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(499262..499939) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(499993..500388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 500441..501391 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 501792..502046 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(502556..503383) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(503365..503928) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(504102..504305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(504302..505996) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(506313..507851) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(507888..508946) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 509090..510607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(510612..510848) product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(511096..511383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(511390..511989) product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene sigR CDS complement(512252..512854) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(512927..513490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(513766..514392) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 514528..515820 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene aroA CDS 515757..516899 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rsgA CDS 517490..518869 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene tnpB CDS 518898..519692 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene hisN CDS 519752..520711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 520902..521735 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 521745..522302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(522293..522955) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(522952..524085) product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 524069..524569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 524602..525429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 525523..526749 product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(526746..527975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(528002..528283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 528282..530306 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene malQ CDS 530303..530482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(530502..530882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 531018..531869 product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 532031..533308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(533369..534604) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(534604..535389) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 535468..536157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 536221..537288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(537273..537716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 537694..538122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(538170..541436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 541583..542503 product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 542503..543546 product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 543534..544313 product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 544310..545611 product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 545598..546512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 546512..546829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 546842..547993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 tRNA complement(548132..548206) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 548357..548596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 548805..549020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 note possible pseudo, frameshifted CDS 549335..552067 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(552064..552798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 note possible pseudo, frameshifted CDS 552964..553149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 553202..553714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 553725..554276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 554273..556075 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 tRNA 556115..556207 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(556508..556681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 556908..558113 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209912946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 tRNA complement(558169..558243) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(558326..561286) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(561366..562391) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 562482..563732 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(563773..564369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(564399..564932) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 565405..565566 product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 565841..566860 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 566860..568302 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 568328..569614 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(569747..569962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(569964..570326) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(570470..570862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(570930..573050) product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 573148..573393 product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(573359..573784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(573781..574209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(574237..575124) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene thpD CDS complement(575226..576200) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene nudC CDS complement(576197..577513) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(577510..578817) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 578982..579389 product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 579386..580477 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 580493..581248 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 581238..582104 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(582101..582997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(583142..583333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 583405..584166 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(584244..584447) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 584673..585077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(585074..588454) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(588451..591999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(592029..593051) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(593328..593882) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(593884..594663) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 594877..595074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(595075..596145) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene dapE CDS 596202..597149 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene dapD CDS complement(597146..597940) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 598013..598609 product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene lysE CDS 598824..599861 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 599961..600689 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 600717..601424 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(601425..602153) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 602185..602589 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 603096..603575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 603654..604127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 604124..604816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 605285..605929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(605889..607184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(607255..607899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(607909..608421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(608747..609715) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene dapC CDS complement(609835..610158) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(610139..610414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 610340..611206 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(611203..611673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(611704..613524) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(613615..614136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(614133..615059) product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene mshB CDS 615130..616992 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 617039..617203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 617237..618673 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 618670..620133 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 620261..621184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 621557..622351 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 622367..624289 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 624289..625293 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(625315..626055) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 626142..627647 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 627698..628330 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(628317..628670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 629244..629963 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 629960..630664 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 630666..631547 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 631544..632560 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 632608..633873 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 633921..634664 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 634661..635437 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 635434..636417 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 636417..637619 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 637616..638236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(638282..638824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(638826..639914) product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(639911..641314) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(641314..641940) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 642001..643173 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 643170..644714 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(644694..645083) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 645329..645649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 645667..646050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(646110..646943) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(646934..647689) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(647710..648489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(648674..649237) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 649345..649836 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 649833..650285 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(650322..652058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(652161..652415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 652375..652740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 652737..653441 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 653438..653854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 653875..654750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(654774..655316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(655495..658062) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene valS CDS complement(658079..658576) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(658654..660072) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 660197..661282 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ychF CDS 661350..661592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 661589..661984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(661995..662747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(662811..663029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 662916..663944 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(663941..664888) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 665008..665574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 665644..666837 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene xseA CDS 666834..667037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(667039..667602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 667703..668746 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene glpX CDS 668811..669455 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(669452..670240) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(670309..671031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(671359..672768) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 673037..673843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(673844..674599) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(674647..675780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(675894..677747) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 678057..678809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 678862..679395 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 679432..679947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(679944..680516) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(680521..681372) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(681390..682211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 682341..683921 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(683918..684646) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(684673..684876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(684939..687650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 687740..688042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 688138..688566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 688566..689930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 691273..691887 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(691911..692666) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(692670..693596) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(693647..694213) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 694299..696050 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(696167..696709) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 696730..696954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 697042..697818 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(697748..699190) product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 699236..699697 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(699694..700641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(700682..701419) product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(701467..702393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(702395..703030) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 703243..704205 product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(704242..705510) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(705745..707310) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 707516..709402 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 709458..711071 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(711078..711761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 711850..712335 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(712332..712937) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene upp CDS 713024..713974 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene deoC CDS 714022..715443 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 715436..716281 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 716410..717291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 717316..719847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 repeat_region 719882..720022 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgagctccgaccgagccgaa CDS 720313..721323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(721297..721941) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(722088..723041) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 723102..723812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(723836..724444) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(724425..724811) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(724897..725301) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(725298..728834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(729273..730358) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 730385..731188 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(731185..731865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(731872..733149) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(733142..733870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(733901..735178) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(735175..736455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 note possible pseudo, frameshifted CDS complement(736452..738023) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(738100..739197) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(739354..739653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(739678..740658) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 740748..741341 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(741331..741720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(741728..742639) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene yhjD CDS complement(742675..743208) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(743216..744247) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene trpS CDS 744402..745376 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene galE CDS 745373..746512 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene galK CDS 746543..746770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(746767..748398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(748401..749225) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(749222..750124) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(750114..751442) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(751439..752896) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(753186..754214) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 754311..755111 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(755095..756393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(756393..757304) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene cysD CDS complement(757351..758241) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(758265..760106) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(760247..760831) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene pth CDS complement(760928..761554) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(762136..763116) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(763350..764753) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene glmU tRNA complement(764872..764943) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(764983..765354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(765303..765854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 766239..767186 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 767309..767980 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(767988..768521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(768530..770326) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(770334..771281) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(771278..772225) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene rsmA CDS 772260..772682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(772686..773573) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 773658..774689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(774728..776524) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene metG CDS 776656..777954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(777948..778769) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene rsmI CDS 778878..780458 product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 781334..782467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 782464..784893 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(784950..786194) product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 786338..786889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 786996..787907 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 787993..788853 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(789045..790289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 790463..791545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 791548..793224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(793242..794900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 tRNA complement(795025..795100) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(795181..795903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(796061..796627) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(796678..797988) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(797985..798899) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene galU CDS complement(798950..800941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 801023..801649 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(801894..802103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 802421..802867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(803023..803277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 803264..803590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(803673..804149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 804404..804850 product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene furA3 CDS 804931..805806 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(805878..806762) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(806800..807417) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(807469..808323) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(808406..809278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(809288..809446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 809394..809582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(809579..810211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(810321..810953) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 811422..811784 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene trxA CDS 811919..813865 product intein-containing Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 813890..814297 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 814473..814961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(815008..815817) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(816016..816657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(816730..817641) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 817775..818506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 818527..819024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(819137..820012) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 820037..821317 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 821314..821859 product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 821872..823032 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(823077..823490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(823557..824873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 825008..825697 product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(825662..827086) product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(827164..827331) product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 827602..828411 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene paaX CDS 828408..829241 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(829285..830145) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(830480..831019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(831024..831641) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(831675..832172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(832169..832663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(832732..833109) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 833301..835154 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 835147..836193 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 836216..837013 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(837019..838032) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 838196..838690 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(838679..841363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(842093..842308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(842489..842788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(842918..843427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 843345..844298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 844393..845403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 845455..847917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(847914..848900) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene hemB CDS complement(848910..850496) product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(850493..851422) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene hemC CDS complement(851419..852708) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(852705..853460) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(853677..854327) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(854329..854577) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(854611..856134) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 856495..857415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 857597..858793 product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(858901..859923) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(859920..860978) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(861407..861619) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(861831..862748) product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 862868..863404 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(863391..864173) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 864325..865188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(865195..865878) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(865912..867246) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 867423..868076 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene phoU CDS complement(868135..868881) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 868990..870300 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 870343..871563 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212011225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 872814..873161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 873230..873460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(873528..874007) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(873992..875269) product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene mshA CDS 875411..876166 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 876163..876909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(876906..877304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 877614..877826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 877889..878602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(878632..879414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(879503..880237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(880342..881901) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(881959..882201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(882284..882721) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene fliW CDS complement(882724..883620) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene flgL CDS complement(883635..885044) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene flgK CDS complement(885046..885531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 885813..887033 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 887144..888550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 888615..888995 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene fliS CDS 889012..889335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 889500..889847 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene flgB CDS 889850..890242 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene flgC CDS 890254..890607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 890609..892240 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene fliF CDS 892314..893339 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene fliG CDS 893353..894003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 894012..895319 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene fliI CDS 895556..895996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 895996..896979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 897011..898798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(898857..899093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(899090..900679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(900657..902711) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene flhA CDS complement(902863..903954) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene flhB CDS complement(903970..904734) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene fliR CDS complement(904731..905624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(905621..906055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(906061..906819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(906816..907766) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene fliM CDS complement(907877..908335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(908348..909376) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(909381..910172) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(910172..910459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(910582..911847) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene flgE CDS complement(911872..912318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(912449..912937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(912945..913307) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(913304..913801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(913798..914193) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(914190..915035) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(915032..916192) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(916206..917078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(917078..917515) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(917517..919868) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(919956..920684) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 921043..921540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(921573..922616) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 922684..923445 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 923586..925010 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 925039..926064 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(926029..926901) product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 927193..927510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 927829..928854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(928903..929790) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(929787..930101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(930168..930602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(930599..931075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(931109..932017) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 note possible pseudo, frameshifted CDS complement(932014..932847) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(932863..933903) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(933905..934324) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(934358..934957) product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 935073..935447 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(935441..936190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(936205..936618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(936624..938552) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 938707..939213 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(939193..940053) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 940143..941096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 941176..941802 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 941806..942819 product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene pitH CDS 942938..944236 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(944252..945229) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 945277..946083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(946115..946891) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene pstB CDS complement(946904..947989) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene pstA CDS complement(948033..949103) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene pstC CDS complement(949145..950287) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene pstS CDS complement(950554..951396) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene mshD CDS complement(951428..952096) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 952408..953394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 953465..954259 product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 954641..955489 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 955494..955826 product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(955870..956484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(956527..957783) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 957867..958238 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 958298..960481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(960491..961693) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 961880..962512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(962502..962792) product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(962789..964588) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(964688..966310) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene groL CDS complement(966604..967518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 967617..968126 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 968126..968617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(968556..969533) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(969795..971096) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene thrC CDS 971029..971238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(971314..972177) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(972174..974936) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 975076..977253 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(977254..977547) product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(977645..978655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(978652..979656) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(979690..980475) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 980668..981591 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 981665..982579 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 982576..983673 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene nagA CDS complement(983636..984385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(984396..985811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 985914..987155 product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(987126..988898) product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 989001..989963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(990118..993519) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(993633..994823) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 994912..997620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(997675..998760) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ugpC tRNA 998900..998974 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 999622..1001469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1001491..1002741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1002735..1003853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1003853..1005259) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene cysS CDS complement(1005354..1006751) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1006748..1008070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, frameshifted CDS complement(1007952..1009739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1010033..1010545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1010587..1011735) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1011789..1013003 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1012990..1014078) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene hisC CDS complement(1014086..1015210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1015207..1015803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1015814..1016956) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene hppD CDS 1017177..1018481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1018544..1020220 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1020266..1021150) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1021227..1022531 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1022524..1023570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1023619..1024077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1024111..1025208) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene fahA CDS complement(1025205..1026050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1026148..1027305 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1027364..1028566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1028769..1029950 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1029972..1031279 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1031286..1032224 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1032221..1033105 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1033102..1034358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018348088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1034355..1035338 product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1035475..1036701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1036792..1037265) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ispF CDS complement(1037360..1038052) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene ispD CDS complement(1038103..1038588) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1038925..1039695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1039829..1040206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1040355..1040813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1040810..1041871) product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1041899..1043053) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1043050..1043799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1043825..1044652 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1044750..1045430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1045460..1046878 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene radA CDS complement(1046886..1047188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1047072..1048139 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene disA CDS 1048233..1048865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1049050..1049568) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1049569..1050339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1050412..1050942) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene def CDS complement(1050939..1051442) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1051464..1052360 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1052507..1055005 product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1055016..1056083 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1056070..1056420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1056527..1059049) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1059426..1059782) product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1059900..1061408) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene lysS CDS complement(1061481..1062245) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1062328..1063179) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene nadC CDS complement(1063194..1064837) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1064900..1065808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1065949..1066377) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1066377..1067207) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene panC CDS complement(1067204..1068022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 note possible pseudo, internal stop codon CDS 1068251..1069195 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1069192..1070337 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1070344..1071516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1071610..1072608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1072748..1073461) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene opuCB CDS complement(1073458..1074180) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1074183..1075202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1075203..1075694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1075760..1076059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1076079..1077320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1077459..1077980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1077977..1078504) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene folK CDS complement(1078501..1078863) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene folB CDS complement(1078869..1079759) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene folP CDS 1080095..1080388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1080390..1080752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1080856..1084290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1084292..1086280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1086285..1086830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1086827..1087942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1087939..1088544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1088545..1089120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1089192..1091873 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112141171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1091870..1092562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1092590..1092991) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1093031..1093498) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1093485..1093814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1093767..1094072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1094074..1094541) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene folE CDS complement(1094718..1096757) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ftsH CDS complement(1097048..1097677) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene hpt CDS complement(1097762..1098865) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene tilS CDS complement(1098865..1099926) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1099980..1101353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1101475..1102116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1102417..1102926 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1103044..1104480) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene eccD CDS 1104598..1108569 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1108673..1110004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1110154..1111332) product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1111367..1112080) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1112181..1112801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1112810..1113613) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene nth CDS complement(1113650..1114561) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1114548..1115009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1115052..1115729 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene crp CDS 1115937..1117235 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1117232..1119238 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1119215..1120162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1120230..1123850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1123877..1124686) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1124786..1125271) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1125268..1125423) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1125542..1126435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1126459..1127412 product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1127449..1128297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 note possible pseudo, internal stop codon CDS complement(1128325..1128699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 note possible pseudo, internal stop codon CDS 1128810..1129937 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1129950..1130252) product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene wblA CDS 1130573..1132975 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1132986..1133702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1134317..1135036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 tRNA complement(1135312..1135388) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(1135461..1136366) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1136384..1136836 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1136960..1137259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1137320..1139527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1139530..1140687) product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1140780..1141295 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pyrE CDS complement(1141314..1141754) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1141921..1142907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1142981..1143244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1143353..1144003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1144315..1145013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1145205..1146098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1146095..1147150) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1147159..1148484) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1148610..1149377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1149560..1151284 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene leuA CDS 1151357..1151986 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1151983..1152240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1152333..1153625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1153682..1154719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1154736..1155776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1155788..1156789) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1156908..1158680) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1158755..1159756) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1160167..1160760) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene recR CDS complement(1160765..1161088) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1161464..1164835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 tRNA 1165125..1165212 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(1165425..1165766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1165954..1166163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 tRNA complement(1166499..1166588) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 1166723..1167439 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene deoD CDS complement(1167498..1167914) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1167947..1168441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1168552..1168743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1168823..1169416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1169321..1170052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1170114..1171247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1171460..1172377 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1172395..1172997 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1173098..1174060) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene mtnA CDS 1174078..1175136 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1175156..1176826 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1177267..1178406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1178393..1181335 product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1181332..1181802 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1181799..1182260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1182238..1182867 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1182972..1183742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1183946..1184977 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene wecB CDS 1184989..1185339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1185336..1186088) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1186173..1186730 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1186727..1187326) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1187461..1189095 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1189283..1190917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1191028..1191837 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1192153..1192404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1192670..1192906 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1193355..1194248) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1194304..1194576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1194545..1194868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1194865..1195053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1195165..1195410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1195449..1197677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1197828..1198124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1198121..1198960) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1199074..1202166 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1202197..1202466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1202631..1203497 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1203485..1203886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1203958..1204620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1204545..1205345) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1205374..1206639) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1206636..1207334) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1207359..1207910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1207976..1208386 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1208383..1208550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1208551..1209504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1209514..1210698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1210798..1212762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1212883..1213215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1213189..1213665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1213662..1214339) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1214336..1216819) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1216987..1217853) product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1217902..1219977) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene kdpB CDS complement(1219974..1221620) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene kdpA CDS complement(1222008..1223276) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene lysA CDS 1223427..1225487 product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1225590..1227668 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1227774..1229474 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1229467..1230195) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1230270..1231436) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene sufS CDS complement(1231436..1232743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1232740..1234275) product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1234582..1235661 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1235647..1236492) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1236592..1239486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1239478..1242438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1242605..1247368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1247541..1249115) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1249318..1250445) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene chrA CDS 1250471..1251151 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1251220..1253070 product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1253075..1253995 product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1254026..1254511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1254601..1255458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1255515..1256570) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1256767..1257375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1257372..1258238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1258264..1259025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1258918..1259253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1259226..1259702) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1259930..1260433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1260616..1261785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 note possible pseudo, internal stop codon, frameshifted CDS complement(1261891..1263216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1263514..1265046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1265048..1265236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1265246..1265797) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1265794..1266273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1266591..1266923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1266951..1268024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1268092..1268694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1268708..1269742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1269739..1270131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1270118..1270639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1271118..1271477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1271474..1272913 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1273122..1273670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1274249..1274668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1274869..1275108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1275088..1275441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1275694..1275930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1277260..1279959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1280029..1280739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1280875..1281495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1281395..1281667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 tRNA complement(1282375..1282448) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(1282485..1282576) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 1282720..1284153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1284114..1284881) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1285028..1286122 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1286119..1287651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1287932..1288762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1288778..1289896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1289896..1291137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1291147..1293957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1294439..1297438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1297649..1297861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1298041..1298310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1298315..1301206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1301675..1303423) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1303925..1304638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1304690..1305220) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1305882..1306085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1305972..1306382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1306387..1307364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1307267..1307521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1307597..1308220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1308377..1309378) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1309382..1309591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 tRNA 1309842..1309927 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1310268..1310609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1310646..1311875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1311920..1312366) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene soxR CDS 1312428..1313093 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1313099..1313974 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1313963..1314406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1314465..1315595) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1315631..1316038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1316035..1316946) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1316961..1317491) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1317655..1318275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1318321..1319688) product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene eccB CDS complement(1319723..1320832) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene corA CDS complement(1320935..1322029) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1322143..1322874 product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1322862..1323923 product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1323898..1324626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1324598..1325176) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1325169..1326002) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1326242..1327750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1327782..1328984) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1328986..1329885 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1330033..1331643 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1331712..1332464) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1332461..1333645) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1333788..1334657 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1335085..1335771 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1335768..1336781 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1336856..1338358 product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1338349..1338816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1338813..1340435 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1340467..1341246 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1341237..1342844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776311.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1342841..1343074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1343154..1343690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1343816..1344187 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1344187..1345860 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1345975..1347156 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1347176..1347511 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1347515..1348309 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1348349..1349542 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1349613..1350530 product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1350535..1351263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1351252..1352469) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1352765..1353496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1353601..1354062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1354148..1354537 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1354545..1354748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1354663..1355157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1355167..1356114 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene pheA CDS complement(1356161..1356895) product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1356958..1357320) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1357386..1357814) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1357872..1358642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1358711..1360009 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene serS CDS 1360125..1360937 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1360939..1361739 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1361736..1362377) product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1362374..1363159) product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1363269..1363727 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1363768..1365609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1365690..1366778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1366862..1367176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1367202..1367801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 note possible pseudo, frameshifted CDS 1367952..1368767 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene fdhD CDS 1368837..1370477 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1370492..1371511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1371554..1372057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1372114..1372995 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1373117..1374124 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene moaA CDS 1374188..1374436 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1374449..1374913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1374953..1376155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1376291..1377529 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1377636..1380767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1380754..1381242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1381575..1382216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1382309..1383523 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1383552..1384115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1384210..1385475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1385462..1385887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1385884..1387107) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1387117..1387611) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1387608..1388099) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene moaC CDS 1388178..1388396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1388537..1391143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1391470..1392879 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1392887..1393288 product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081656034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1393358..1394566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1394668..1395096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1395086..1395403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1395400..1399038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 1399035..1399370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1399374..1400648) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene dnaB CDS 1401099..1404992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1405167..1405616) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rplI CDS complement(1405631..1405870) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rpsR CDS complement(1405922..1406497) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1406563..1406853) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene rpsF CDS complement(1407177..1408172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1408303..1409079 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1409102..1411366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1411459..1412988) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1413100..1415889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1416079..1416549) product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1416752..1417399 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1417420..1418499 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1418671..1419126) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene ogt CDS 1419011..1419220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1419217..1419720 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1419717..1420826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1420823..1422253) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1422284..1423225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1423222..1424958 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene murJ CDS 1425225..1426754 product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1426800..1427477 product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene sigM CDS 1427474..1428328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 sequence002 source 1..270717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..2971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 note possible pseudo, internal stop codon, frameshifted CDS complement(3073..3417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, internal stop codon, frameshifted CDS 3416..4375 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene galE1 CDS 4568..5317 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 5473..6843 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(6892..9126) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene katG CDS complement(9123..9581) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(9635..10321) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 10320..13190 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 13232..15814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 15835..16269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 16302..18986 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 19067..20524 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 20532..23267 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(23264..25852) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 25982..26647 product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 26755..28212 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 28391..28675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 28732..29133 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(29053..29850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(29898..30419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(30442..31284) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(31366..31761) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(31771..32595) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(32633..33772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(34078..35100) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(35184..36926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 37028..37915 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 37957..39075 product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 39090..39920 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene catA CDS 39925..40233 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene catC CDS complement(40196..41218) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(41234..41608) product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(41605..41919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 41919..42947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 43083..44042 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(44297..44449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(44564..45157) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 45356..45829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 45826..46200 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene crcB CDS 46360..46857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 46860..47537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(47494..49386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(49429..50376) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 50580..51347 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 51357..52151 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 52283..54649 product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 54667..55311 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 55457..55729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 55796..57061 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 57075..57950 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 57947..58759 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 58786..60558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 60562..61332 product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 61325..62188 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224955.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(62140..62949) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(62954..65632) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(65629..68382) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(68370..68552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 68624..69331 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 69350..69958 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 69979..70806 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 70811..71599 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(71803..72393) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 72513..74498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 74474..74698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 74704..76302 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 76339..77289 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 77446..78231 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 78228..79022 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 79093..79962 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 80133..80885 product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(81032..81991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 82120..82377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(82374..84095) product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(84098..85102) product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene hpnH CDS complement(85105..86523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(86520..88406) product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene shc CDS complement(88408..89376) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(89382..90734) product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene hpnE CDS complement(90731..91588) product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene hpnD CDS complement(91585..92427) product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene hpnC CDS 92533..93822 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(94365..96338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(96549..97235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(97308..98219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(98239..98988) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(99035..100285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 100868..101344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(101337..101855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(101898..102131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(102202..102969) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(103087..103806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(103812..104696) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 104804..105916 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152476683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 105913..106515 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(106532..109420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(109430..110449) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(110442..111380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(111377..111868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(111872..113092) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(113089..113961) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 114127..114945 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(114939..117671) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(117758..118555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(118858..120357) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(120358..120861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 120971..121825 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(121822..122790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(123025..123555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(123652..124320) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 124440..125492 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 125501..126586 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 126583..127641 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 127638..128609 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 128609..130138 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 130147..131097 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 131094..131921 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 131918..133216 product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 133207..134709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(134796..135206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 135205..135453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(135375..136190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 136265..137026 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 137075..138010 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 138010..138753 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(138737..141733) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(141848..142204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(142226..142657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(142657..143001) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(143085..146297) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 146372..147058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(147321..148205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 148451..148678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 148778..148954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(149020..149484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(149885..150850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 150944..151312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(151627..151941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(152154..153350) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673996.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(153446..154276) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 154364..155371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(155352..155696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 155743..156921 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(156958..157635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(157677..158288) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(158364..159404) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(159723..160889) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 160968..162185 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(162128..163570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 163735..164370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(164349..165098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 165508..165675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(166194..166697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(167748..168053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(168311..169486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(169560..170795) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185067440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(170782..171501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(171557..172798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(172836..173198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 173414..173989 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(173979..174677) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(174681..174968) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 175013..175831 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene map CDS complement(175905..177524) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(177692..178717) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(178765..178995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(178995..179840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 note possible pseudo, internal stop codon CDS 180046..180792 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(180877..182286) product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 182206..182538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 182595..183554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 183715..184623 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(184627..186063) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(186060..186767) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(186764..188314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(188329..189087) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(189084..189992) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 190307..190531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 190555..191064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(191033..191311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(191381..192232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 192147..192578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(192589..194199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(194299..195054) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 195100..195444 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(195441..197123) product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(197126..200212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(200229..202133) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 202337..203554 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(203683..205014) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(205011..208877) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 209096..209548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(209676..212384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(212384..212587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 212737..213390 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(213375..214343) product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(214337..215101) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(215098..215781) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(215778..216563) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(216560..217573) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(217570..218640) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 218817..220010 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(220022..220474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 220506..220844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(221052..221492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(221393..221770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(221798..222097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(222191..223243) product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 223275..223709 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(223772..224821) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(224829..225221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 225515..226900 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 226911..228353 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(228397..230427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(230623..231171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(231302..231535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 231636..233117 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(233148..233849) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 234136..234954 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(234955..236439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 236779..237030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 237200..238615 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 238612..239619 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(239601..239954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 tRNA 240020..240095 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 240116..240189 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(240328..240552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 240661..241347 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 241340..242614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 242666..243202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 243246..244010 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(244007..245383) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene zwf CDS 245520..246416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 246621..247256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(247302..248024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531677.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 248270..248944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(248969..250162) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(250184..250846) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 251026..251940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(251990..252265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(252451..255096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 255320..257902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 257983..258801 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene fmt CDS 258857..259669 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(260235..260477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 260458..260751 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(260825..262303) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 262402..263031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 263292..263627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 263768..266212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 266228..267901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(267883..268587) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(268584..270590) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 sequence003 source 1..741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence004 source 1..722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence005 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence006 source 1..680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 note possible pseudo, frameshifted sequence007 source 1..659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence008 source 1..647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227281.1:DoxX family membrane protein locus_tag LOCUS_16220 sequence009 source 1..640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence010 source 1..637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence011 source 1..621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence012 source 1..616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence013 source 1..266557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1272..1622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1700..1900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 2076..2657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(2761..3225) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(3265..4269) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 4340..5926 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(5895..6137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(6139..6360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 6637..6879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 7164..7427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 7466..8338 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(8279..8773) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 8883..10076 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 10158..11060 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 11066..11806 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 11821..13080 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 13077..13700 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(13697..14104) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(14097..15095) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(15368..15949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(15946..16758) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(16755..17687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(17660..18817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 19077..19505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 19571..19834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 19868..20350 product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 20357..20569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 20673..23267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(23275..23472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(23593..24111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(24130..25764) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(25856..26716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 26860..27363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(27493..29157) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(29170..29961) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(30446..30853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(30858..30989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 31244..32806 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(32858..33142) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 33229..33510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 33580..34404 product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 34502..35647 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 35728..36165 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 36162..36662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 36659..36931 product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 37254..37457 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(37552..37755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(37845..38798) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 38893..39768 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 39765..40778 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(40766..40915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(40936..43065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(43179..44462) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 44361..44621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(44570..45259) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 45397..46272 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 46363..47544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 47624..48814 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 48878..49393 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(49368..51527) product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 51705..52334 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 52331..53194 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 53205..54359 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 54394..54930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227143.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(54981..55877) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene pdxS CDS complement(56148..56564) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(56561..56995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 57019..57615 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene pdxT CDS 57634..58386 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 58430..58981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 59044..59592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(59982..60518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 60623..61186 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ruvC CDS 61183..61782 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene ruvA CDS 61779..63818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 63961..64347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 64516..66381 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene secD CDS 66383..67591 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene secF CDS 67656..68192 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 68353..70788 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene relA CDS complement(70837..71667) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(71720..72583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 72714..73412 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 73437..74747 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene hisS CDS complement(74734..74997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 74969..75898 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 75951..77525 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726877.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 77569..80301 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene cphA CDS 80773..82824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 83091..83345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 83459..84379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(84406..85149) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(85187..85906) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene ureG CDS complement(85896..86540) product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(86543..88261) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(88258..88644) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(88641..88943) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(89070..89450) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(89425..90672) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 90973..91182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 91217..91648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 91635..92846 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 92889..93653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 93737..94435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 94506..96308 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027660890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene aspS CDS 96321..97142 product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 97153..97641 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 97728..98432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 98506..98724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 98811..100442 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 100439..103774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 103850..104302 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 104322..104594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 104591..107275 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene alaS CDS 107337..107795 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene ruvX CDS 107792..108985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 108996..109826 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 109884..111062 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene aroC CDS 111062..111565 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 111648..112568 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(112553..113236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 113345..114406 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene aroB CDS 114403..114891 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene aroQ CDS 114898..115455 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene efp CDS 115457..115891 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene nusB CDS complement(116408..116902) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(116963..117613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 118185..118676 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(119090..119578) product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene bldD CDS 119887..120447 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene pyrR CDS 120444..121367 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 121364..122629 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 122689..123786 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene carA CDS 123789..127142 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene carB CDS 127145..128143 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 128140..129417 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 129501..130331 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene pyrF CDS complement(130239..130433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 130517..130834 product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene mihF CDS 130867..131466 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene gmk CDS 131496..131759 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rpoZ CDS 131941..133158 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene coaBC CDS 133234..134424 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene metK CDS complement(134483..136564) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 136832..138058 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 138100..138657 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene def CDS 138663..139589 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene fmt CDS 139586..141058 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(141055..141927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 142021..142689 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene rpe CDS 142686..143720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 144119..145198 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene ribD CDS 145218..145817 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 145810..147015 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 147066..147542 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene ribH CDS complement(147549..147929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(147929..148333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(148454..149194) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(149194..150081) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(150078..150950) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 151027..151290 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 151336..152178 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene hisG CDS 152187..152636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 152891..153580 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene infC CDS 153650..153844 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene rpmI CDS 153880..154272 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene rplT CDS 154533..155309 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 155309..156307 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 156489..157550 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene pheS CDS 157556..160036 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene pheT CDS complement(160114..160860) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(160898..161608) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 161667..162029 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 162068..162739 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 162767..163528 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(163554..164312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(164309..165004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 165092..166237 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 166234..166869 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 166913..167920 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 167996..168739 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 168741..170633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 171032..171763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(171741..173435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 173616..174077 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(174256..175323) product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(175359..176723) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 176824..177309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 177423..177707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 177704..178096 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 178193..178765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(178768..179979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(180009..180713) product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(180738..182987) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(183185..183418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(183467..183943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 183893..184549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(184500..185249) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 185387..186388 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene argC CDS 186385..187557 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene argJ CDS 187554..188462 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene argB CDS 188459..189607 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 189604..190527 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene argF CDS 190524..191024 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 191021..192223 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 192230..193651 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene argH CDS complement(193648..194730) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(194779..196167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(196164..196673) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 197105..197713 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 197724..198299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(198272..199339) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 199684..201627 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 201637..202893 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 202890..203660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 203650..204723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(204856..205860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(205863..207080) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(207094..208107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(208131..209273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(209270..210478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(210475..211755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(211748..213430) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(213453..214682) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(214688..215836) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(215829..216611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 216811..217827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(218997..219233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(219249..219479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(219567..220616) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 220858..222075 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 222106..223662 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 223731..224561 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 224558..226327 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene malZ CDS 226339..231681 product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene pulA CDS 231937..232548 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 232628..234124 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(234203..235081) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 235155..235988 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 236149..237093 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 237090..237881 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 237966..238646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 239148..239351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(239421..240401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(240398..240754) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(240828..242762) product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 tRNA 241313..241404 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(242881..244305) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 244442..246418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(246403..246816) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 247087..247608 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(247983..248192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 248191..248460 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125586694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 248457..248726 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 248820..249104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(249153..250106) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(250280..251713) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 251804..252817 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 252852..254018 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 254020..254853 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 254850..255665 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(255958..256245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(256492..257046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(257088..257825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(257925..258539) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 258880..259755 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 259748..259951 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 260060..260788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(260823..261359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 261427..261957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 261970..262602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 262612..263265 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(263247..263948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 264064..265338 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene tyrS sequence014 source 1..614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence015 source 1..611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence016 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 sequence017 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence018 source 1..594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence019 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence020 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence021 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence022 source 1..584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence023 source 1..261535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..3000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 3003..3611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 3616..4182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(4186..4710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 4592..4912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 4953..5495 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 5512..5823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 5881..6252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(6360..7247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 7441..10446 product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 10730..11299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 11305..12234 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103759610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 12231..13070 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 13080..14048 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006494597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 14081..14764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 14962..15408 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(15428..15799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(15811..16638) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 16739..18583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 18650..19144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 19141..19494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 19491..20522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 20561..20863 product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(20987..21310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(21410..21754) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 21814..22815 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 22866..27575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 27654..29030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(29035..29655) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(29665..30504) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 30710..34432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(34441..35337) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 35709..35948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(35929..37380) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 37433..38866 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(38912..39472) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 39965..41119 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(41169..42188) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(42479..42940) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene smpB CDS complement(42980..43243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 43385..45568 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 45642..46640 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(46753..47535) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 47607..47930 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 48003..50207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(50182..50892) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 50891..51652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 51850..52488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(52452..53687) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(53684..54535) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 54601..54939 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 54906..55532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(55657..56700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 56842..59028 product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(59064..59441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(59598..59963) product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 60105..60476 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 60592..60999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 60996..61331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 61649..62161 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 62240..63262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(63226..64443) product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(64596..65714) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(65714..67162) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 67303..67998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(68106..69290) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 69499..69909 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(69842..70918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(70915..71391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223694.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 71573..74254 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene ppdK CDS 74475..74885 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(75009..75371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(75663..77681) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene recQ CDS complement(77841..79781) product sigma-F factor regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(79816..80457) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 80606..81298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(81374..82459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(82521..83288) product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(83285..84313) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(84310..84708) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(84714..85688) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 85838..86563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(86673..87554) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 87693..88286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(88293..89132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 89213..89614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(89538..89903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(89961..90734) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 90788..91552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 91668..91946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 92228..92572 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 92610..93122 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098468.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 93171..94736 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene gntK CDS 94988..97108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 97108..97707 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene cobO CDS 97701..99056 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 99296..99667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(99977..101455) product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(101623..101847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 101912..102757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 note possible pseudo, internal stop codon CDS complement(102720..103244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 103535..105580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 105739..106866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(106863..107603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 107716..110019 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene secA2 CDS 110383..110934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 110944..111576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 111742..112158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 112230..113111 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(113088..113879) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(113873..114655) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 114765..115013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 115016..116272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(116282..116701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 116764..117273 product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(117233..117937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(117937..120564) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(120589..121461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(121469..121729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003056176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 122112..122951 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(122948..124126) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(124204..124389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(124393..124773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 124905..127454 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(127498..128517) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(128591..129178) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 129256..130563 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 130585..131265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(131314..131505) product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 131767..133761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(133954..134949) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 135065..136138 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 136138..136818 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 136915..137511 product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 137508..138323 product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(138333..139604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 139722..140960 product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene mshC CDS 141875..142177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(142518..143309) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(143411..144280) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(144491..145045) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene hpt CDS 145195..146025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(146034..146474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 146524..147063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 147075..147503 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 147505..148425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 148595..149077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(149171..149872) product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(149908..150891) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 151036..151698 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(151722..154250) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(154250..155002) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 155203..155712 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 155742..156560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 156560..156700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(156710..157438) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(157456..158436) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 158569..159777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 159777..160727 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 160813..161412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(161563..161856) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 162031..163812 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene arc CDS 163873..165105 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 165171..166670 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene dop CDS 166750..166965 product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 166943..167674 product endonuclease VII domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 167593..168432 product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene prcB CDS 168489..169340 product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene prcA CDS 169407..169802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 169922..171280 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene pafA CDS 171330..171506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(171583..172623) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 172881..173816 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(173773..174294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 174293..174940 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(175581..176642) product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(176653..177693) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 177786..178766 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 178763..179725 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 179735..179968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 180132..180461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 180461..181423 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene tatC CDS 181442..182332 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 182410..182877 product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 182888..183436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(183416..184096) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 184244..186997 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 186999..187817 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 188690..189034 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 189028..190377 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(190445..191668) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(191665..192246) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 192683..193162 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 193159..193863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(194139..194747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 194867..195595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 195612..196127 product aminoglycoside nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123821061.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(196162..196695) product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene aac(2')-Ic CDS 196717..197709 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 197715..198461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(198466..199272) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene hisN CDS complement(199432..200130) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 200246..201238 product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(201294..201920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(201917..203188) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(203192..204124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(204186..206345) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(206342..207502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(207499..208449) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(208449..209744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(209848..211410) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(211477..213861) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene pepN CDS 213946..214338 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(214948..215319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 215476..215817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(215903..216328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 216857..217465 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 217551..219047 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(219024..219926) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(220046..220531) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(220528..220851) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(220874..221377) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(221395..221733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(222015..222599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(222581..222823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 222734..223234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(223463..223882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 223974..225356 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(225337..226605) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene lysA CDS complement(226626..227615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 227854..235254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(235367..235852) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 235904..236539 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 236631..237491 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(237592..238506) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(238503..239522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(239615..240988) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(241274..242638) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 242988..245894 product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 245896..246978 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(247029..247718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 247896..248783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 248858..249919 product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 249942..250658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(250668..253370) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(253428..253994) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(253991..254677) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 255132..256430 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 256445..259585 product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 259587..260834 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 misc_feature complement(260789..>261535) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899482.1:IS607 family element RNA-guided endonuclease TnpB locus_tag LOCUS_21490 sequence024 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence025 source 1..576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 240..512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 sequence026 source 1..570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence027 source 1..561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence028 source 1..558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence029 source 1..543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence030 source 1..541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence031 source 1..539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence032 source 1..532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence033 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence034 source 1..255050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..2464 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2421..6017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(6014..6994) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene cydB CDS complement(7007..8368) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 8448..8798 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058519.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 8803..9711 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 9987..10964 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(11071..12042) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 note possible pseudo, internal stop codon CDS complement(12085..12264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 note possible pseudo, internal stop codon CDS 12390..13580 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 13577..14719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(14815..15561) product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(15652..17007) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(17008..17667) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 17771..18883 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 18947..20110 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene trpB CDS 20107..20928 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene trpA CDS 20849..21619 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(21628..21897) product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 21976..22359 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(22348..23961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(24049..24687) product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 25127..27133 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 27182..28471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 28468..30378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(30323..32941) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(32938..33729) product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(33795..35216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(35470..37617) product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(37628..38902) product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(38947..39825) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 39953..40531 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 40564..42252 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(42519..43010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(43007..43564) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(43623..44009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(44077..45036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(45961..48408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 48534..49730 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(49744..50385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 50423..51130 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229271.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(51153..53243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(53283..53549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(53580..54365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(54362..55315) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 note possible pseudo, frameshifted CDS 55391..56692 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 56689..57399 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(57549..58727) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 58922..60403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 60493..62736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 62988..64625 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene pgi CDS 64659..65747 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045248209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 65812..67140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 67628..68722 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 68719..69324 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 69448..70011 product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 70028..71410 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(71422..72108) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(72237..73430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 73684..75744 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(75695..76393) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 76657..77652 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730166.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 77767..78240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(78242..78898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 79060..80229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 80293..81027 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 81040..82530 product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene phoR CDS 82616..83767 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 83764..84465 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 84462..85637 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 85646..86176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 86251..86433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 86527..89190 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 89361..89618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(89702..90709) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 91248..91898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 91933..93462 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 93459..94064 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(94105..95859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 96083..96448 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(96409..96648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(96645..97319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(97411..99921) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(99929..100693) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 100896..101846 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene iolC CDS 101839..102696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 102696..103586 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene iolB CDS 103583..105436 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene iolD CDS 105447..106943 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 106986..107933 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 107930..108922 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 108936..110000 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 110002..110817 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 110823..111839 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399736.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 111893..112756 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 112857..113726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229446.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(113748..114254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(114886..115368) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899141.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(115365..115682) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 115911..116150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(116256..117257) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(117254..118420) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013443.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 118526..119527 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 119745..122858 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ileS CDS complement(122923..124074) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 123959..124180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(124194..124733) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 124863..126533 product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene paaN CDS 126551..127753 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 127750..128478 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 128475..129338 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 129398..130252 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene paaA CDS 130249..130536 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene paaB CDS 130545..131414 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene paaC CDS 131408..131899 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene paaJ CDS 131901..132953 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene paaK CDS complement(133015..133644) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(133680..134387) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(134398..134724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 135428..136378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 136518..137642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 137792..138481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(138466..141948) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110240682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(142068..143252) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(143271..143936) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 144023..144490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(144473..145129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(145198..145416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 145577..146389 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 146386..147390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 147387..148727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 148780..151530 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(151527..154262) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(154350..154916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(154938..155921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(156019..157242) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(157332..158876) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(158909..159271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(159315..161618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(161685..162962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(162959..163888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(163909..164829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 165582..166535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 166588..167499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 167771..168235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(168180..169316) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(169385..169612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(169987..170544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(170597..171313) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(171318..172130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(172127..172978) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(172975..173931) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(173936..175453) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742127.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(175455..176135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(176237..177313) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene speB CDS 177410..178348 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(178476..181016) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(181013..181744) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 181858..183084 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 183128..183784 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(183798..184667) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(184664..186142) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(186156..186458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 186376..186726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 186782..187576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 187631..188872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 188920..189363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 189360..192278 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 192271..193029 product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 193142..193903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(193961..195379) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(195445..196356) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 196427..197323 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043688023.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 198246..198983 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(198989..203455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(203554..204426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 204540..205232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(205303..206100) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene yaaA CDS complement(206110..206454) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(206518..208170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 208284..209927 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene pgm CDS 210018..212279 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(212269..213711) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene gndA CDS 213968..214282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 214448..216307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 216328..218214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(218168..219058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 219205..220392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 220373..221623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 221680..222012 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 222009..222467 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(222534..222944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 223874..224137 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 224582..225886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(226079..227098) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene pstS CDS complement(227109..228380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 228528..229553 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125591658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 229658..230644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 230650..231099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 231105..231341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(231367..232155) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(232171..232935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(232932..233714) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(233711..233869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 233988..234752 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 234955..236337 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 236467..237777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 238439..239437 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(239403..240476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(240473..241180) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225346.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 241294..242367 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(242421..243422) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 243541..244476 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene rihA CDS complement(244449..245594) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(245635..246375) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 246394..247170 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene pcaH CDS 247167..247691 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene pcaG CDS 247702..248835 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728464.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene pcaB CDS 248829..249971 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene pcaD CDS 249968..250630 product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 250627..251262 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 251398..252156 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(252101..253753) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 sequence035 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence036 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence037 source 1..507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence038 source 1..254510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(1679..2518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2705..3808 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene mraY CDS complement(3816..4322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 4438..4920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(4997..5989) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(5986..6615) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(6620..8569) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(8566..9774) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(9771..10520) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(10575..11702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(11753..13600) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 13753..14940 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(14945..15490) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(15560..16369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(16369..17475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(17475..17747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(17747..18070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 18269..18610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(18613..19227) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(19224..19892) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(19914..20585) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(20655..21101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(21162..21986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 21930..22190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(22174..22428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 22316..22993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 23058..23816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(23809..25188) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(25233..25406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 25925..26065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(26062..27210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 note possible pseudo, internal stop codon, frameshifted CDS complement(27327..28151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 28334..29998 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene alsS CDS 29995..30768 product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene alsD CDS 30833..31633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 31745..32548 product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(32630..32854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(32851..34431) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(34569..35618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(35527..35835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(35868..36605) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(36596..37330) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(37327..38280) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 38563..39183 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 39224..40126 product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(40339..40707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(40715..41485) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 41560..42123 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 42236..42742 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157890372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 42742..43734 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 43731..45935 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(45928..46836) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 46937..47572 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(47559..49025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(49120..50019) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(50016..50915) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 50930..51940 product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(51919..53163) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(53175..54902) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 55027..56760 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230530.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 56774..58174 product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene ngcE CDS 58178..59083 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(58987..59334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 59240..60061 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 60137..60742 product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 60739..61260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(61392..61538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(61548..62750) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 62891..63067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(63142..64986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(64983..65738) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(65735..66640) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(66655..67719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(67716..68684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(68681..71245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(71242..72768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(72778..74511) product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(74508..76538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(76535..78145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(78156..78341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(78350..78631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 78873..79865 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(79886..80278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 80388..80606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 82665..83150 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(83263..85713) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene ppsA CDS complement(85838..86725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 86618..86857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 86883..87122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 87112..87519 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 87882..88376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 88578..88940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 88955..89368 product spore-associated protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(89388..90137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 90396..91568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 note possible pseudo, internal stop codon CDS complement(91555..91782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 91809..92498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 92657..93172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(93118..94080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(94237..94998) product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene lieB CDS complement(94995..95759) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(95774..96616) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(96658..97197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(97229..100255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 100379..100759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 100809..101138 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 101135..101605 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(101588..102544) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(102587..103714) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 103937..105163 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224782.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 105364..107808 product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 107909..108490 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 108503..109213 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(109210..109662) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(109768..111084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(111081..112493) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 112673..113197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(113198..113824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(113921..116512) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 tRNA complement(115272..115363) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 116685..117053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 117086..117343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 117340..118959 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(118987..119256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(119344..120219) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229089.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(120216..121493) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 121492..123102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(123099..123689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(123722..124735) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene macA CDS 124867..125274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(125271..126050) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 126144..128261 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene ligA CDS 128811..129218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(129287..129490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(129558..130478) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 130806..131003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 131115..133430 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 133602..135320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 135439..135990 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 135987..136775 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 136790..137590 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 137587..138906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 138903..139475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(139491..140462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(140459..140821) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(140832..141821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(142633..145371) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 145519..147804 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(147890..148165) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(148165..149082) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(149069..150325) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(150312..151181) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(151178..152197) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530846.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(152194..153570) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(153570..154055) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(154066..154938) product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 155047..155871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 155989..156615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 156716..157120 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(157033..158205) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110568702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene alr CDS complement(158202..159170) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 159420..160559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(160800..161612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 161791..163119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 note possible pseudo, internal stop codon CDS 163219..165036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 note possible pseudo, internal stop codon CDS complement(165077..166228) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(166431..166964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 166861..167139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 167391..169847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(169848..171080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(171171..171953) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031850.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 172116..173933 product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230690.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 174029..174535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(174530..175207) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(175217..176449) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 tRNA complement(176180..176269) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(176483..176887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(176893..177750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 177671..177889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 178007..179041 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 179557..181923 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 note possible pseudo, frameshifted CDS complement(181929..182888) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(182885..183991) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 184154..184735 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 184757..185743 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967883.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(185807..188197) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene lon CDS complement(188210..189622) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene argG CDS 189775..190905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 190962..192275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 192425..192991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 193054..193863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(193865..195601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(195626..195877) product SCO4226 family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(195961..196764) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(196774..197337) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(197446..198615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(198660..199985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 200684..202087 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 202511..203533 product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 203588..205255 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(205240..206544) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 206742..208040 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 208045..209016 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 209020..209850 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(209828..210295) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(210370..211467) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 211835..211954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(212003..212647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(212727..213422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(213376..213954) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 214109..214933 product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026918.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 214930..215613 product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226847.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(215650..216600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(216645..217433) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 217621..219270 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 219343..220350 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 220347..221306 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 221313..222296 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 222293..223390 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(223393..223923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(223920..224537) product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(224746..227478) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731565.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 227609..229228 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 229295..229933 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 229952..230710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 230707..231042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 231144..231971 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 232049..232768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 232972..233934 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 234038..234475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 234535..234807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 234791..238966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(238973..240940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 241027..241920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 242090..242941 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 242995..243567 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 243660..244439 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(244765..245007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 245266..246549 product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(246598..246888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 246956..247975 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(248027..249223) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091269089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 249498..250280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 250277..251461 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene fahA CDS complement(251455..251850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 251819..251998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(252451..252747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(252744..253490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(253493..253828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(253847..254143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 sequence039 source 1..224532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 567..1091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(987..2084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2091..2264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(2331..2891) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 2966..3523 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 3520..6609 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(6535..7329) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(7326..8309) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(8366..10489) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(10563..11777) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(11701..13089) product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 13130..14896 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(14922..15374) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 15454..16506 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(16478..16846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 17349..17582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 17617..18501 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 18660..18785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(18821..19015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(19035..22028) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(22031..22840) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 22839..23663 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(23814..24239) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(24299..25651) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene glnA CDS 25866..26696 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene panB CDS complement(26738..28159) product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(28227..29996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(30118..30372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(30466..31473) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 31637..32398 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(32399..33001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(33049..34167) product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(34242..35135) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 35202..36425 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225406.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 36430..36861 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 37177..38235 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene gap CDS 38245..39159 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(39265..39681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(39678..41345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(41465..42478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(42528..43670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(43699..50553) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 51035..51388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 51385..51939 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026983.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 51955..52479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(52457..53035) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(53045..53809) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(54373..55650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 55924..56199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(56359..57183) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(57173..58072) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(58081..59322) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(59338..60936) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(60929..61996) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 62205..63071 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 63103..63564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 63561..64415 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(64412..65563) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 65728..67008 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene purF CDS 67013..67417 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(67382..67963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(68032..69678) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(69683..69910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(70108..71397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(71560..72690) product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(72687..73421) product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(73418..74275) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(74325..74909) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(74954..76189) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 76430..76822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 76777..77109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(77207..77776) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 77845..78681 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(78723..79574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 79482..79727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 79806..80309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 80332..80961 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731532.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 81016..81561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(81610..82563) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(82584..82892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 82891..83670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 83704..84267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 84264..84683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(85149..85574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 tRNA complement(85667..85739) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(85772..86236) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(86301..86732) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(86831..89101) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 89123..89572 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 89731..92469 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene aceE CDS complement(92525..92866) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(92884..93417) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 93640..94881 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 94895..96304 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene gltX CDS 96611..97282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(97300..98100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(98097..98576) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(98624..99184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(99277..99528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 99729..100931 product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene fasR CDS 101097..102041 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 102038..102988 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 103039..103281 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 103283..104509 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(104561..106288) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(106373..106864) product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 107100..107426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(107547..108167) product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene canB CDS 108343..109287 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 109441..111564 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(111569..112504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 112693..113607 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 113748..114056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 114142..115074 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207897272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 115071..115913 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(116072..116434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 116751..117146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 117184..117759 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 117846..119252 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 119298..120152 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 120216..120569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(120606..121448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(121385..121966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(122416..124041) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene argS CDS 124187..124642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 124693..125190 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(125233..126042) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 126171..126872 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728686.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(126945..128426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 128491..129078 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(129071..131641) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173444.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(131720..132274) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 132558..133820 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene urtA CDS 133877..134764 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene urtB CDS 134761..135819 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene urtC CDS 135816..136556 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene urtD CDS 136553..137248 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene urtE CDS complement(137383..141012) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 141276..141836 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 142007..144310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 144320..144712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 144835..146415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(147017..149041) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 149209..152952 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(153085..154083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 154248..154505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 154490..154891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(154926..155126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 155295..156020 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(156017..156619) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene wrbA CDS 156700..157350 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027418.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 157372..158334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 158331..158942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 158939..160261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 160258..161214 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 161222..162538 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(162550..163539) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(163614..164768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(164779..165579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(165662..166192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(166189..166941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 167131..167520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 167517..169640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 169637..170398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 170382..173624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 173668..174528 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223050.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 note possible pseudo, frameshifted CDS complement(174719..177988) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 178117..178605 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 178598..179332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(179475..180008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(180127..182424) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(182503..184458) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(184455..185891) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(186009..186773) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 186840..187679 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(187664..188320) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(188317..189447) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 189534..190949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 191012..191194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(191168..191614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(191664..192665) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(193383..196955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(196952..197329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(197497..197970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 198429..198881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 199120..199575 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 199914..200252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(200324..201172) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 201242..202213 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(202300..203121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 203441..205888 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 205885..207429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 207548..207790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 207720..207947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 207987..209429 product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 209470..210243 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 210387..211466 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 211474..213021 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 213014..213973 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 213970..214971 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 214968..216008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 216261..216806 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 216803..217528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 217525..220245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 220395..220580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(220582..221424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(221797..223038) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 223016..223342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 223608..223811 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 sequence040 source 1..217757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..1746 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(1741..2865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 2950..3411 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 3408..4229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 4360..6942 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 6939..9419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 9520..10233 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 10295..10603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 10600..11436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 11512..13512 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene thrS CDS complement(13625..16333) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 16418..16666 product SCO4226 family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(16642..17376) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene pnuC CDS 17433..18455 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 18522..21548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 21545..24544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 24601..25254 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(25441..26283) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 26364..27302 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(27609..28646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 28795..29508 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 29568..31607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 31860..33569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 33837..35027 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene tuf CDS 35088..35693 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(35686..37926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(38032..38370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(38381..39250) product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 39488..39868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(39888..42974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(42977..43273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(43270..44025) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(43995..44594) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 44675..45412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(45488..47362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 47598..48341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(48434..50713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 50996..52210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 52307..53041 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 53038..53931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 53945..54904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 54901..56142 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 56235..56549 product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(56615..57760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(57805..58269) product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(58373..59266) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(59305..60504) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(60501..62822) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(62815..63876) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(63954..66731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 66810..67457 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(67461..68462) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 68559..69659 product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(69918..70880) product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(70996..72612) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 72764..73777 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(73774..74808) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 74965..76362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(76476..77045) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226392.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(77423..77794) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(77930..80959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 81257..81625 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 81630..82847 product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 82920..83609 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 83602..84921 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(84926..85702) product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(85860..88685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 88856..89464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 89611..91662 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 91672..95481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(95491..96156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(96217..96381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(96563..96910) product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 96957..97805 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 97970..98971 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 99050..100738 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 100801..101853 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 101850..102830 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 102835..103884 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 103885..104889 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 104886..106274 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 106339..106857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(106977..108179) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 108300..109124 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 109226..109435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 109576..109791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 109837..110565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 110712..111713 product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(111687..111845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 111887..112531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296444.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 112563..115208 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304129.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 115220..115756 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(115766..116659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(116787..117611) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(117608..118516) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(118516..119871) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(120234..121229) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838101.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(121399..122937) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 123206..124033 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(124133..124648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 124854..127160 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(127203..128102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 128322..128837 product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(129349..130623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(130620..131048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776555.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 131248..131598 product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(131656..132543) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(132558..133016) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(133086..134228) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(134311..134706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 134870..136651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 136661..137659 product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene fgd CDS complement(137664..138236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 138512..139168 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 139280..139471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 139505..139810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(139847..140956) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 141034..142626 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 142953..144692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 144689..146608 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 146770..148581 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene ggt CDS 148622..149656 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(149843..150289) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218060570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(150286..150783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(150776..151297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(151325..152197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(152194..152901) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 153218..153889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 154104..154718 product IS607-like element ISTko2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250792.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 154715..156127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 156245..157276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 157333..157719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 157730..158395 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene trmB CDS 158437..160446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(160563..161258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 161371..162009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 162028..162768 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(162770..163675) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 163916..164608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 164618..165046 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899059.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 165287..165862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(165859..167337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(167342..167572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 167627..168547 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene panE CDS complement(168558..169937) product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene tnpB CDS 170466..172577 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene glgX CDS 172579..174849 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene treY CDS 174846..176579 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene treZ CDS 176622..177236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 177246..177743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 note possible pseudo, internal stop codon CDS 177736..178755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 178847..179569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 179661..181979 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(181956..182384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(182381..184927) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene hrpB CDS 185069..185575 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene uraD CDS 185565..185927 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene uraH CDS 185934..186794 product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene pucL CDS 186791..188146 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 188355..189875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 190051..191598 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene aceB CDS 191598..192740 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(192744..193751) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 193970..195256 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene allB CDS 195355..196248 product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene alc CDS 196248..196574 product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(196602..197663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 197763..199061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 199194..200390 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 200390..201244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 201312..201701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 201733..203304 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(203305..203832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(203829..204899) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(204922..205188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(205188..205760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(205856..206827) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(206987..207427) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(207651..208508) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 208581..208973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(208970..209581) product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(209583..209819) product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(209912..210106) product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(210148..210918) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(211104..213224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(213353..213682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 213784..214620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(214617..215408) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(215453..215905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(215907..216347) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 sequence041 source 1..206952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..2050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 2047..2496 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 2493..3161 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227870.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 3235..4374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(4375..5355) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 5393..6595 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(6567..7718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(7715..8227) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 8367..8534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(8528..9409) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(9544..12900) product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031394.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(13077..14150) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(14147..14806) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 14938..15795 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222010.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(15832..17367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(17360..18205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(18210..20462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 20832..21329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 21329..22693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 22690..23973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 23988..25100 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 25097..27874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 27871..28311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 28425..28922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 28919..31633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 32759..33634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 33796..35256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 35316..35978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 36112..36795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 37158..38225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 38676..38888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 tRNA complement(39739..39814) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 39957..41195 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 41331..42575 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 42659..43051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 43198..44097 product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 44407..45399 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(45396..45746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(45776..46213) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(46262..46654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 47544..48332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 48987..49559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(49700..52282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(52420..53484) product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(53498..54241) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(54245..55183) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 55285..56247 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 56397..57227 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 57340..58092 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(58136..58726) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 58683..60260 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(60208..61443) product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene cypC CDS 61628..63625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 64133..64711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(64678..65673) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(65733..66692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(66704..67381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224872.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 67625..70678 product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 70675..71097 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 71087..71461 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 71442..72041 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(71982..73163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 73323..74117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 74191..75252 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 note possible pseudo, frameshifted CDS 75491..77206 product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(77260..78393) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224920.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 78444..78923 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(78911..79918) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 80116..81303 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene xylA CDS 81317..82717 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene xylB CDS 82769..84193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(84101..85726) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(85746..86450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(86483..87358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(87528..87671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(87712..88458) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(88455..88703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(88713..89297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 note possible pseudo, internal stop codon CDS 89479..90168 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene tmk CDS complement(90262..90948) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 91537..92541 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(92628..93587) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(93916..94236) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(94247..94705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406940.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 94774..95016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 95016..95534 product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(95639..95791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 96285..96488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 96528..97316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(97458..97769) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230429.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(97949..99664) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(99661..100131) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(100195..100788) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(100824..101300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 101521..102177 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(102386..102730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 102792..103904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(103950..105164) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene serA CDS complement(105361..106272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 106423..107307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(107285..108397) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(108406..109062) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 109172..109735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 109732..110778 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 110775..111437 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 111434..112594 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 112721..113104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(113037..114353) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(114380..115543) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227743.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(115645..116490) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(116487..118400) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(118404..119168) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 119322..120497 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259470.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 120494..121243 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 121240..121935 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 121936..122802 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 122799..123782 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(123757..126048) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene ptsP CDS complement(126048..126674) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene dhaL CDS complement(126680..127681) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene dhaK CDS complement(128678..129520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 129757..131034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 131613..131831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 131815..132333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 132314..133165 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 133247..133411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 133380..133646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 133643..133966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(134222..134605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 134689..134931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 134928..136130 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 tRNA complement(136223..136296) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(136494..136931) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 137272..137748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(137769..138389) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 138529..139236 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(139328..140503) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(140760..141335) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 141416..142204 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 142291..143118 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(143120..144109) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 144280..144936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 145187..145738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 145747..146685 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 note possible pseudo, internal stop codon CDS 146682..148217 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 148210..148821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 148818..149882 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 149904..151259 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 151270..152763 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804070.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 152843..153139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(153183..156683) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 156682..156945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 157036..158589 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(158641..159705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 159807..161291 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 161463..162092 product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(162089..164383) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 164450..165502 product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene cobC CDS 165499..166563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 166560..167747 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene cobA CDS 167778..168155 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(168143..169576) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 169752..170246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 170410..172086 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene ettA CDS 172079..172486 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 172483..173142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 173274..173855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(173867..175120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(175196..175585) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(175662..177095) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(177294..178364) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 178601..179128 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(179206..180036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(180044..180547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 180822..181082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 181069..181530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 181675..182244 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(182245..184788) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene pepN CDS 184936..185565 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 185614..185856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 185867..187117 product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 187177..188091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 188119..188595 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(188754..189182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(189208..190428) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 190532..191119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(191135..192082) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(192036..192407) product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene hpxZ CDS complement(192394..194022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(194019..194690) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(194693..195385) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(195385..196983) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene atzF CDS 197129..197383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 197581..198216 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(198204..198521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 tRNA complement(198686..198757) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 198888..198962 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 198998..200347 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene tig CDS 200535..201164 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 201176..201841 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 202052..203341 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene clpX CDS complement(203501..204124) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 204196..204573 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 204644..205114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 205175..205972 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(206174..206389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 sequence042 source 1..204910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1166..2737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(2706..3110) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 3210..3572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(3552..6329) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 6566..6961 product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 7015..7686 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 7775..8419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(8406..8819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 9291..11453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(11424..11639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(11659..12612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 12754..14004 product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 14029..15582 product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(15546..16763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(17006..19099) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 19285..19848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 19827..21857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 21854..26974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 26962..28335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(28340..28531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(28583..29707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(29704..30204) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(30270..32264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 32360..32887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(32893..34362) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(34359..36164) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(36272..37627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(37761..40055) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 40253..41071 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 41005..41994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(41970..43556) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 43646..44161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(44065..45066) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(45063..46124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(46121..46570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(46567..48102) product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852612.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 48288..48704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(48708..50633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(51221..52690) product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222084.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(52747..53079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(53081..54832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 55078..56931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 56994..58610 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227841.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(58622..60592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 60755..61651 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228269.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 61648..62397 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228270.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 62412..63566 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228271.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 63563..64219 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030860.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(64228..66543) product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 66681..67160 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227655.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(67152..67841) product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(68049..68675) product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227628.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 68806..69252 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 69298..69588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(69677..69898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(70004..70495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(70753..71985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 72160..73356 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(73357..73968) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(73994..75235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(75369..76430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(76478..76783) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene rpsN CDS complement(76783..76950) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene rpmG CDS complement(76950..77195) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene rpmB CDS 77231..78469 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene zigA CDS complement(78496..78798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(78795..79631) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812031.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(79615..80499) product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene aztB CDS complement(80496..81251) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(81253..82218) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(82346..82633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(82708..83904) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229096.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 84190..85029 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(85089..85871) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(85868..88042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 88443..88925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(88960..89637) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074680.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 89824..91212 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 91381..92088 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968061.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 92155..92832 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705141.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(93013..93591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 93689..94798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 94839..95144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(95137..95973) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 96046..97275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(97245..97670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(98043..100139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(100244..100894) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(100914..101288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(101354..102823) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524102.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(102829..103821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(103836..104546) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 104756..105670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(105679..107091) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(107088..107282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 107458..107859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 108110..108943 product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 109021..109389 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086787.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(109386..112319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(112605..113387) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(113459..114376) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 114738..116885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(116891..117640) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(117610..117999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(118013..119017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(119271..120086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(120277..120630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 120698..121294 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(121358..123556) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 123730..125049 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 125013..125726 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 126756..126884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 127119..128117 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 128398..129024 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(129372..130067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(130360..131652) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879259.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 131905..133362 product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226093.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(133545..133898) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(133919..134590) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 134634..135227 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026857.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(135212..135865) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 136123..138897 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 138975..140696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 140744..141595 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(141806..142156) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 142146..142901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(142898..143455) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729010.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 143558..144442 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 144721..145089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 145086..146999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 147055..147255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 147266..148054 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(148170..149192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 149458..149652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 149649..150368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 150365..151018 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(151005..153263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 153556..153930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 154058..155671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 155964..156851 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(156904..158301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(158411..158932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(158904..159524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 159950..161476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 161373..162365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 162414..163673 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(163704..164423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(164522..164926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(164926..165357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 165856..166107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(165993..166868) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 166949..167752 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 167989..170751 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225365.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 170885..173665 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 173773..174693 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 174726..175406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(175812..177857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 178124..179269 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845572.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 179535..179828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 179806..181248 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225850.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 181245..181997 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 181990..182682 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313865.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 182700..183950 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 183947..184819 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 184816..185844 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397979.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 185841..186521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(186531..187340) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(187337..187900) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(187989..188732) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 189149..190504 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 190501..191451 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 191451..192365 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528079.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 192365..193432 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211523.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 193432..194508 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene ugpC CDS 194512..195996 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 195989..197215 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 197340..198884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 199216..200691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(200849..201241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 201383..201865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 202055..203542 product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(203846..204682) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 sequence043 source 1..196610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 1153..3786 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 3783..5108 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 5105..5476 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(5576..8134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 8291..8707 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene ndk CDS complement(8704..9588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(9585..10346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(10352..11329) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(11360..12376) product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 12459..13217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 13232..13480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 13731..16850 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene ileS CDS 16999..17673 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(17670..17843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(17862..18998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 19103..19963 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 19976..22477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 22474..22860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 22917..24866 product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 24866..25639 product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 25794..29003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 29122..29613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 29818..30132 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene rplU CDS 30146..30403 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene rpmA CDS 30480..31976 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene obgE CDS 32034..32447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(32436..33455) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene trpS CDS 33658..36153 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene pepN CDS 36189..37691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 37774..38355 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene nadD CDS 38395..38784 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074555.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene rsfS CDS 38834..39463 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 39506..39916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 39954..40820 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(40738..41850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(41864..42673) product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 43434..44192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 44189..46627 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 46676..47308 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 47511..48485 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165922484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene holA CDS 48482..49003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 49116..49361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(49544..49810) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene rpsT CDS complement(49996..50964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 51019..51552 product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 51687..52397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 52445..54409 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene lepA CDS 54492..54767 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(54894..55556) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 55635..56270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(56277..58091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(58232..59101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319978.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(59153..59938) product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 60081..61184 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene hemW CDS complement(61187..61750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 61874..62896 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene hrcA tRNA complement(62379..62473) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 62914..64053 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene dnaJ CDS complement(64275..65453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(65560..66192) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 66284..66853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(66840..67670) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226682.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(67682..69067) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 69253..70383 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 70368..71138 product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 71152..72015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 72012..72374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 72371..73330 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(73763..74575) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 74696..75154 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230140.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 75197..75850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 75865..76596 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(76597..77403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 77721..79202 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 79199..80926 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726610.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(80923..83280) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230337.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 83331..84710 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 84837..85913 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 85936..86403 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene ybeY CDS 86406..87770 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 87763..88113 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(88052..88444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 88818..89711 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene era CDS 89821..90927 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(90932..91693) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(91894..92685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 92846..93616 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene recO CDS complement(93671..93859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 93917..94243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 94189..95310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 95350..96132 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 96132..96644 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230409.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(96657..97319) product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223969.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(97331..97624) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 97897..98115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 98112..98537 product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(98548..99216) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(99304..100233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(100255..100749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(100752..102455) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(102541..104319) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 104401..105417 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 105552..106835 product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030591.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene ngcE CDS 106832..107758 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 107766..108620 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 108632..108787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 108784..110094 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 110091..110951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 110948..113191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 113311..114012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 114018..114752 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223184.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(114749..115462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(115525..116169) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(116166..117590) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223179.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(117664..118692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(118689..119237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(119303..120115) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(120141..121571) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(121590..122162) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 122444..122689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 122686..124071 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene tnpB CDS 124084..124908 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 124940..125491 product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623980.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(125457..126083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730838.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(126104..126526) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(126523..126822) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(126829..127677) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(127747..128532) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(128529..129434) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(129478..129732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 129765..130103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 130121..130633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 130692..132071 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(132081..132575) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227140.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 132719..133441 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(133445..133897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 133863..135071 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene dusB CDS complement(135489..136688) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(136743..137822) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(137913..138284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(138385..138873) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978180.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(138908..139936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(139997..140377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 140648..141001 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 141023..142234 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 142246..144105 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene dnaG CDS 144102..144632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 144645..145643 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 145643..146401 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 146404..147213 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 147356..148477 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 148722..149975 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 149972..151705 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 151702..152718 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 152770..153816 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 153829..155031 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(155166..155480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(155542..156234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(156234..156545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(156542..156901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(156931..157311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(157308..158018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 158154..158606 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 158618..159208 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 159273..160472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(160465..160980) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 161079..161675 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(161749..161940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(161937..162383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(162906..163847) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 164495..165409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 165611..166618 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(166695..167054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 tRNA 167188..167261 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 167652..169856 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 170022..171284 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 tRNA 171370..171444 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(171446..172582) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(172585..172785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(172782..174533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(174530..174715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(174712..175191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(175188..176243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(176596..176802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(177000..177431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(177532..178263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 178602..179462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 179459..180166 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 180163..180987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(181060..186102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(186103..186480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 186844..187893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 188250..188594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 188573..188731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 188865..189335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 189345..189911 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(190157..191881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(191961..192434) product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(192492..193424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 193502..193870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(194385..195839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 sequence044 source 1..855868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1004..2110) product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene hpxO CDS 2300..3367 product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227097.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 3467..4810 product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(4816..5889) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(5933..6349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(6645..7031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(7050..8753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 9121..10716 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107018483.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(10713..15647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(15696..16451) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(16503..16856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(17020..17688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 18810..20144 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 20149..21183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 21222..22070 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 22296..22970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 23257..25002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 25197..25508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(25496..25909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(25906..27324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(27321..28352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(28349..28915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 29071..29355 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(29379..29777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(29758..30180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(30347..32764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 32838..33155 product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene bldG CDS complement(33145..34506) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 34487..35467 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 35530..37197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 37310..38449 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 38454..39686 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 39764..40270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 40311..41099 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 41122..42147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 42300..42836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 42836..43438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 43496..44149 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 44320..44826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 44830..45273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(45442..46197) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 47638..49755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(49817..50545) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(50589..51116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 51183..51761 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(51840..52583) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(52625..53422) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 53527..54084 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 tRNA 54281..54355 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 54462..54854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(54865..55473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(55466..55963) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 56092..56718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 56724..57386 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 57383..58453 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229874.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 58528..59028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 59025..59396 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 tmRNA complement(59663..60036) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(60075..60794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(60858..61334) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene smpB CDS complement(61439..62623) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(63024..64271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(64367..65242) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene ftsX CDS complement(65304..65930) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene ftsE CDS complement(66139..67251) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene prfB CDS complement(67342..67857) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 68224..69168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(69271..69780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(69985..70401) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 70487..70951 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 70989..71222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 71376..71984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(72090..75005) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene secA CDS 75097..76281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(76305..76925) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene raiA CDS complement(77228..78016) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893258.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(78025..79848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(79848..81587) product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080870.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene mtrB CDS complement(81617..82306) product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene mtrA CDS complement(82464..82667) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(82712..83584) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 83957..84220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(84754..85926) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene manA CDS complement(85946..86890) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(86912..88135) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(88135..88335) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 88516..89799 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 89833..91356 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 91478..91732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 92110..92946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(92943..93311) product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 93518..93994 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(94015..94272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(94556..97066) product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(97161..98132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 98243..99199 product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111920.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene cofD CDS 99307..100368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 100389..100946 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(101104..101658) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 101768..102355 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(102346..103461) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(103480..104631) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 104794..105507 product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 105537..106649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 106707..107030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(107027..108958) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(108975..109526) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 109667..110782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 110858..111466 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019283510.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene lexA CDS complement(111687..112139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(112271..113149) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711563.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene rocF CDS complement(113265..113927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(113936..114748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(114741..115034) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(115156..116868) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(116865..118505) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226856.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(118502..118825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(118982..119341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(119335..119664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 120036..121766 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 122596..122868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(122865..128135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(128547..129701) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 129790..131118 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 131226..136199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 136311..136976 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296703.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(137381..138118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(138115..138462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(139553..139975) product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975822.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(139985..140482) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene purE CDS complement(140483..141625) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(141638..143632) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(143693..146227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(146477..146836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(146853..147734) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene mca CDS 147837..148265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 148426..148920 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene greA CDS complement(148968..150218) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene ilvA CDS complement(150239..151600) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(151618..152769) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 152794..153207 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 153256..153915 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene msrA CDS 154009..154293 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 154290..154580 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 155168..155497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(155494..155664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 155785..157197 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 157253..158227 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene ppk2 CDS 158526..159437 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 159437..159949 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(160529..160819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 160928..161959 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230294.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 162002..162301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(162305..164416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(165088..166449) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(166453..166797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 166946..168007 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 168020..168811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 168880..170124 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(170171..170521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(170532..171353) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 tRNA complement(171479..171563) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(171639..172997) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(173097..173660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(173660..175009) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110439.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(175006..176019) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(176030..176605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(176602..177255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(177322..178062) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(178105..178572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(178659..179669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(179666..180016) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(180066..180974) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(180971..181462) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(181464..181961) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(181970..182587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(182678..183961) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene eno CDS 184135..184746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 184788..185450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 185485..186000 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 186334..186615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 186704..187096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(187076..187912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(188000..189616) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(189627..190667) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(190824..191582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(191641..192534) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(192564..196184) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene mfd CDS 196367..198127 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051183874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 198127..199866 product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 199863..201803 product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 201803..202810 product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 202912..205707 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene ppc CDS complement(205759..206502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 206682..207596 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 207589..208458 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 208455..209366 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 209366..210076 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(210115..211407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 211563..213071 product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957747.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 213163..214935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 214941..216323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 216320..217549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 217563..218438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 218435..219988 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 219985..220719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 220739..221701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(221691..222059) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 222145..222951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 224758..225987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 226207..226401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 226770..227018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 227789..228703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 228853..229161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(229236..230675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(230847..231791) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 231854..232807 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331969.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 232804..233718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 233800..234576 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 234573..235658 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene galT CDS 235670..236038 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(236321..237535) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783318.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(237824..238774) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene mdh CDS complement(238880..239473) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(239487..241049) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene purH CDS complement(241046..241663) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene purN CDS 241809..242168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(242219..243646) product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029881.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(243750..244634) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene sucD CDS complement(244639..245817) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene sucC CDS complement(246217..246621) product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 247013..247744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 247870..248616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(248618..251032) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene pcrA CDS 251201..253057 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 253303..253638 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(253678..254685) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(254678..255706) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(255714..256613) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(256606..257532) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(257690..259324) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(259539..260207) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(260204..261391) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 261656..263317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 263356..263670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 263686..264945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(264993..265874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(266168..267016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(267076..268026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 268232..268501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(268506..270053) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene guaA CDS complement(270151..271941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 272087..273148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(273152..274525) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(274575..275693) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222686.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(275706..277193) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene guaB CDS 277315..277716 product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(277743..278594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 278826..279215 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(279383..281005) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(281085..282767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(282764..283717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027770.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(283876..285060) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(285095..286351) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(286348..287163) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(287322..288428) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(288813..289355) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene ybaK CDS complement(289369..290544) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 290772..291086 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene groES CDS 291159..292805 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene groL CDS complement(292860..294635) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(294632..296323) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(296399..296653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(296663..297715) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene tsaD CDS complement(297708..298142) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene rimI CDS complement(298142..299059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(299144..299833) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887334.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(299846..300358) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene tsaE CDS complement(300355..301431) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(301428..302555) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene alr CDS complement(302601..304058) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(304141..304509) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 304665..304952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 304949..306397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(306406..308331) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene glmS CDS 308461..309345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 309362..310540 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(310610..311959) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene glmM CDS complement(312092..312589) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418308.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene rpsI CDS complement(312610..313053) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene rplM CDS 313733..314875 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(315025..315645) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(315626..315988) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467375.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(316020..316427) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(316424..319393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 319810..320967 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031490.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 320964..321713 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 321798..323015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(323057..324577) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene thiC CDS complement(324645..325406) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene thiD CDS complement(325403..325975) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907660.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene thiE CDS complement(325969..326751) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(326754..326954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(326951..327958) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085791.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene thiO CDS complement(327955..328596) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene thiE CDS complement(328734..330401) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(330413..331093) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 331124..331906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(331884..332696) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene truA CDS complement(332831..333367) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222625.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene rplQ CDS complement(333401..334423) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(334507..335133) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene rpsD CDS complement(335149..335556) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene rpsK CDS complement(335574..335954) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene rpsM CDS complement(336271..336492) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003886926.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene infA CDS complement(336729..337364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(337393..337872) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(337901..338734) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene map CDS complement(338736..339389) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(339458..340804) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene secY CDS complement(341046..341495) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene rplO CDS complement(341495..341677) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene rpmD CDS complement(341677..342300) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene rpsE CDS complement(342314..342709) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene rplR CDS complement(342706..343245) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene rplF CDS complement(343263..343670) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene rpsH CDS complement(343790..343975) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(343978..344547) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene rplE CDS complement(344547..344861) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene rplX CDS complement(344947..345315) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene rplN CDS complement(345415..345687) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene rpsQ CDS complement(345684..345917) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222608.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene rpmC CDS complement(345917..346342) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene rplP CDS complement(346346..347173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(347173..347619) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene rplV CDS complement(347651..347932) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892827.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene rpsS CDS complement(347947..348786) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene rplB CDS complement(348799..349101) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055645.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene rplW CDS complement(349098..349742) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene rplD CDS complement(349739..350389) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene rplC CDS complement(350403..350711) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene rpsJ CDS complement(351164..352357) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene tuf CDS complement(352477..354573) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene fusA CDS complement(354664..355134) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene rpsG CDS complement(355136..355510) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene rpsL CDS complement(355917..356378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(356457..356807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(356875..360765) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(360852..364292) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene rpoB CDS complement(364881..365264) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene rplL CDS complement(365319..365867) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene rplJ CDS complement(366330..367010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(367007..367843) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222000.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(367910..368620) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222526.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene rplA CDS complement(368684..369424) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene nusG CDS complement(369463..369828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 tRNA complement(369934..370007) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(370116..370511) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(370513..370959) product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(371046..371213) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene rpmG tRNA complement(371317..371390) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(371437..371510) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(371604..374138) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(374198..374341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 374676..374915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(374912..375718) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(375746..376048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(376079..376573) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 tRNA 376722..376804 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 377195..378064 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene htpX CDS 378209..379462 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(379459..380109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 380187..380630 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(380605..382743) product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 383000..383836 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 383848..384501 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 384503..384673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 384721..385326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(385620..387083) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(387080..388567) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(388564..390453) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(390450..390821) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene nuoK CDS complement(390821..391642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(391639..392238) product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 392343..392918 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(392947..393906) product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(393906..394604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 note possible pseudo, frameshifted CDS complement(394633..395934) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(395945..396502) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(396512..397963) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(398036..399364) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 399414..400805 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(400818..401741) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 401844..402524 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(402525..402836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 402888..404000 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene proB CDS 404014..405261 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(405404..406210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(406357..407538) product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene moeZ CDS complement(407657..408517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(408646..409608) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(409605..411437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 411967..412626 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 412666..412890 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 413144..414955 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(415031..415330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(415336..415995) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230203.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 416119..417291 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(417294..418298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091127472.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(418291..418503) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(418538..418843) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(418894..421089) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(421274..422545) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 422804..424519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(424486..425979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 426117..428564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(428620..429636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(429702..430475) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384660.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(430481..431290) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(431283..431738) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(431735..433342) product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731061.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(433339..434520) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(434591..434926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 435002..437359 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(437347..439134) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(439131..439808) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 439899..441026 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 441023..441712 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 441709..442890 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(442937..443551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225400.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(443652..443936) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(443947..444318) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 444449..446614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942102.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(446595..446864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 447005..447742 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 447744..449258 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 449451..450518 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 450604..452721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 452841..454160 product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(454498..454809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(455222..456337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(456356..456964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 457156..457665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 457685..458380 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073044.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(458361..459599) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 459892..460434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 460490..460852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111477.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(460948..462141) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(462146..463150) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225254.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(463176..463703) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978556.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 463858..464391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(464420..464704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(464748..465410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 465488..466912 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 466927..467205 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(467195..467965) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(467983..468801) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(468804..469829) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(469826..470845) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(470853..471854) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(471941..474109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(474113..474865) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(474967..475614) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(475602..476828) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(476834..478204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 478326..478913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 478931..480064 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(480048..480659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 480767..481555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(481602..482459) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227930.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 482525..483301 product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(483464..484000) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897643.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 484074..485789 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 485831..488572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 488562..489365 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061915636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 489466..489915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227448.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 489953..490321 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 490441..492336 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 492378..492593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(492565..493584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 493644..493955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 494151..494549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 note possible pseudo, internal stop codon CDS 494546..494854 product type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229831.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 494851..496065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 496065..496532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(496639..497124) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061898.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(497163..498293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(498308..498478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(498597..501350) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051183743.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 501453..501842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 501972..502286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(502378..502887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(502986..503897) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203660628.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(503908..504495) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 504770..505231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 505364..506593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(506753..507403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 507772..508788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 508778..509368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 509262..509531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 tRNA 510003..510078 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(510090..510425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(510427..511218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(511508..512350) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026839.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 512376..513353 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978781.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 513350..513805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 513810..514502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(514499..515335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(515395..516060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(516057..516536) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(516648..517106) product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469843.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(517467..518663) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(518717..519604) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(519694..521670) product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 521808..522761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 522800..524020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 524246..525304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 525348..526532 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(526529..527449) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031357.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(527541..528449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 528657..530132 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227086.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene ahcY CDS 530190..531827 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085748.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 531885..532583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 532854..533216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 533682..534041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 534261..534872 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228543.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 534869..535762 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 535759..537336 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228541.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(537530..537688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(537707..538117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(538196..538483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 538525..538728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(538744..539439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 539458..539913 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(539919..541832) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 541937..542635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(542614..543177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(543187..543978) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(544132..545547) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(545544..546140) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(546137..547564) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(547561..548298) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(548308..549645) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(549642..551666) product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467133.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 552058..552429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 552426..552863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 553023..553430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 553749..554558 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(554646..555680) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227584.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 555883..557511 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 557508..558542 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 558535..559539 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 559550..560635 product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene rhaS CDS 560647..560976 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 560973..562139 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226383.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene rhaI CDS complement(562350..562625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 562817..565456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS 565738..567933 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027193.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(568102..568752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(568955..570211) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(570346..571371) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 571501..572514 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 572517..573530 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531509.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 573527..574330 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974317.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(574372..574584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 574735..575241 product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(575392..576858) product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974134.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 577009..578574 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896053.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 578651..579529 product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013494.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(579673..580902) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(580937..581350) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 581688..582500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 note possible pseudo, internal stop codon, frameshifted CDS complement(582476..582724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 582644..582916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 582939..583616 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 583670..584284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 584415..585035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(585028..586002) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(586070..587191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(587199..589370) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 589444..590655 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027783.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(590615..591463) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 591533..592201 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(592198..592893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(593086..594576) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(594560..595873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 596238..596765 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 596762..597886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 597919..598944 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(598934..599620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(599674..600621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(600630..601217) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(601451..603049) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227841.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(603143..604381) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268163.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 604464..605051 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079455.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(605048..606802) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226836.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(606967..607449) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971719.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 607559..608119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(608145..608450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(608815..610344) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(610446..611303) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(611300..612229) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222784.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(612226..613575) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(613622..614383) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(614926..615372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 note possible pseudo, internal stop codon CDS complement(615383..615532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 615764..616216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 616216..617244 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene pseI CDS complement(617281..619140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(619145..620014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 620430..621059 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030265.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(621447..623597) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(623669..624313) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(624340..625656) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(625722..628016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(628082..630430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(630427..631614) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(631611..632648) product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(632645..633874) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(633871..634608) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(634601..634846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 635038..636018 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene pseB CDS 636018..637136 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene pseC CDS 637140..638003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 638024..639505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 639502..640227 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 640232..641245 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707836.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene pseG CDS complement(641223..642236) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(642345..642593) product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 642759..643214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS 643307..644779 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(644780..645814) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962511.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(645830..646453) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229849.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 646703..650002 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316076.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(650009..650719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(650716..651225) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(651395..652477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 653359..653856 product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 653850..654260 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059289.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(654257..655909) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 656003..656701 product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene actII CDS 656709..658265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(658320..658865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(658898..659896) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014889.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 659970..661199 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804430.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(661196..661552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(661643..662209) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229516.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 662424..663320 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 663313..664089 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975815.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(664138..665175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 665659..666693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(666754..669117) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950883.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(669182..669949) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(670010..670510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(670645..671946) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(672082..674250) product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028440.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(674247..676097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 676326..676514 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(676574..677344) product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(677387..678562) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(678577..678873) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(678949..679587) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964727.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(679587..680507) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(680518..681849) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(681846..682472) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene pdxH CDS 682687..683784 product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 683787..684902 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene serC CDS complement(685089..685301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 685182..686264 product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene sepH CDS 686405..686740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(686926..687366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(687426..688739) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(688808..689257) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(689323..690747) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 690872..691129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(691143..691982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 note possible pseudo, internal stop codon, frameshifted CDS 692069..694246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 694293..694919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 694982..695803 product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(695800..696186) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(696237..696860) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(696857..697057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 697148..699577 product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 699646..700197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 700319..700852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 700944..702605 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 702661..703233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 703233..703856 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(703851..704267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(704264..704617) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975942.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(704642..705550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(705540..706517) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 706595..707524 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 707538..708026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(708076..708351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(708847..710088) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(710085..710654) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704847.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(710651..711202) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 711273..712382 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(712379..712927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(712985..713182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(713405..713599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(713645..714562) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972919.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(714706..715155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 715850..716308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 tRNA complement(716356..716430) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 716596..718257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(718692..718844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 719051..719374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(719515..720360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS 720517..722454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(722757..723368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(723368..723658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(723660..723986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 724097..725344 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(725445..727739) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 727836..729038 product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(729040..729669) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 729808..731109 product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203926466.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(731110..733923) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene topA CDS complement(734121..734858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(734860..735429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(735474..737816) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(738090..738461) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 note possible pseudo, internal stop codon CDS complement(738527..738883) product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene bldG CDS 739029..741371 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(741512..741841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(741913..742272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(742269..742454) product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419673.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(742512..743204) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230523.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(743374..744078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(744075..745298) product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(745295..746365) product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 746583..746984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 747284..748123 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(748644..749105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(749185..749916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 750131..752116 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene acs CDS 752236..752760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 752857..753753 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(753754..754116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(754116..757022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(757345..757641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(757659..757988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 758372..760126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 760196..760600 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 760785..761723 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene rarD CDS complement(761739..762455) product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224601.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(762544..763338) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 763492..764664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 764927..765916 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(765986..767518) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene nuoN CDS complement(767521..769065) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(769129..771051) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene nuoL CDS complement(771064..771363) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene nuoK CDS complement(771360..772109) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(772109..772702) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene nuoI CDS complement(772704..774101) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222459.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 gene nuoH CDS complement(774098..776602) product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS complement(776602..777918) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene nuoF CDS complement(777915..778748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(778748..780073) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(780070..780795) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(780872..781540) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(781580..781945) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(782016..783311) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(783409..783666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(783748..784443) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(784753..785049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(785105..786346) product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene mqnC CDS 786479..789517 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 tRNA complement(787390..787481) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 789519..790349 product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(790346..790792) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(790773..791060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(791082..792662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 792804..793766 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(793771..794544) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 794672..795556 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729989.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(795545..796360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(796438..796839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(796923..797774) product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(797895..798197) product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene mazF3 CDS complement(798197..798430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 798633..800627 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 800918..801550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 801547..801873 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223409.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 801870..802748 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 802758..803498 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 803549..804304 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(804281..805057) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(805054..806139) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(806136..807065) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(807302..807610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(807621..808049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(808096..809265) product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 gene mqnE CDS 809457..811235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 811563..813407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 813712..815664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 815759..816391 product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066871.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(816450..816902) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 817116..817391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(817364..818002) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(818051..818947) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(818944..820491) product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(820503..820694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 820717..821388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(821393..822373) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 gene ccsB CDS complement(822373..824007) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222433.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(824004..824825) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776420.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS complement(824825..825382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(825385..826041) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS complement(826038..827375) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 gene hemL CDS 827533..827859 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897958.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(828010..828558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(828587..833014) product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228557.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 833111..835147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 835210..835821 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013844.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(835927..837057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 837224..839308 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(839310..840839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(840836..842200) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 note possible pseudo, frameshifted CDS complement(842197..843228) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS complement(843225..843629) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(843626..844048) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(844050..844877) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 845041..845394 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 845501..845929 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 gene mscL CDS 845993..846226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(846415..847224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(847865..848494) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225405.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS complement(848678..850081) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 gene sthA CDS 850179..851069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(851116..852831) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 852997..853737 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 853734..855203 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene glpK sequence045 source 1..194635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..489 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene trxA CDS 602..1750 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(1747..2415) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 2589..3899 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 3938..4870 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS 5089..5907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(6373..7257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(7731..8030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS 8291..8449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 10729..10914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(12960..14006) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(14003..14854) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(16748..17458) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene rsmG CDS complement(18035..18607) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(18755..19786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(19788..20045) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769988.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 gene yidD CDS complement(20042..20398) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 gene rnpA CDS complement(20434..20571) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 gene rpmH CDS 21147..22925 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 gene dnaA CDS 24561..25694 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 gene dnaN CDS 25734..26609 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 gene gnd CDS 26617..27747 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 gene recF CDS 27737..28642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(28654..29220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 29809..31761 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 gene gyrB CDS 31877..34384 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene gyrA CDS 34388..35245 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098607.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 tRNA 35326..35400 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 35495..35749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44580 tRNA 35763..35836 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 35971..36687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 36746..37288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 37396..38688 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 38835..39233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(39211..40062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 40153..40704 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(40738..41373) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(41463..41897) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727923.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(41944..42333) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(42362..44119) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 44232..45002 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 45124..46032 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077428.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS 46117..47844 product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 47841..50516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 50560..51165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112478.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 51394..52722 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179728959.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 52730..53605 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 53748..54797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 55045..56397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 56646..58172 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 58186..59343 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 59433..61892 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950372.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(62224..62712) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225198.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS 62814..63392 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 63543..65000 product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083578.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(65046..66593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 66691..67626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(67631..67900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 68294..69199 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 69163..69387 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 69543..69989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(69993..70589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(70696..71502) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340251.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 tRNA complement(71809..71892) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 72040..72885 product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776668.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 72891..73373 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726620.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 73370..74806 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 74904..76346 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 tRNA 75854..75935 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 76343..77839 product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 gene pbpA CDS 77842..79149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 79146..80978 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 gene pknB CDS complement(81025..81675) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030445363.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(81677..81979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(81984..83867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(83867..84712) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 84858..85121 product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082859.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 gene crgA CDS 85307..87442 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(87447..88133) product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS 88219..89541 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 89534..90589 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS 90675..91562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(91559..92734) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 92842..93357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(93365..93943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 tRNA complement(94791..94862) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(95097..95597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 95673..96251 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727114.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene dcd CDS complement(96330..97085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS complement(97228..97701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 97717..97935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(97939..98802) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS 98854..99138 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937746.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(99139..99681) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947658.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 99782..100903 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(100916..101098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 101395..103251 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(103270..103788) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 103878..104150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(104333..105172) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 105293..105664 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS complement(105693..106346) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 106449..107060 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 note possible pseudo, internal stop codon CDS 107057..107917 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 107904..108662 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(108666..110459) product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230910.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(110520..113777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(114076..114213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(114387..115817) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(115823..116848) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(116848..117987) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene pdhA CDS 118441..119592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(119600..120811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS complement(120849..122558) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(122555..124591) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 124808..126694 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 gene dnaK CDS 126949..127323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 127391..128590 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 gene dnaJ CDS 128612..129046 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(129087..129596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(129662..130870) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(130917..131423) product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(131437..132666) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303290.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS 132834..135422 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 gene clpB CDS complement(135481..135666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS 135986..136948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 137020..138330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 note possible pseudo, internal stop codon, frameshifted CDS 139422..139631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS 139689..140066 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS 140176..140850 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146500.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(141062..141886) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762868.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(142080..144569) product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(144566..145939) product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(146006..147424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 147585..148610 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 gene fbaA CDS 148764..149279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(149241..150479) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 150498..151487 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 151533..151946 product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(151974..152870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(153784..154758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(154761..156053) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 156172..157413 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 gene purD CDS complement(157415..157867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 158068..158535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 158532..159836 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 159833..161254 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene purB CDS 161586..161843 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 gene purS CDS 161846..162550 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene purQ CDS 162547..165159 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730824.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene purL CDS complement(165286..167160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 167345..167677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 167821..169395 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene purF CDS 169425..170576 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404132.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene purM CDS 170750..171880 product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 gene grrM CDS 171843..172085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS complement(172269..172544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(172726..173805) product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 173956..174795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 175078..175287 product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 gene bldC CDS complement(175392..175796) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 175795..176571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 176568..177119 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466793.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS complement(177126..177374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS 177468..177887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS 177937..178326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(178323..178631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(178786..179208) product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230610.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 179306..179677 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230611.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS 179665..180855 product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230612.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(181508..182005) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225564.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 182123..182950 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(183038..184363) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(184365..185252) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 185196..186449 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 186475..187956 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 gene crtI CDS 187953..188516 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 gene idi CDS 188506..189399 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 tRNA 189548..189621 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 189717..189791 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 189805..189881 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 190056..191264 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS 191261..192145 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(192266..193294) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 193381..194205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46070 sequence046 source 1..173212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026948.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 740..1465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS complement(1472..2638) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS complement(2683..3252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS complement(3670..4083) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS 4237..5046 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031761.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(5019..5981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049871458.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 6140..7954 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230595.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(8012..8680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46160 note possible pseudo, frameshifted CDS complement(8804..11737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(11885..12724) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163686145.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(12736..14295) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226090.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(14449..14919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 14992..16614 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079057788.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS 16611..17471 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222855.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 17617..18582 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS complement(18602..19414) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS complement(19586..21289) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS complement(21370..22887) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731514.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene glpK CDS complement(22880..23725) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS 23867..24640 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS 24637..26127 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 gene glpK CDS complement(26098..30165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS 30273..31337 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS 31466..31900 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 31887..32216 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074955.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 CDS complement(32264..33280) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 33374..34126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111012.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS complement(34471..34677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46360 note possible pseudo, frameshifted CDS complement(34587..34961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46370 note possible pseudo, frameshifted CDS 35162..35788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS complement(35814..36347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(36365..37228) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028976.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 37169..37711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 37711..38184 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS 38184..38798 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS 39015..40430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(40380..40745) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974466.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS 40848..41222 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(41219..41479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 41478..42224 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS complement(42202..42564) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727330.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 42701..48121 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(48292..48735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(48892..50277) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS complement(50287..51813) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 gene dacB CDS 52003..53169 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS complement(53244..53828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 53901..54704 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728902.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(54631..55125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 note possible pseudo, frameshifted CDS complement(55795..57810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS complement(57814..58440) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972556.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS complement(58473..59687) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972557.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 59894..60295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 60292..61947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 62149..62436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 62519..64465 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS complement(64533..65576) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330037.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 65825..66685 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(66692..67795) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803997.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(67889..68422) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613322.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 68481..68969 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS 69069..70517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS complement(70595..71023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466698.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS complement(71185..72276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS 72340..73416 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(73317..74657) product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(74666..75529) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229012.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(75526..76602) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS complement(76599..77426) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(77440..78381) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803841.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(78378..79247) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(79300..80241) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(80242..81570) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 81733..83130 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 gene uxaC CDS 83142..84350 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777067.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS complement(84515..85921) product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 gene larC CDS complement(85918..86544) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777074.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 gene larB CDS complement(86652..87545) product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777075.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 gene larE CDS 87641..89326 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS complement(89295..89834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(89904..90182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS 90263..90493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(90438..91007) product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS 91211..92893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS 92957..94708 product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966240.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS complement(94774..96405) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229972.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(96482..97339) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 97397..98044 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873188.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS complement(98173..98544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 98759..99091 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 99160..99963 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(100946..103144) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230975.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(103141..103821) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS complement(103818..104342) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS complement(104383..105318) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS 105382..105792 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS 105902..108136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(108469..109518) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727354.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS 109996..110412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(110441..110923) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 111008..111277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110042.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS 111337..111942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 112081..112377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS complement(112428..113432) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS 113618..114910 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068481.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS 114984..115802 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051555.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 115806..116624 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051554.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS 116632..118530 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(118543..119418) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 119523..120473 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 120478..121419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS 121620..122744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 122812..123111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(123254..125710) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057784170.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS complement(125758..129255) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031478.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS 129451..130056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 130171..132873 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(132847..133659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(133559..135817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(136115..136744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 136932..137609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS complement(137695..138009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS complement(138228..138989) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(138989..139888) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS complement(139969..140937) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 141284..141985 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223308.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 142039..142557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(142588..143100) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 143353..143862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(143940..144140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS complement(144461..144814) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529383.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 144922..145533 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168558.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS complement(146055..146474) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089001.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 146689..147438 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(147569..148402) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031456.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(148405..149304) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(149386..149739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(149754..151088) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031431.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(151164..152033) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972031.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(152055..152390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS 152289..152903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS complement(152976..153326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS complement(153331..154932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS complement(154945..155184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS complement(155184..155843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS complement(155878..156948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS complement(156945..158093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS 158667..159182 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085317.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS complement(159137..159484) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS 159578..160399 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198727.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 160417..161817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(161795..164083) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS 164193..164843 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS 164923..165462 product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(165487..166449) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 166536..168596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(168601..169593) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS 169685..170221 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 170644..171429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS 171437..171817 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS 172037..172696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47690 sequence047 source 1..135760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47700 note possible pseudo, frameshifted CDS complement(586..1080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47710 note possible pseudo, frameshifted CDS complement(1166..2107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS complement(2180..3817) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257984.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(3884..5104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS 5252..8170 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS 9323..9571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 10495..11508 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(11492..11920) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(11913..12371) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 12472..14583 product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230689.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 gene helR CDS complement(14573..15091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 15268..15516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 15828..17099 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 17155..18045 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS 18042..18929 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 18965..21196 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 gene yicI CDS 21260..22291 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 22281..23597 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 23780..24502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS 24698..26749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(26772..27692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 27968..28660 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972069.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 28735..30105 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031417.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS complement(30116..30604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 note possible pseudo, frameshifted CDS complement(30810..31043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 31097..31765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS 31811..32509 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727080.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS 32541..33239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(33343..34869) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(35108..36730) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223537.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 gene aceB CDS complement(36730..38079) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 gene aceA CDS 38239..39651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(39665..42388) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(42441..43247) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257620.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(43244..44062) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 44174..46846 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728954.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS 46986..47459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(47468..48187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606590.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS 48444..49886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(49883..51325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS 51453..52193 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS 52178..52714 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304888.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS 52724..53134 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082410.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS 53751..54281 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854343.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(54265..54801) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224228.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS 54945..56114 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(56128..56796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(56798..57151) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975942.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS complement(57195..57833) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS complement(57830..59023) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199888163.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 59174..59926 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 59923..62451 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(62458..64446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(64443..65504) product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 gene cheB CDS complement(65504..67621) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS complement(67621..69090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(69090..69710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS complement(69707..71104) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(71101..71736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(71958..73643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 73964..74968 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027196.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 75101..75859 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(75886..76062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 76152..77501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS 77498..78235 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS 78232..79416 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS 79481..80332 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 80371..81360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(81357..86546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48390 note possible pseudo, internal stop codon CDS 87255..88208 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 88327..88764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS complement(89070..89474) product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS complement(89603..91015) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS complement(91117..92346) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS complement(92352..93869) product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 93985..95028 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775546.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS complement(95074..95457) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061577.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(95454..96248) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225182.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(96268..96612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 96805..97962 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS 97959..98621 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS 98756..100747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(100839..102317) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 102452..103147 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(103161..103493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 103628..104098 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(104223..104891) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS 104968..105672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS complement(105924..107417) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 gene zwf CDS 107612..108550 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS complement(108709..109533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 109614..109826 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 109985..111349 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 111352..112311 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS 112308..113180 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 113275..114114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 114116..114649 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS 114737..115345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(115335..117764) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031451.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS complement(117840..118208) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 118402..119292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS 119350..120777 product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 120774..121118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS 121137..122159 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089456.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS complement(125069..126301) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 gene glgC CDS 126449..127660 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 gene glgA CDS complement(127605..128498) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057677989.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS 128548..130167 product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS complement(130154..131041) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS 131101..132024 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS complement(132007..132378) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS complement(132428..132847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS complement(132908..133096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS 133237..133896 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS complement(134041..134934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48850 sequence048 source 1..111100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1105) product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176652.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(1152..1640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS complement(1738..1974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS 2137..2835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48890 note possible pseudo, frameshifted CDS 2835..3209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48900 note possible pseudo, frameshifted CDS complement(3115..4782) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS complement(4779..5465) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 5544..6422 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 6419..7093 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS 7087..10197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS 10194..12890 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 12928..14220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS complement(14245..17376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(17376..18569) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS complement(18608..19873) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227575.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS complement(19924..20745) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS complement(20742..21662) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS 21892..22917 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742137.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS complement(22973..23389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 23315..23872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS complement(23862..24086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 24364..24765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(24772..25152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS complement(25245..25949) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223207.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS complement(25961..26791) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(27114..27470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(27628..29001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS 29264..29656 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 29674..30612 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS 30625..31587 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192779382.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS 31726..31920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 31941..32399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 32401..33882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS 33945..34127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS 34128..34910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS 34900..36726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS 36723..38504 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(38489..39904) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(40260..40538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS complement(41041..41799) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS 41853..43490 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 43512..44273 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666039.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(44408..44677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 44705..45244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 45249..46031 product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS complement(46003..47154) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS complement(47239..48177) product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 gene sigJ CDS 48242..49366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(49339..50937) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS 50936..51847 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971940.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS complement(51866..53101) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene gguB CDS complement(53098..54630) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 gene gguA CDS complement(54630..55757) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 gene chvE CDS 55969..56790 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729575.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS 56787..57203 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270067.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS 57243..57674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(57676..58116) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS complement(58116..59621) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(59860..60327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(60407..61012) product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301800.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 gene lacA CDS complement(61002..62339) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS 62739..63290 product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 CDS complement(63284..64144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS 64290..65432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49490 CDS 65425..66531 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(66564..67541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(67685..69844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS complement(69965..71062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS 71287..72162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS 72159..73562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS 73644..74903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS complement(74910..75608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS complement(75639..76049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS 76210..77571 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS 77618..78313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS complement(78330..79178) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225558.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS 79321..79926 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225557.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS 79938..80810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS 80815..81594 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731108.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(81972..83813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(84021..85298) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS complement(85295..85642) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS 85813..87186 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS 87230..88507 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS 88521..89093 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(89066..90244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS 90608..90814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS complement(90721..90933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS 90982..91137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS 91137..91304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(91356..91595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS 91632..92549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS complement(92491..92853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS 93015..93572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS complement(93573..94466) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS 94559..97996 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265956.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 98091..98672 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 98636..99484 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231034.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS complement(99657..100685) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 100856..101989 product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 102000..104192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS complement(104229..105425) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS complement(105422..107518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(107734..110769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49890 sequence049 source 1..110267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS complement(563..1729) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS complement(1729..3336) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529694.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 CDS complement(3352..5037) product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729611.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS complement(5034..5768) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729612.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(5765..7288) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(7285..8076) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS complement(8107..9102) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529212.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(9133..10620) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS complement(10628..11686) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529214.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS complement(11786..12880) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(13161..13553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS 13666..14004 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS 14323..15015 product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(15158..15370) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS complement(15367..31938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS complement(32002..33321) product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 33602..34549 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(34805..35185) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS complement(35295..35939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS complement(36061..37245) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS complement(37242..37928) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS complement(37925..39019) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(39016..39582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS 39711..41024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS 41021..41686 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 41765..42373 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS 42370..43092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 43089..45515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS complement(45851..46327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS 46497..47078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS 47279..47989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS 48237..49364 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS complement(49449..49805) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727330.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(49863..55235) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS complement(55307..55705) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS 55806..56762 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS complement(56963..57289) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029627.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS 57399..58061 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS complement(58150..58686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS complement(58683..60770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS complement(60767..61930) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(61927..63441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(63438..64694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS 65055..65294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS 65413..70449 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(70594..71586) product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013141957.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 gene bla CDS complement(71648..73426) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(73556..73708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 73981..75954 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(76037..76462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS complement(76459..77691) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS complement(77664..78332) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS complement(78329..78964) product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230053.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(78961..79620) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS 79726..80805 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 80808..82100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 82166..82849 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS 82842..83894 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS 84011..84571 product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS complement(84798..86432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS complement(86429..87319) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS 87709..89004 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728574.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 gene nhaA CDS complement(89269..89688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS 89720..90367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 90674..91360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS complement(91375..91680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 92406..92690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 92806..93279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS complement(93323..95188) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(95395..96693) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS complement(97774..98136) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS complement(98494..98763) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS 98934..100382 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS 100379..101290 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(101693..101938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS complement(101960..103033) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(103033..103467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS 103450..104277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS complement(104355..105884) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(106165..107583) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS 107685..108047 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS 108113..108802 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS 108909..109643 product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 gene aqpS CDS 109673..110086 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 sequence050 source 1..103876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..1264 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 gene hisN CDS complement(1231..5364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS 5569..6477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS 7089..7604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS complement(7720..8781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(8891..9250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(9280..9534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS complement(9453..9671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS complement(9762..10529) product A-factor type gamma-butyrolactone 6-reductase ScbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030779.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 gene scbB CDS 10639..11256 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS 11601..12113 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS 12115..13092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072482346.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS complement(13197..14027) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225659.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 14255..17002 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS 17073..17318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS complement(17574..18524) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805167.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS 18798..19394 product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS complement(19457..19873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(19943..20683) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974452.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS complement(20699..21925) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS complement(21959..22162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(22340..23887) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 gene gcvPB CDS complement(23887..25287) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 gene gcvPA CDS complement(25324..26454) product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(26629..27258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 27454..27999 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 28204..28614 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS 28921..31662 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 31766..32803 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS complement(33106..34479) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS complement(34577..35596) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS 35818..37281 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS 37292..38659 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(38675..39463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(39545..40399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS complement(40403..41605) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(41655..42758) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730801.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(42755..43666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(43782..45263) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS 45413..46117 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS 46122..47018 product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(47065..47397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 47442..48836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS complement(48860..49270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS complement(49263..49589) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 50101..52911 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 52916..53569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS complement(53577..54314) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 54506..55597 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS 55767..57914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS complement(57920..58621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(58701..59213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS 59499..60494 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS complement(60532..61296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS complement(61310..62014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS complement(62052..62801) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS complement(63212..63874) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268099.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS 64130..65257 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS complement(65308..66225) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224778.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS complement(66287..67159) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS complement(67242..69998) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 70475..70900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 71041..71364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS complement(71416..72600) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS complement(72629..73198) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS 73395..73889 product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS complement(73987..74871) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 CDS 75013..75642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(75680..75826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS complement(75863..78568) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS complement(79019..79876) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS 79957..80277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(80247..81380) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS complement(81666..82007) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974467.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(82169..82318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS 83061..83696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS complement(83713..84057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS complement(84283..87039) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 CDS complement(87272..88186) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199873.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS 88283..89809 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947833.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS 89990..91078 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726736.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS 91078..91587 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 91839..92585 product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978775.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS complement(93204..93548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 93571..94521 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 94771..95244 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS 95391..96014 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 transl_table 11 codon_start 1 locus_tag LOCUS_51610 gene wrbA CDS 96303..97775 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS complement(97803..98168) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS 98952..99653 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 99704..100540 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS 100725..103637 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 sequence051 source 1..100408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS complement(1040..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS 1503..1901 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(1905..2696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS complement(2718..3890) product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS 3953..4750 product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS 4781..5419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(5548..6519) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS 6779..7744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS complement(7774..8157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS 8237..8443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 8478..9266 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 gene mshB CDS 9291..10124 product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 CDS 10121..10840 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535056.1 transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS 10893..11873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS 11956..12582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS 12649..12921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(12938..13393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227448.1 transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS complement(13605..14489) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS 14538..15161 product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS 15227..16099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS 16232..17116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS 17113..18297 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS 18513..19625 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS complement(19622..20755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS 20823..22052 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS complement(22200..22973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS 23265..24269 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS 24419..24838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS 24835..25059 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS 25056..25991 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS complement(25893..26099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS 26662..27678 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS complement(27736..28461) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223917.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS complement(28556..28765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 28647..29906 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS complement(29926..30687) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027023.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS 30776..31384 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730455.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS 31381..31710 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557347.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(31876..33087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(33129..34514) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918269.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS complement(34599..37118) product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117302210.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS complement(37243..38073) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS complement(38086..38742) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247918.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS complement(38739..39782) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS 40084..40638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS complement(40652..41581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 41568..42218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52140 note possible pseudo, frameshifted CDS 42194..43513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS complement(43473..44444) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS complement(44831..45154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS complement(45266..46339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS 46618..47052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229946.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS complement(47101..47877) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146461.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS 47977..48690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 49089..49964 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS 50018..50809 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS complement(50980..51609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS complement(51648..52397) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031670.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS 52481..53095 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 53092..53529 product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS 53705..54544 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994149.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS 54632..56296 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS complement(56608..57948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52300 CDS 58163..58546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 58543..60246 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 60365..60883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS complement(60928..61884) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087175.1 transl_table 11 codon_start 1 locus_tag LOCUS_52340 gene pip CDS complement(61904..62128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(62142..63269) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS 63334..66180 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS 66239..67204 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS 67201..67983 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS complement(68140..68493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 68611..69300 product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 gene wag31 CDS 69377..70192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS complement(70287..70580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(70594..72030) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173762.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS 72184..72870 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS complement(72921..73568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS 73979..75193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS complement(75162..75953) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(76043..77914) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS complement(77919..79976) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS complement(79985..81217) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS complement(81178..81801) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210025486.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS 81958..82449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS complement(82451..83407) product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969667.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS complement(83494..83652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 83621..84259 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS 84323..84778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS 84869..85819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 85881..86330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS complement(86320..88917) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS 89030..89935 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972012.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS 89932..90516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 90699..93560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS complement(94023..94481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS 94584..95447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS complement(95604..95888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS complement(95903..96070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS complement(96117..97583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS 97794..98159 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS complement(98169..99356) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS complement(99571..100284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52710 sequence052 source 1..95623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..547) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729707.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 gene dtd CDS complement(549..1193) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976493.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS complement(1221..1571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS complement(1645..2205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(2202..2519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS 2539..3156 product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS 3191..3655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS complement(3966..4847) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS complement(4844..5758) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS 5964..6182 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS 6208..6822 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS 6913..8637 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS 8709..9203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS 9203..9463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS complement(9774..10013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS complement(10258..11847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS 12052..12906 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(12923..13462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 13814..14110 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS 14265..15083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS complement(15080..15562) product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728565.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS 15663..16139 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 gene dut CDS 16156..16830 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS 16919..17296 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 17293..18072 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894153.1 transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS complement(18115..18792) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS complement(18795..19460) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851807.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS 19573..21618 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 21615..22871 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(22902..23768) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS 24028..25947 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 gene dxs CDS 25944..27338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 27342..28700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS 28734..30011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 30080..30754 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 30751..31989 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(31997..32938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS complement(33079..33906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(34034..36094) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS complement(36091..37281) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 37604..37753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS complement(37817..39118) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS 39261..40490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS complement(40492..41058) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS 41186..42169 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 gene hemE CDS 42229..43665 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 gene hemG CDS 43662..44435 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS complement(44419..44868) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS 44950..45225 product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS 45311..45919 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 gene wrbA CDS 45949..46206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS 46265..47158 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225956.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS 47155..47649 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057139.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS 47675..48676 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029794.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS complement(48630..49037) product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS complement(49034..49756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS complement(49766..50323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS 50417..51484 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS 51551..53110 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(53061..53519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS 53588..54049 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS complement(54136..55158) product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 gene ligD CDS complement(55185..55379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS complement(55467..55877) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 gene msrB CDS 55903..56403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS 56498..57004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53370 CDS complement(57057..58502) product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 gene dgt CDS complement(58513..59052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS 59186..60262 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS 60244..60816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS 60825..61484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS complement(61445..62371) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS complement(62406..62984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS 63137..63454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53450 CDS 63481..64245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53460 CDS complement(64252..64506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS 64767..65024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53480 CDS 65063..65941 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222333.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(65938..67383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53500 CDS complement(67371..68504) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS 68758..69753 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 transl_table 11 codon_start 1 locus_tag LOCUS_53520 gene bioB CDS complement(69926..70969) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS complement(71075..71782) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443162.1 transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS 72043..72753 product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908282.1 transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS complement(72741..73649) product CU044_5270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225196.1 transl_table 11 codon_start 1 locus_tag LOCUS_53560 CDS complement(73642..74235) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_53570 CDS 74554..76218 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS 76239..77390 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS 77476..79947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53600 CDS 79959..80918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 transl_table 11 codon_start 1 locus_tag LOCUS_53610 CDS complement(80924..81484) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225326.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS 81615..82409 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 transl_table 11 codon_start 1 locus_tag LOCUS_53630 CDS complement(82970..83335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS 83243..83806 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS 83803..84597 product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 gene rsuA CDS 84808..85503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS 85550..86326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS 86370..87542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 87831..88727 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS complement(88705..89493) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS 89559..90329 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS 90331..91056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS complement(91053..91730) product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 CDS complement(91741..92403) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921252.1 transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 92490..95480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53760 sequence053 source 1..94533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1892..2140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 2188..5463 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_table 11 codon_start 1 transl_except (pos:2761..2763,aa:Sec) note codon on position 192 is selenocysteine opal codon. locus_tag LOCUS_53780 gene fdh CDS 5453..6364 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS 6361..7326 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225065.1 transl_table 11 codon_start 1 locus_tag LOCUS_53800 gene nrfD CDS complement(7316..8320) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226944.1 transl_table 11 codon_start 1 locus_tag LOCUS_53810 gene selD tRNA 8386..8479 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(8488..9297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS complement(9432..11183) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS 11262..12623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53840 CDS 12547..13176 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 13173..13445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS 13725..14822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065474.1 transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS 14908..15222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS 15219..15668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS complement(15705..16376) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093809.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS complement(16397..17308) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466733.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS 17371..17784 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS complement(17853..19595) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 gene selB CDS complement(19598..20893) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727953.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 gene selA CDS 21065..23836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53950 CDS 23833..24924 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS 24968..25618 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 CDS 25594..26256 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS 26284..27489 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 transl_table 11 codon_start 1 locus_tag LOCUS_53990 CDS complement(27619..30207) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284555.1 transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS 30389..31732 product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS 31899..32837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS 32873..33406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS 33984..35039 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS complement(35090..36202) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 gene ald CDS 36326..36796 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081784.1 transl_table 11 codon_start 1 locus_tag LOCUS_54060 CDS 36900..38117 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 transl_table 11 codon_start 1 locus_tag LOCUS_54070 CDS 38284..39297 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS complement(39610..41184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(41254..41973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS 42149..42607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS 42604..43008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS complement(43130..44632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 44784..45605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS 45717..47216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS 47355..47765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 47847..47996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS complement(48057..49982) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS 50044..50865 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS 50933..51355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS 51444..53120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS 53127..53306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS complement(53303..53680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS 53793..56057 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS 56060..56566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS 56551..57426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS 57423..58199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS 58252..58416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS 58391..58678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS complement(58717..60189) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 CDS complement(60629..61774) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394438.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS complement(61815..62579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54320 note possible pseudo, frameshifted CDS complement(62576..63355) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626598.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 CDS complement(63352..64191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS complement(64188..65183) product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111352.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS complement(65200..66600) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 transl_table 11 codon_start 1 locus_tag LOCUS_54360 gene hydA CDS complement(66597..67436) product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 CDS 67625..69001 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS 69028..70329 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 CDS 70565..71476 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS 71476..73551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS 73676..74875 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS 74872..75168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS 75176..75493 product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727386.1 transl_table 11 codon_start 1 locus_tag LOCUS_54440 CDS 75656..76870 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 CDS 76867..77163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908790.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(77167..77838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS complement(77897..78988) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS complement(79111..79914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS complement(79911..80498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS 80632..81261 product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS complement(81206..84145) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892217.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 84190..85335 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS 85419..87599 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049717556.1 transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS 87782..88372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54550 CDS complement(88377..89888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 90069..92519 product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223208.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS 92827..93270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS complement(93287..94030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS 94159..94431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54600 sequence054 source 1..94137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS complement(751..2373) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS 2480..3940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS 3971..4246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 CDS 4243..4587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS complement(4639..5553) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS 5741..6208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54670 CDS complement(6270..7121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS complement(7274..7792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS 8504..9055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS complement(9208..9495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS complement(9702..10001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS 10105..10461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(10913..11182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS 11111..12190 product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 transl_table 11 codon_start 1 locus_tag LOCUS_54750 CDS 12389..12973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54760 CDS complement(13465..16770) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS 16943..18289 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS 18306..19526 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS 19592..19921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS complement(19927..20628) product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727694.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS complement(20625..21581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS complement(21703..23616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480089.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(23947..24297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS 24278..25078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54850 CDS 25196..25366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54860 CDS complement(25424..26509) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS complement(26568..27896) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS complement(28240..29415) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225179.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS complement(29455..30048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS 30223..31047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(31084..31644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54920 CDS complement(31641..32558) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS 32654..33568 product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 CDS complement(33646..34305) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229425.1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS 34425..34925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(34901..35419) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS complement(35441..36583) product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030553.1 transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS 36640..37164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 37554..39308 product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259365.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 CDS complement(39336..40097) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS complement(40226..41164) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS complement(41186..42025) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS 42194..43120 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026947.1 transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(43204..43719) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225071.1 transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS 43847..45679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS complement(45821..45988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55070 CDS 46542..47525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS 47506..47688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS 48368..48721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229778.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS complement(48847..49263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS complement(49447..49971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS complement(50208..50636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(51201..51455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55140 note possible pseudo, frameshifted CDS complement(51421..51948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55150 note possible pseudo, frameshifted CDS 52291..53358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS 53373..54581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS complement(54772..55209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55180 CDS 56002..56325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55190 CDS complement(56676..57056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55200 CDS complement(57312..57683) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_55210 CDS 57728..58435 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS complement(58720..59130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS complement(59375..60250) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223330.1 transl_table 11 codon_start 1 locus_tag LOCUS_55240 CDS 60382..61287 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS complement(61941..63242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS complement(63248..63835) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225073.1 transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS complement(63832..64656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS 64757..65521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS complement(65527..66624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS 66784..68664 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 CDS 68745..69455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS 69499..71247 product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS complement(71288..73078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55340 CDS complement(73159..73422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS complement(73696..74187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS 74337..74963 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(75014..76039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55380 CDS complement(76067..77464) product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530004.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS complement(77527..78855) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS complement(78857..79153) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 gene nirD CDS complement(79150..81600) product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 gene nasD CDS complement(81597..83666) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS complement(83734..84507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55440 CDS complement(84593..85690) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(85793..85978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55460 CDS complement(85983..86168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS 86231..86398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(86362..87282) product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466629.1 transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS 87335..88021 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 CDS 88011..88352 product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS 88340..89845 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227763.1 transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS 89842..90780 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS 90777..91616 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640484.1 transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS complement(91859..92242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55550 CDS complement(92245..93378) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS 93359..94021 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_55570 sequence055 source 1..599284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..1713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS 1713..3755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55590 CDS 4304..5689 product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS 5926..6366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS complement(6355..6600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS complement(6629..7174) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223304.1 transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS 7342..8181 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS 8277..9158 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS 9214..10665 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 transl_table 11 codon_start 1 locus_tag LOCUS_55660 CDS complement(10793..11212) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975062.1 transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS complement(11303..11767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS 12463..13152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55690 note possible pseudo, frameshifted CDS 13080..13412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS 14116..14496 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_55710 gene trxA CDS 14556..14825 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS complement(14829..15077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS complement(15210..15878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS complement(16241..17425) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS complement(17497..18687) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_55760 CDS 18915..19235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS 19270..20631 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 20715..21314 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS 21311..22243 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 CDS complement(22451..23506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55810 CDS 23390..23725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS 23751..25499 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS complement(25557..26060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS 26636..28936 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 transl_table 11 codon_start 1 locus_tag LOCUS_55850 CDS 28933..29616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55860 CDS 29697..30320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55870 CDS complement(30496..30828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55880 CDS complement(31153..32301) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS 33086..33286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55900 CDS 33317..35461 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031418.1 transl_table 11 codon_start 1 locus_tag LOCUS_55910 CDS 36100..37155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS 37148..37759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS 37783..37995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS 37976..38680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS complement(38804..39196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS complement(39495..42359) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304129.1 transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS 42249..42719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS 42927..43421 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS 43418..45448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS 45504..45797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56010 CDS 45882..50234 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(50281..50883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029717.1 transl_table 11 codon_start 1 locus_tag LOCUS_56030 CDS complement(50880..51227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS 51297..52328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS 52325..53599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56060 CDS 53631..54989 product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 transl_table 11 codon_start 1 locus_tag LOCUS_56070 CDS complement(54881..55228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56080 CDS complement(55303..55923) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227485.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS 56011..57399 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS complement(57458..57997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS complement(57997..58701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS complement(58685..60457) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 transl_table 11 codon_start 1 locus_tag LOCUS_56130 CDS complement(60454..61512) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_56140 CDS complement(61576..62328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230003.1 transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS complement(62365..63147) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704873.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 gene aat CDS complement(63155..66166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(66181..67497) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229096.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 CDS complement(67546..67749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56190 CDS 67946..68632 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS 68644..70143 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS 70276..71052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS 71068..71340 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 CDS 71346..72125 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230240.1 transl_table 11 codon_start 1 locus_tag LOCUS_56240 gene modA CDS 72122..72961 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS 72958..74010 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 transl_table 11 codon_start 1 locus_tag LOCUS_56260 CDS 74007..75155 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 transl_table 11 codon_start 1 locus_tag LOCUS_56270 gene chrA CDS 75166..76404 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 transl_table 11 codon_start 1 locus_tag LOCUS_56280 CDS 76394..77056 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184524.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS 77053..77445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56300 CDS 77450..78673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS 78714..79640 product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS 79812..81314 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 transl_table 11 codon_start 1 locus_tag LOCUS_56330 gene argH CDS complement(81359..81586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS 81542..82330 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226603.1 transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS 82333..84621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS 84618..87965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56370 note possible pseudo, internal stop codon, frameshifted CDS 87995..94756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56380 CDS 94784..98908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS 98905..100176 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211973.1 transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS 100163..102514 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS complement(102490..103266) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879184.1 transl_table 11 codon_start 1 locus_tag LOCUS_56420 CDS 103392..103877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56430 CDS 103874..104287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS 104485..104700 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS 104697..105668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS 105681..107933 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS complement(108034..110676) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS complement(110756..112099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(112099..112917) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227389.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS 113410..113607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56510 CDS 113685..114248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS 114251..114763 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS complement(114735..115283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS 115503..115727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS complement(115894..116685) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 CDS 116930..117667 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720646.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 gene kduI CDS 117664..118419 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 transl_table 11 codon_start 1 locus_tag LOCUS_56580 gene kduD CDS 118517..119590 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530574.1 transl_table 11 codon_start 1 locus_tag LOCUS_56590 CDS 119692..120588 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613875.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS 120585..122096 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS 122093..123076 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612367.1 transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS 123091..124575 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS 124572..125195 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 transl_table 11 codon_start 1 locus_tag LOCUS_56640 gene eda CDS 125192..126289 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 126473..130711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS 131127..131801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS complement(132037..134115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56680 CDS 134386..134724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56690 CDS 134763..135875 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 CDS 135872..136534 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS 136668..138125 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS 138151..138645 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222147.1 transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS 139460..139915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56740 CDS complement(139985..142882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS 143037..144041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS 144139..144558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56770 CDS 144555..144881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56780 CDS 144885..145379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS 145386..145880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56800 CDS 145899..146342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS complement(146346..147920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56820 CDS complement(148165..148710) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 transl_table 11 codon_start 1 locus_tag LOCUS_56830 CDS complement(148616..149299) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 transl_table 11 codon_start 1 locus_tag LOCUS_56840 CDS complement(149277..149654) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS complement(149651..150085) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_56860 CDS complement(150120..151391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56870 CDS 151935..152381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS complement(152407..152619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56890 CDS 152651..152944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(152960..153133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS 153296..153583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56920 CDS complement(153584..154066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS complement(154142..155158) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727499.1 transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS complement(155176..156315) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS complement(156383..157327) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS complement(157582..158403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS 158722..159234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56980 note possible pseudo, frameshifted CDS 159353..159739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(159777..161000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS complement(161009..161422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS complement(161704..163362) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 transl_table 11 codon_start 1 locus_tag LOCUS_57020 CDS complement(163433..163882) product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227398.1 transl_table 11 codon_start 1 locus_tag LOCUS_57030 CDS complement(164005..164775) product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 CDS complement(164772..165506) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 CDS complement(165680..167890) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 gene tkt CDS 168119..169351 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 CDS complement(169356..170306) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_57080 CDS complement(170379..170681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS 171023..171388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57100 CDS 171556..172623 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 transl_table 11 codon_start 1 locus_tag LOCUS_57110 CDS complement(172792..173037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57120 CDS complement(173116..174000) product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224425.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 CDS 174211..174687 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS 174684..176225 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS 176222..179023 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 transl_table 11 codon_start 1 locus_tag LOCUS_57160 gene fdhF CDS 179023..179229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57170 CDS 179238..180050 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730562.1 transl_table 11 codon_start 1 locus_tag LOCUS_57180 CDS 180052..180936 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS complement(180928..182163) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 note possible pseudo, internal stop codon, frameshifted CDS complement(182160..182393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 CDS 182497..183858 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226405.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS 183905..184723 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 transl_table 11 codon_start 1 locus_tag LOCUS_57230 gene fdhD CDS complement(184813..185688) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226408.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 gene sucD CDS complement(185694..186872) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 transl_table 11 codon_start 1 locus_tag LOCUS_57250 gene sucC CDS 187210..188439 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 transl_table 11 codon_start 1 locus_tag LOCUS_57260 gene frc CDS 188469..190634 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS complement(190676..190906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57280 CDS 190884..192287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57290 CDS 192308..192859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS 192859..193863 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS complement(193884..194093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS 194764..196497 product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891489.1 transl_table 11 codon_start 1 locus_tag LOCUS_57330 gene oxc CDS 196589..197950 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS complement(197954..198715) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226414.1 transl_table 11 codon_start 1 locus_tag LOCUS_57350 CDS complement(198852..200555) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 gene gcl CDS complement(200560..201546) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891485.1 transl_table 11 codon_start 1 locus_tag LOCUS_57370 CDS complement(201916..202368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS complement(202495..203013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57390 CDS complement(203043..203897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57400 CDS complement(203946..207026) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 transl_table 11 codon_start 1 locus_tag LOCUS_57410 CDS 207207..208679 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 CDS 208820..209458 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 CDS complement(209469..210020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(210113..211333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57450 CDS complement(211330..215379) product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 CDS complement(215379..216593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57470 CDS complement(216586..218085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS 218173..218892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS 219030..220367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57500 CDS complement(220500..221387) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 transl_table 11 codon_start 1 locus_tag LOCUS_57510 CDS 221455..221982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS complement(221936..224002) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 CDS 224206..227658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57540 CDS complement(227646..250337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS complement(250351..251388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS complement(251385..251798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57570 CDS 252129..252443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS 252478..252780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS 252874..253686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS 253751..256213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS 256206..256571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57620 CDS 256568..260521 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 260535..261914 product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 transl_table 11 codon_start 1 locus_tag LOCUS_57640 gene eccD CDS 261921..263264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS 263271..266312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS 266312..269467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57670 CDS 269484..269783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS complement(269827..270906) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229444.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS 270997..271881 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 CDS complement(271884..273884) product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS complement(273935..274093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS complement(274325..275899) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 transl_table 11 codon_start 1 locus_tag LOCUS_57730 CDS complement(275991..277085) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 transl_table 11 codon_start 1 locus_tag LOCUS_57740 CDS complement(277055..277759) product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS complement(277854..279065) product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198491.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 CDS 279296..280198 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 transl_table 11 codon_start 1 locus_tag LOCUS_57770 CDS 280195..280929 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 transl_table 11 codon_start 1 locus_tag LOCUS_57780 CDS 280926..281801 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 transl_table 11 codon_start 1 locus_tag LOCUS_57790 CDS 281808..282464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57800 CDS complement(283183..285948) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 transl_table 11 codon_start 1 locus_tag LOCUS_57810 CDS 286459..288759 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS 288756..289772 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 transl_table 11 codon_start 1 locus_tag LOCUS_57830 CDS complement(289870..290130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57840 note possible pseudo, frameshifted CDS 290426..291277 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_57850 gene pdxY CDS complement(291278..294274) product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227072.1 transl_table 11 codon_start 1 locus_tag LOCUS_57860 tRNA 293446..293539 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 294661..295551 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230668.1 transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS complement(295612..298413) product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 transl_table 11 codon_start 1 locus_tag LOCUS_57880 CDS complement(298609..299361) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813694.1 transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS complement(299464..300165) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 transl_table 11 codon_start 1 locus_tag LOCUS_57900 CDS 300634..301098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS 301065..301256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS 301326..302462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS complement(302509..303285) product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS complement(303455..305929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57950 CDS 306210..307196 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS 307193..308086 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS 308105..309775 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS complement(309830..312067) product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108674.1 transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS 312250..313404 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS 313631..319390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58010 CDS 319455..319958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS complement(319953..320660) product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 transl_table 11 codon_start 1 locus_tag LOCUS_58030 CDS complement(320662..321705) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 transl_table 11 codon_start 1 locus_tag LOCUS_58040 gene hypE CDS complement(321705..322805) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 transl_table 11 codon_start 1 locus_tag LOCUS_58050 gene hypD CDS complement(322802..323050) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS complement(323062..325545) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 transl_table 11 codon_start 1 locus_tag LOCUS_58070 gene hypF CDS complement(325547..326080) product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 transl_table 11 codon_start 1 locus_tag LOCUS_58080 CDS complement(326077..326199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58090 CDS complement(326193..327530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(327527..328156) product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 transl_table 11 codon_start 1 locus_tag LOCUS_58110 CDS complement(328153..328731) product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 CDS complement(328728..329183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS complement(329187..330944) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 transl_table 11 codon_start 1 locus_tag LOCUS_58140 CDS complement(330958..331989) product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 CDS 332083..332478 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894106.1 transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS 332531..333127 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 transl_table 11 codon_start 1 locus_tag LOCUS_58170 gene hypB CDS complement(333117..333635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS complement(333811..334788) product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225632.1 transl_table 11 codon_start 1 locus_tag LOCUS_58190 CDS 334835..335401 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847604.1 transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS 335526..335912 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 transl_table 11 codon_start 1 locus_tag LOCUS_58210 CDS complement(335922..336788) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731504.1 transl_table 11 codon_start 1 locus_tag LOCUS_58220 CDS complement(336785..337384) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891451.1 transl_table 11 codon_start 1 locus_tag LOCUS_58230 CDS 337606..342318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS complement(342366..342659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS 342752..343039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58260 note possible pseudo, frameshifted CDS 343633..345012 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_58270 gene tnpB CDS 345066..345752 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS complement(345804..347288) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 transl_table 11 codon_start 1 locus_tag LOCUS_58290 CDS 347394..347837 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 transl_table 11 codon_start 1 locus_tag LOCUS_58300 CDS complement(347810..351403) product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS 351559..352065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS complement(352510..353064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS complement(353820..355610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222074.1 transl_table 11 codon_start 1 locus_tag LOCUS_58340 CDS complement(355639..356415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS complement(356558..357214) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS complement(357211..358503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58370 CDS 358660..359352 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS 359349..361676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58390 CDS complement(361721..362305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58400 CDS complement(362576..364033) product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224773.1 transl_table 11 codon_start 1 locus_tag LOCUS_58410 CDS complement(364111..365550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS complement(365632..367695) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190907.1 transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS 368160..369584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58440 CDS complement(369592..369876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58450 CDS complement(370047..371423) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 transl_table 11 codon_start 1 locus_tag LOCUS_58460 CDS complement(371420..372151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58470 CDS complement(372242..372601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58480 CDS 372862..373065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58490 CDS 373062..374186 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS complement(374275..374847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58510 CDS complement(374880..376532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS 376931..377374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS complement(377418..378431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58540 CDS complement(378428..378697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS 378986..379480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS complement(379534..381096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58570 CDS 381387..386744 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS complement(387343..387663) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967855.1 transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS 387662..388492 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS complement(388564..389928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS 390079..391323 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 transl_table 11 codon_start 1 locus_tag LOCUS_58620 CDS 391320..392327 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(392405..392923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58640 CDS complement(393644..394753) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486033.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 CDS 395049..398006 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_58660 CDS complement(398232..398978) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_58670 CDS 399151..400284 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS complement(400745..401362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58690 note possible pseudo, internal stop codon, frameshifted CDS complement(401269..401637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58700 note possible pseudo, frameshifted CDS 401542..401898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58710 CDS 401923..402981 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729551.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS 403051..403869 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS 403875..404669 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 transl_table 11 codon_start 1 locus_tag LOCUS_58740 CDS 404675..405451 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS 405609..408932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS complement(409293..410534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58770 CDS complement(410531..411043) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS 411408..412064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS 412129..412875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS 412875..415022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS 415026..416093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS complement(416086..416592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS complement(416635..417807) product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS complement(417820..418815) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 transl_table 11 codon_start 1 locus_tag LOCUS_58850 gene dhaK CDS complement(418812..419447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS complement(419444..420199) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 transl_table 11 codon_start 1 locus_tag LOCUS_58870 CDS complement(420196..421056) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 transl_table 11 codon_start 1 locus_tag LOCUS_58880 CDS complement(421084..422073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS 422072..423310 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS complement(423341..424159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS 424241..425131 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 transl_table 11 codon_start 1 locus_tag LOCUS_58920 CDS complement(425186..426577) product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS complement(426587..426949) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS complement(427104..427307) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804343.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS complement(428374..428601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58960 CDS 429650..430714 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 CDS 430711..434628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58980 CDS 434625..436163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS 436190..437167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS 437403..437864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS complement(437953..442284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS 442612..443271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS complement(443445..443630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS complement(443706..443909) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 CDS 444519..445157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59060 CDS 445331..445912 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864582.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 CDS complement(445909..446244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59080 CDS complement(446237..447988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS complement(448049..450757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59100 CDS complement(450754..452106) product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS complement(452163..453398) product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 transl_table 11 codon_start 1 locus_tag LOCUS_59120 CDS 453689..454030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS complement(454085..455512) product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 CDS 455679..457418 product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 transl_table 11 codon_start 1 locus_tag LOCUS_59150 CDS 457463..458764 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS 458761..460671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59170 CDS complement(460773..461669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59180 CDS 462027..463058 product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_59190 CDS 463103..463837 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS 464021..465529 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947833.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 CDS complement(465539..466186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS complement(466203..468626) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 transl_table 11 codon_start 1 locus_tag LOCUS_59230 gene pepN CDS 468725..468997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS 468994..469410 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 CDS complement(469473..471332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59260 CDS complement(471345..472499) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS 472621..474690 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223744.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 CDS 474687..475946 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 transl_table 11 codon_start 1 locus_tag LOCUS_59290 CDS 475949..476836 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118115.1 transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 476833..477684 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS 477716..478669 product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 transl_table 11 codon_start 1 locus_tag LOCUS_59320 gene axeA CDS 478916..479509 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS 479517..480599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS 480781..481182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS complement(481294..483531) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_59360 tRNA complement(483417..483495) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 483632..485410 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 transl_table 11 codon_start 1 locus_tag LOCUS_59370 repeat_region 485519..490245 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaccatccccgcgtgcgcggggagcag CDS complement(490512..490868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS complement(490868..491806) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 transl_table 11 codon_start 1 locus_tag LOCUS_59390 gene cas1e CDS complement(491803..492486) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 transl_table 11 codon_start 1 locus_tag LOCUS_59400 gene cas6e CDS complement(492489..493199) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_59410 gene cas5e CDS complement(493196..494320) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_59420 gene cas7e CDS complement(494317..494979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59430 CDS complement(494976..496817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS complement(496786..499626) product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 transl_table 11 codon_start 1 locus_tag LOCUS_59450 gene cas3 CDS complement(499623..501728) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS 502030..503214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59470 CDS complement(503180..503896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(503943..504158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS 504260..506242 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 transl_table 11 codon_start 1 locus_tag LOCUS_59500 repeat_region 506483..509059 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgctccccgcgcacgcggggctgatcc CDS complement(509281..509715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS complement(509799..510236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59520 CDS 510373..511497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59530 CDS 511425..511784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS complement(511750..513492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS complement(513582..514205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS complement(514311..517772) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031493.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS 517879..518826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(518831..519433) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS 519728..520804 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS 520801..521766 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 transl_table 11 codon_start 1 locus_tag LOCUS_59610 CDS 521763..522878 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS 522875..523882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59630 CDS 523869..524840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59640 CDS 524837..525928 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS 526051..529731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59660 CDS 529746..531194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS complement(531452..532735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS 533005..533874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59690 CDS 533871..535244 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878504.1 transl_table 11 codon_start 1 locus_tag LOCUS_59700 CDS complement(535426..536604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59710 CDS complement(536601..537746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS complement(537758..538879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59730 CDS 539059..539715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878513.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 CDS complement(539720..540736) product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS complement(540733..541956) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103941653.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS 542137..542994 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS 543003..543878 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061716.1 transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS 544207..545391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS 545388..546152 product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 gene vpsK CDS 546156..547412 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 transl_table 11 codon_start 1 locus_tag LOCUS_59810 CDS 547415..548545 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 transl_table 11 codon_start 1 locus_tag LOCUS_59820 gene wecB CDS complement(548920..550416) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 CDS complement(550691..551305) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS complement(551302..552174) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 gene rfbA CDS 552302..553180 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 transl_table 11 codon_start 1 locus_tag LOCUS_59860 gene rfbB CDS 553180..554013 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 gene rfbD CDS complement(553991..554638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59880 CDS 554831..557029 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS 557109..557996 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064705.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 CDS complement(558000..559511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS complement(559513..561510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS 561845..563506 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 gene sulP CDS 563503..564912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142795.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 CDS 564909..565973 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 transl_table 11 codon_start 1 locus_tag LOCUS_59950 CDS 566055..566762 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS 566799..567863 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS 567863..569074 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS 569109..569456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59990 CDS 569504..570820 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS complement(571155..571454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60010 CDS complement(571566..571745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS 572150..572734 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS 572881..574227 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS complement(574202..574654) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 CDS 575123..575998 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 transl_table 11 codon_start 1 locus_tag LOCUS_60060 CDS 576004..576504 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS 576501..578894 product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS 578903..579880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS 579884..580447 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS 580444..581304 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401863.1 transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS 581301..582254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS 582241..583515 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727166.1 transl_table 11 codon_start 1 locus_tag LOCUS_60130 CDS complement(583537..584493) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727160.1 transl_table 11 codon_start 1 locus_tag LOCUS_60140 CDS 584751..585386 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742191.1 transl_table 11 codon_start 1 locus_tag LOCUS_60150 CDS 585376..586392 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227851.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 CDS complement(586410..586901) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657947.1 transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS complement(586923..588758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(588755..589447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60190 CDS complement(589458..590009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS complement(590088..590588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS complement(590585..591232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60220 CDS complement(591238..591771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030243.1 transl_table 11 codon_start 1 locus_tag LOCUS_60230 CDS complement(591790..593100) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 transl_table 11 codon_start 1 locus_tag LOCUS_60240 CDS 593194..593547 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528288.1 transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS 593571..594899 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 transl_table 11 codon_start 1 locus_tag LOCUS_60260 CDS 595016..595711 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225513.1 transl_table 11 codon_start 1 locus_tag LOCUS_60270 CDS 595741..596112 product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225512.1 transl_table 11 codon_start 1 locus_tag LOCUS_60280 CDS 596158..596760 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 transl_table 11 codon_start 1 locus_tag LOCUS_60290 CDS complement(596941..597690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS 597914..598447 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_60310 CDS 598444..599163 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227870.1 transl_table 11 codon_start 1 locus_tag LOCUS_60320 sequence056 source 1..88079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60330 CDS 919..1380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60340 CDS complement(1385..2092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60350 CDS 2130..2639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60360 CDS 2858..4063 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_60370 CDS 4074..4463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS complement(4460..5011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60390 CDS complement(4989..6572) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223428.1 transl_table 11 codon_start 1 locus_tag LOCUS_60400 CDS 6777..7856 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS 7927..8160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60420 CDS complement(8126..9385) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS complement(9447..10088) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 transl_table 11 codon_start 1 locus_tag LOCUS_60440 CDS 10221..10865 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 transl_table 11 codon_start 1 locus_tag LOCUS_60450 CDS 11104..11553 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035800727.1 transl_table 11 codon_start 1 locus_tag LOCUS_60460 CDS complement(11634..12065) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 transl_table 11 codon_start 1 locus_tag LOCUS_60470 CDS complement(12345..14291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS complement(14388..15254) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS complement(15947..16231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60500 note possible pseudo, frameshifted CDS 16905..17306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60510 CDS 17404..18591 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 transl_table 11 codon_start 1 locus_tag LOCUS_60520 CDS 18678..20369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60530 CDS 20366..21175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60540 CDS 21183..22178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60550 CDS complement(22175..22888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60560 CDS 22935..23600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60570 CDS complement(23566..24660) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223768.1 transl_table 11 codon_start 1 locus_tag LOCUS_60580 CDS 24875..29248 product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 transl_table 11 codon_start 1 locus_tag LOCUS_60590 CDS complement(29245..30207) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534186.1 transl_table 11 codon_start 1 locus_tag LOCUS_60600 CDS 30258..30878 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 transl_table 11 codon_start 1 locus_tag LOCUS_60610 CDS complement(30853..32235) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 transl_table 11 codon_start 1 locus_tag LOCUS_60620 CDS complement(32252..33544) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223100.1 transl_table 11 codon_start 1 locus_tag LOCUS_60630 gene gabT CDS complement(33933..34307) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532314.1 transl_table 11 codon_start 1 locus_tag LOCUS_60640 CDS complement(34304..34555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60650 CDS complement(34623..35990) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 transl_table 11 codon_start 1 locus_tag LOCUS_60660 CDS complement(35994..36857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS complement(36854..37717) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 transl_table 11 codon_start 1 locus_tag LOCUS_60680 CDS complement(37719..38972) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 transl_table 11 codon_start 1 locus_tag LOCUS_60690 CDS complement(38974..40131) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS complement(40170..41606) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 transl_table 11 codon_start 1 locus_tag LOCUS_60710 CDS complement(41802..43280) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 transl_table 11 codon_start 1 locus_tag LOCUS_60720 CDS 43341..44777 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 transl_table 11 codon_start 1 locus_tag LOCUS_60730 CDS 45118..45684 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224171.1 transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS complement(45673..46206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60750 CDS complement(46709..48655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60760 CDS 48788..49801 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 transl_table 11 codon_start 1 locus_tag LOCUS_60770 CDS complement(49878..50768) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 CDS complement(50770..51693) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 transl_table 11 codon_start 1 locus_tag LOCUS_60790 CDS complement(51690..53033) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 transl_table 11 codon_start 1 locus_tag LOCUS_60800 CDS 53420..55690 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730344.1 transl_table 11 codon_start 1 locus_tag LOCUS_60810 CDS complement(55687..58356) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 transl_table 11 codon_start 1 locus_tag LOCUS_60820 CDS 58587..59420 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 transl_table 11 codon_start 1 locus_tag LOCUS_60830 CDS 59524..60504 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 transl_table 11 codon_start 1 locus_tag LOCUS_60840 CDS 60515..61528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60850 CDS complement(61586..61801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60860 CDS 61928..62629 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 transl_table 11 codon_start 1 locus_tag LOCUS_60870 CDS 62626..62979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60880 note possible pseudo, internal stop codon, frameshifted CDS 62981..63742 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 transl_table 11 codon_start 1 locus_tag LOCUS_60890 gene cbiQ CDS 63870..64655 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 transl_table 11 codon_start 1 locus_tag LOCUS_60900 CDS complement(64686..65387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60910 CDS complement(65777..66442) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS 66483..66932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60930 CDS 66942..67508 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 transl_table 11 codon_start 1 locus_tag LOCUS_60940 CDS 67552..68148 product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 transl_table 11 codon_start 1 locus_tag LOCUS_60950 CDS complement(68404..68889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60960 CDS complement(68898..70061) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 transl_table 11 codon_start 1 locus_tag LOCUS_60970 CDS complement(70064..70606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60980 CDS complement(70674..72635) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093101.1 transl_table 11 codon_start 1 locus_tag LOCUS_60990 CDS complement(72675..74012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61000 CDS complement(74111..75214) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228204.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 CDS complement(75211..76266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61020 CDS 76388..77434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61030 CDS 77431..78327 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 transl_table 11 codon_start 1 locus_tag LOCUS_61040 CDS 78324..79478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61050 CDS 79475..81775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61060 CDS 81906..82505 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 CDS complement(82520..83287) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 transl_table 11 codon_start 1 locus_tag LOCUS_61080 CDS complement(83284..83970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61090 CDS 84159..86879 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484153.1 transl_table 11 codon_start 1 locus_tag LOCUS_61100 CDS complement(86848..87492) product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 transl_table 11 codon_start 1 locus_tag LOCUS_61110 CDS complement(87652..87909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61120 sequence057 source 1..83007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS 331..651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61140 CDS 651..1703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61150 CDS 1757..2869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61160 CDS 2866..3627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61170 CDS complement(3557..4363) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 transl_table 11 codon_start 1 locus_tag LOCUS_61180 CDS complement(4360..4653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61190 CDS complement(4696..5652) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 transl_table 11 codon_start 1 locus_tag LOCUS_61200 CDS complement(5649..6329) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS complement(6342..7718) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226118.1 transl_table 11 codon_start 1 locus_tag LOCUS_61220 CDS complement(7715..8323) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 transl_table 11 codon_start 1 locus_tag LOCUS_61230 CDS complement(8323..9528) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 transl_table 11 codon_start 1 locus_tag LOCUS_61240 CDS complement(9513..10430) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 transl_table 11 codon_start 1 locus_tag LOCUS_61250 CDS complement(10427..12028) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206025215.1 transl_table 11 codon_start 1 locus_tag LOCUS_61260 CDS complement(12025..13068) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 transl_table 11 codon_start 1 locus_tag LOCUS_61270 CDS complement(13119..14774) product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 transl_table 11 codon_start 1 locus_tag LOCUS_61280 CDS 14889..16295 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226111.1 transl_table 11 codon_start 1 locus_tag LOCUS_61290 CDS complement(16323..17168) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226123.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 CDS complement(17209..18162) product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227034.1 transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS complement(18290..18949) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 transl_table 11 codon_start 1 locus_tag LOCUS_61320 CDS complement(18925..19338) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224980.1 transl_table 11 codon_start 1 locus_tag LOCUS_61330 CDS complement(19335..20180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61340 CDS 20385..21251 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776664.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 gene folP CDS complement(21252..21812) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 transl_table 11 codon_start 1 locus_tag LOCUS_61360 CDS 21878..23284 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 transl_table 11 codon_start 1 locus_tag LOCUS_61370 CDS complement(23578..24399) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 transl_table 11 codon_start 1 locus_tag LOCUS_61380 CDS 24496..25419 product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 CDS 25423..25788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61400 CDS 25791..27980 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 transl_table 11 codon_start 1 locus_tag LOCUS_61410 CDS 28038..29345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61420 CDS complement(29497..31317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61430 CDS 31429..31857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61440 CDS complement(32009..32641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61450 CDS complement(32638..34122) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 transl_table 11 codon_start 1 locus_tag LOCUS_61460 CDS 34176..35033 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 CDS 35115..35270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61480 CDS 35267..36094 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 transl_table 11 codon_start 1 locus_tag LOCUS_61490 CDS complement(36222..37124) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027411.1 transl_table 11 codon_start 1 locus_tag LOCUS_61500 CDS complement(38032..39861) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467081.1 transl_table 11 codon_start 1 locus_tag LOCUS_61510 gene htpG CDS complement(39958..41241) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 transl_table 11 codon_start 1 locus_tag LOCUS_61520 CDS 41404..42255 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026921.1 transl_table 11 codon_start 1 locus_tag LOCUS_61530 CDS 42310..44580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61540 CDS 44695..44814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61550 CDS 44853..45635 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 transl_table 11 codon_start 1 locus_tag LOCUS_61560 CDS 45722..47404 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 transl_table 11 codon_start 1 locus_tag LOCUS_61570 CDS 47401..48435 product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 transl_table 11 codon_start 1 locus_tag LOCUS_61580 CDS 48774..49019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS complement(49066..49452) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 transl_table 11 codon_start 1 locus_tag LOCUS_61600 CDS complement(49507..50439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61610 CDS complement(50817..51197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61620 CDS complement(51273..55220) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_61630 gene hrpA CDS complement(55288..56088) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 transl_table 11 codon_start 1 locus_tag LOCUS_61640 CDS complement(56148..58607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61650 CDS complement(58656..59825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61660 CDS 60061..61014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61670 CDS 61011..61577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS complement(61740..62519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61690 CDS 62734..63531 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 transl_table 11 codon_start 1 locus_tag LOCUS_61700 CDS 63534..63995 product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 transl_table 11 codon_start 1 locus_tag LOCUS_61710 CDS complement(63992..64906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS complement(64896..65402) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 transl_table 11 codon_start 1 locus_tag LOCUS_61730 CDS complement(65659..66144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485905.1 transl_table 11 codon_start 1 locus_tag LOCUS_61740 CDS 66324..66623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61750 CDS 66855..68819 product DUF3416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224467.1 transl_table 11 codon_start 1 locus_tag LOCUS_61760 CDS 68845..70638 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400893.1 transl_table 11 codon_start 1 locus_tag LOCUS_61770 gene treS CDS 70635..71945 product maltokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899824.1 transl_table 11 codon_start 1 locus_tag LOCUS_61780 gene mak CDS 71963..74113 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 transl_table 11 codon_start 1 locus_tag LOCUS_61790 gene glgB CDS 74419..74583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61800 CDS 74588..75781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61810 CDS 75771..77459 product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317561.1 transl_table 11 codon_start 1 locus_tag LOCUS_61820 CDS 77456..78775 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_61830 CDS 78806..79018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 79034..79798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61850 CDS 79809..80318 product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 transl_table 11 codon_start 1 locus_tag LOCUS_61860 CDS complement(80402..80779) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 transl_table 11 codon_start 1 locus_tag LOCUS_61870 CDS 81125..81619 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 transl_table 11 codon_start 1 locus_tag LOCUS_61880 CDS 81700..82653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61890 sequence058 source 1..80084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..779) product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 transl_table 11 codon_start 1 locus_tag LOCUS_61900 CDS complement(1028..1282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61910 CDS complement(1342..1836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS complement(2139..3152) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 transl_table 11 codon_start 1 locus_tag LOCUS_61930 CDS 3272..4429 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 4426..5526 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 transl_table 11 codon_start 1 locus_tag LOCUS_61950 CDS 5523..6326 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 CDS 6323..7045 product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 transl_table 11 codon_start 1 locus_tag LOCUS_61970 CDS complement(7027..7698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61980 CDS complement(7801..8664) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031381.1 transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 8768..10648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62000 CDS 10702..11931 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 transl_table 11 codon_start 1 locus_tag LOCUS_62010 CDS complement(12023..13165) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226276.1 transl_table 11 codon_start 1 locus_tag LOCUS_62020 CDS complement(13302..14753) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_62030 CDS complement(14744..16030) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 transl_table 11 codon_start 1 locus_tag LOCUS_62040 CDS complement(16027..17424) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 transl_table 11 codon_start 1 locus_tag LOCUS_62050 gene uxaC CDS complement(17424..18707) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467112.1 transl_table 11 codon_start 1 locus_tag LOCUS_62060 CDS 18920..19954 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 transl_table 11 codon_start 1 locus_tag LOCUS_62070 CDS 19967..21289 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972769.1 transl_table 11 codon_start 1 locus_tag LOCUS_62080 CDS 21286..22251 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229175.1 transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS 22251..23075 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226274.1 transl_table 11 codon_start 1 locus_tag LOCUS_62100 CDS 23083..23742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62110 CDS complement(23813..24637) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 transl_table 11 codon_start 1 locus_tag LOCUS_62120 CDS 24755..25714 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 transl_table 11 codon_start 1 locus_tag LOCUS_62130 CDS complement(25619..26005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62140 CDS 26100..27341 product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 transl_table 11 codon_start 1 locus_tag LOCUS_62150 gene aldO CDS 27478..28446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62160 CDS 28610..30673 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 transl_table 11 codon_start 1 locus_tag LOCUS_62170 gene ftsH CDS 30966..31790 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803928.1 transl_table 11 codon_start 1 locus_tag LOCUS_62180 CDS complement(31994..34558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62190 CDS complement(34957..37164) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 transl_table 11 codon_start 1 locus_tag LOCUS_62200 CDS 37403..38170 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222010.1 transl_table 11 codon_start 1 locus_tag LOCUS_62210 CDS 38320..38877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62220 CDS 38894..41074 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 transl_table 11 codon_start 1 locus_tag LOCUS_62230 tRNA complement(40179..40271) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(41141..41707) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_62240 CDS 42084..46856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62250 CDS complement(46931..48352) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_62260 CDS complement(48647..49744) product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229171.1 transl_table 11 codon_start 1 locus_tag LOCUS_62270 CDS complement(49828..50874) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 transl_table 11 codon_start 1 locus_tag LOCUS_62280 CDS complement(50939..51832) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 transl_table 11 codon_start 1 locus_tag LOCUS_62290 CDS complement(51835..52746) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 transl_table 11 codon_start 1 locus_tag LOCUS_62300 CDS complement(52749..54044) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 transl_table 11 codon_start 1 locus_tag LOCUS_62310 CDS 54206..56635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62320 CDS 56653..58167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62330 CDS complement(58225..59574) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 transl_table 11 codon_start 1 locus_tag LOCUS_62340 CDS complement(59584..59988) product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 gene sodN CDS 60174..62456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62360 CDS complement(62446..65460) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 transl_table 11 codon_start 1 locus_tag LOCUS_62370 CDS complement(65462..66664) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 transl_table 11 codon_start 1 locus_tag LOCUS_62380 CDS complement(66701..67522) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS complement(67591..68469) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804717.1 transl_table 11 codon_start 1 locus_tag LOCUS_62400 CDS complement(68531..69823) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 transl_table 11 codon_start 1 locus_tag LOCUS_62410 CDS 69965..70993 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 transl_table 11 codon_start 1 locus_tag LOCUS_62420 CDS complement(71042..71983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62430 CDS 72132..73235 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911735.1 transl_table 11 codon_start 1 locus_tag LOCUS_62440 CDS 73232..73765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62450 CDS complement(73813..75726) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 transl_table 11 codon_start 1 locus_tag LOCUS_62460 CDS 76016..76438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS 76600..77586 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529607.1 transl_table 11 codon_start 1 locus_tag LOCUS_62480 CDS 77587..78042 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_62490 CDS 78044..79549 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 transl_table 11 codon_start 1 locus_tag LOCUS_62500 sequence059 source 1..76995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..431) product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 CDS 340..576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62520 CDS complement(591..1028) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 transl_table 11 codon_start 1 locus_tag LOCUS_62530 CDS complement(1132..1686) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207760114.1 transl_table 11 codon_start 1 locus_tag LOCUS_62540 CDS 1768..3948 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 transl_table 11 codon_start 1 locus_tag LOCUS_62550 CDS 4087..4653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62560 CDS 4668..5492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62570 CDS 5560..7698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62580 CDS 7733..11152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62590 CDS 11149..14451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62600 CDS 14456..19690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62610 CDS 19687..21504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62620 CDS complement(22029..22490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62630 CDS complement(22491..23255) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082824.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 CDS 23304..23825 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224194.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 CDS complement(23984..24451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62660 CDS 24664..26298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62670 CDS 26329..27675 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS 27672..29588 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 transl_table 11 codon_start 1 locus_tag LOCUS_62690 CDS 29815..30162 product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990797.1 transl_table 11 codon_start 1 locus_tag LOCUS_62700 CDS complement(30173..30652) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530895.1 transl_table 11 codon_start 1 locus_tag LOCUS_62710 CDS 30764..31507 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252874.1 transl_table 11 codon_start 1 locus_tag LOCUS_62720 CDS complement(31511..31831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62730 CDS complement(31842..33590) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 transl_table 11 codon_start 1 locus_tag LOCUS_62740 tRNA 33619..33692 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(34086..34970) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS complement(35007..35444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62760 CDS complement(35540..37054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62770 CDS complement(37054..37683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62780 CDS 38009..39064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS complement(39104..40369) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 transl_table 11 codon_start 1 locus_tag LOCUS_62800 CDS complement(40411..40857) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228548.1 transl_table 11 codon_start 1 locus_tag LOCUS_62810 CDS 41048..42211 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225019.1 transl_table 11 codon_start 1 locus_tag LOCUS_62820 CDS 42222..42968 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523228.1 transl_table 11 codon_start 1 locus_tag LOCUS_62830 CDS 42965..43669 product ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_62840 gene aadA1 CDS complement(43652..43786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62850 CDS 44076..44600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62860 CDS 45133..45966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62870 CDS complement(45970..47163) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 transl_table 11 codon_start 1 locus_tag LOCUS_62880 CDS 47313..47981 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 transl_table 11 codon_start 1 locus_tag LOCUS_62890 CDS complement(47947..48927) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228244.1 transl_table 11 codon_start 1 locus_tag LOCUS_62900 CDS 49142..50254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62910 CDS complement(50238..51701) product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 CDS complement(51770..52552) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_62930 CDS 52614..54071 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877909.1 transl_table 11 codon_start 1 locus_tag LOCUS_62940 CDS 54133..55794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 transl_table 11 codon_start 1 locus_tag LOCUS_62950 CDS 55925..57181 product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS 57237..58184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62970 CDS 58274..58867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62980 CDS complement(58864..59094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62990 CDS complement(59144..59545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63000 CDS complement(59631..61601) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 transl_table 11 codon_start 1 locus_tag LOCUS_63010 CDS complement(61633..62979) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 transl_table 11 codon_start 1 locus_tag LOCUS_63020 CDS complement(63003..63917) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS complement(63914..64834) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 transl_table 11 codon_start 1 locus_tag LOCUS_63040 CDS 65036..65995 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 transl_table 11 codon_start 1 locus_tag LOCUS_63050 CDS 66006..66899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS 67249..68508 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223198.1 transl_table 11 codon_start 1 locus_tag LOCUS_63070 CDS 68553..69536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63080 CDS 69569..70069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63090 CDS 70098..70325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63100 CDS complement(70287..70859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63110 CDS 71091..71825 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228773.1 transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS 71825..72049 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228772.1 transl_table 11 codon_start 1 locus_tag LOCUS_63130 gene infA CDS complement(72280..72924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105965.1 transl_table 11 codon_start 1 locus_tag LOCUS_63140 CDS complement(73118..73750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63150 CDS complement(74395..74703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63160 CDS complement(74704..74922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63170 CDS 74999..75691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63180 CDS 75857..76189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63190 CDS 76339..76926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63200 sequence060 source 1..73165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..1458 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_63210 CDS complement(1422..1985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63220 CDS complement(2008..2469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63230 CDS 2468..2989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63240 CDS 2986..3186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63250 CDS 3179..3598 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS 3683..4846 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872865.1 transl_table 11 codon_start 1 locus_tag LOCUS_63270 CDS 4896..5231 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413583.1 transl_table 11 codon_start 1 locus_tag LOCUS_63280 CDS 5328..5498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63290 CDS 5492..5923 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 transl_table 11 codon_start 1 locus_tag LOCUS_63300 CDS complement(5925..6620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63310 note possible pseudo, frameshifted CDS complement(6575..6853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63320 note possible pseudo, frameshifted CDS complement(6961..7674) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_63330 CDS 7947..8165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63340 CDS 8402..8632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63350 CDS complement(8751..9218) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223301.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 CDS complement(9261..10010) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087138.1 transl_table 11 codon_start 1 locus_tag LOCUS_63370 CDS 10070..10549 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 transl_table 11 codon_start 1 locus_tag LOCUS_63380 CDS complement(11034..11624) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 transl_table 11 codon_start 1 locus_tag LOCUS_63390 CDS 11753..12178 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897995.1 transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS complement(12516..12896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63410 CDS complement(13443..13589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63420 note possible pseudo, frameshifted CDS 13610..13867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63430 CDS complement(14177..14377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63440 CDS 14629..16218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63450 CDS complement(16130..16411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63460 CDS complement(16620..17492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63470 CDS complement(17516..18373) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227389.1 transl_table 11 codon_start 1 locus_tag LOCUS_63480 CDS complement(18579..18845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63490 CDS complement(18748..19275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63500 CDS 19444..19749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63510 CDS complement(19847..22297) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 transl_table 11 codon_start 1 locus_tag LOCUS_63520 CDS complement(22401..22865) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931873.1 transl_table 11 codon_start 1 locus_tag LOCUS_63530 CDS 23064..24398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63540 CDS 24509..25363 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_63550 CDS complement(25950..26354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63560 CDS 26594..26902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63570 CDS 26986..28395 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 transl_table 11 codon_start 1 locus_tag LOCUS_63580 CDS 28409..28855 product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 transl_table 11 codon_start 1 locus_tag LOCUS_63590 CDS complement(28874..29401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63600 CDS 30059..30784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63610 CDS 30816..31100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63620 CDS complement(31167..32006) product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 transl_table 11 codon_start 1 locus_tag LOCUS_63630 CDS complement(32237..33100) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 transl_table 11 codon_start 1 locus_tag LOCUS_63640 CDS complement(33620..34120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63650 CDS complement(34228..34377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63660 CDS complement(34334..35176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63670 CDS complement(35476..35910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63680 CDS complement(35982..36257) product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 transl_table 11 codon_start 1 locus_tag LOCUS_63690 CDS complement(36441..36857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63700 CDS complement(36912..37382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63710 CDS complement(37512..38021) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 transl_table 11 codon_start 1 locus_tag LOCUS_63720 CDS 38391..38693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63730 CDS 38874..40040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63740 CDS 40059..41066 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 CDS 41227..41907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63760 CDS 42201..43520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63770 CDS complement(43427..43633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63780 CDS 43697..45721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63790 CDS 45721..46635 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392170.1 transl_table 11 codon_start 1 locus_tag LOCUS_63800 CDS 46632..47180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63810 CDS complement(47518..47994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63820 CDS complement(48235..48573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63830 CDS complement(48668..49186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63840 CDS 49237..49497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63850 CDS 50047..50262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63860 note possible pseudo, internal stop codon, frameshifted CDS 50499..52070 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_63870 CDS 52063..52731 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_63880 CDS 53373..54215 product IS5-like element IS470 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029009.1 transl_table 11 codon_start 1 locus_tag LOCUS_63890 CDS 54603..54989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63900 CDS 55023..55694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63910 CDS complement(55859..56425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63920 CDS complement(56422..57783) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 transl_table 11 codon_start 1 locus_tag LOCUS_63930 CDS complement(57780..58208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63940 CDS 58432..58728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63950 CDS 58725..59324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63960 CDS 59416..59715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63970 CDS 59849..60229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63980 CDS complement(60236..61255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63990 note possible pseudo, frameshifted CDS complement(61221..62069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64000 note possible pseudo, frameshifted CDS complement(62079..63131) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 transl_table 11 codon_start 1 locus_tag LOCUS_64010 CDS complement(63142..64446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64020 CDS complement(64546..65058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64030 CDS complement(65100..65516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64040 CDS 65995..66894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64050 note possible pseudo, internal stop codon, frameshifted CDS complement(66992..67426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64060 CDS complement(67423..67992) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031560.1 transl_table 11 codon_start 1 locus_tag LOCUS_64070 CDS 68549..69700 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 transl_table 11 codon_start 1 locus_tag LOCUS_64080 CDS 69805..70689 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 transl_table 11 codon_start 1 locus_tag LOCUS_64090 CDS 70689..71528 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 transl_table 11 codon_start 1 locus_tag LOCUS_64100 CDS 71539..72741 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 transl_table 11 codon_start 1 locus_tag LOCUS_64110 gene ugpC CDS 72836..72994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64120 sequence061 source 1..72824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(825..1325) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416005.1 transl_table 11 codon_start 1 locus_tag LOCUS_64130 CDS complement(1403..1723) product multidrug efflux SMR transporter Mmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415995.1 transl_table 11 codon_start 1 locus_tag LOCUS_64140 gene mmr CDS complement(1943..3454) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 transl_table 11 codon_start 1 locus_tag LOCUS_64150 CDS complement(3504..4082) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 transl_table 11 codon_start 1 locus_tag LOCUS_64160 CDS complement(4079..5368) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 transl_table 11 codon_start 1 locus_tag LOCUS_64170 CDS 5363..5764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64180 CDS 5788..6288 product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 transl_table 11 codon_start 1 locus_tag LOCUS_64190 CDS 6337..6759 product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 transl_table 11 codon_start 1 locus_tag LOCUS_64200 CDS 6888..7247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64210 CDS 7252..8217 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084687.1 transl_table 11 codon_start 1 locus_tag LOCUS_64220 CDS complement(8214..8624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64230 CDS 8886..9632 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 transl_table 11 codon_start 1 locus_tag LOCUS_64240 CDS 9704..10915 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 transl_table 11 codon_start 1 locus_tag LOCUS_64250 CDS 11044..11772 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_64260 gene rph CDS 11769..12383 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 transl_table 11 codon_start 1 locus_tag LOCUS_64270 gene rdgB CDS 12439..12609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64280 CDS 12744..14036 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095295.1 transl_table 11 codon_start 1 locus_tag LOCUS_64290 CDS 14033..15202 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 transl_table 11 codon_start 1 locus_tag LOCUS_64300 CDS 15199..16044 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 transl_table 11 codon_start 1 locus_tag LOCUS_64310 CDS 16046..16945 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726731.1 transl_table 11 codon_start 1 locus_tag LOCUS_64320 gene murQ CDS complement(17028..18608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64330 CDS 18782..19609 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 transl_table 11 codon_start 1 locus_tag LOCUS_64340 CDS 19630..21270 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 transl_table 11 codon_start 1 locus_tag LOCUS_64350 gene hutU CDS 21267..22439 product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 transl_table 11 codon_start 1 locus_tag LOCUS_64360 CDS 22436..23773 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 transl_table 11 codon_start 1 locus_tag LOCUS_64370 CDS 23770..24918 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 transl_table 11 codon_start 1 locus_tag LOCUS_64380 gene hutI CDS 24915..26450 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 transl_table 11 codon_start 1 locus_tag LOCUS_64390 gene hutH CDS 26475..28160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64400 CDS 28216..28737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64410 CDS 28734..29492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64420 CDS complement(29529..30032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64430 CDS 30101..30715 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 transl_table 11 codon_start 1 locus_tag LOCUS_64440 CDS complement(30675..32735) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_64450 CDS 32881..33456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64460 CDS 33501..34298 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 transl_table 11 codon_start 1 locus_tag LOCUS_64470 CDS 34393..35340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64480 CDS complement(35483..36004) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 transl_table 11 codon_start 1 locus_tag LOCUS_64490 tRNA complement(36136..36220) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(36419..36895) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 transl_table 11 codon_start 1 locus_tag LOCUS_64500 gene bcp CDS complement(36938..37930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64510 CDS complement(37927..38679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64520 CDS complement(38676..39170) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_64530 CDS complement(39247..39783) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 transl_table 11 codon_start 1 locus_tag LOCUS_64540 CDS 39927..41546 product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228657.1 transl_table 11 codon_start 1 locus_tag LOCUS_64550 CDS 41770..45447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64560 CDS 45758..46333 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096508.1 transl_table 11 codon_start 1 locus_tag LOCUS_64570 gene orn tRNA 46446..46521 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(46681..48543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64580 CDS complement(48540..49295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64590 CDS complement(49570..49941) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 transl_table 11 codon_start 1 locus_tag LOCUS_64600 CDS complement(49951..50697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64610 CDS complement(50802..51101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64620 CDS complement(51129..51596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64630 CDS complement(51652..52644) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028254.1 transl_table 11 codon_start 1 locus_tag LOCUS_64640 CDS complement(52838..54040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64650 CDS 54232..54705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64660 CDS 54698..55414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64670 CDS 55538..59116 product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 transl_table 11 codon_start 1 locus_tag LOCUS_64680 CDS complement(59145..60092) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 transl_table 11 codon_start 1 locus_tag LOCUS_64690 CDS 60264..61367 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090484.1 transl_table 11 codon_start 1 locus_tag LOCUS_64700 CDS 62118..63461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64710 CDS 63461..64630 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 transl_table 11 codon_start 1 locus_tag LOCUS_64720 CDS 64661..65404 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 transl_table 11 codon_start 1 locus_tag LOCUS_64730 CDS 65406..66701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64740 CDS complement(67298..68356) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_64750 CDS complement(68356..69324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64760 CDS complement(69321..70208) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 transl_table 11 codon_start 1 locus_tag LOCUS_64770 CDS complement(70208..71206) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 transl_table 11 codon_start 1 locus_tag LOCUS_64780 CDS complement(71224..71976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64790 CDS 72187..72681 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 transl_table 11 codon_start 1 locus_tag LOCUS_64800 sequence062 source 1..70973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64810 CDS complement(706..1584) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_64820 CDS 1732..2718 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 transl_table 11 codon_start 1 locus_tag LOCUS_64830 CDS 2887..5352 product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 transl_table 11 codon_start 1 locus_tag LOCUS_64840 CDS complement(5356..6009) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 transl_table 11 codon_start 1 locus_tag LOCUS_64850 CDS 6292..6498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64860 CDS complement(6495..7655) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 transl_table 11 codon_start 1 locus_tag LOCUS_64870 CDS complement(7670..8167) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133875918.1 transl_table 11 codon_start 1 locus_tag LOCUS_64880 CDS complement(8257..8625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64890 CDS complement(8746..9678) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 transl_table 11 codon_start 1 locus_tag LOCUS_64900 CDS 9800..9943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64910 CDS complement(10018..10362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64920 CDS 10579..12303 product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 transl_table 11 codon_start 1 locus_tag LOCUS_64930 CDS 12379..13356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 transl_table 11 codon_start 1 locus_tag LOCUS_64940 CDS 13454..13780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64950 CDS 13848..14210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64960 CDS 14559..15926 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 transl_table 11 codon_start 1 locus_tag LOCUS_64970 gene acsA CDS 16100..17521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64980 CDS complement(17578..18267) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 transl_table 11 codon_start 1 locus_tag LOCUS_64990 CDS complement(18447..18620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65000 CDS 18767..20992 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390748.1 transl_table 11 codon_start 1 locus_tag LOCUS_65010 gene pflB CDS 20992..21741 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112608.1 transl_table 11 codon_start 1 locus_tag LOCUS_65020 gene pflA CDS 21815..22822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 transl_table 11 codon_start 1 locus_tag LOCUS_65030 CDS 22878..24365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65040 CDS complement(24419..25396) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 transl_table 11 codon_start 1 locus_tag LOCUS_65050 CDS 25659..26006 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 transl_table 11 codon_start 1 locus_tag LOCUS_65060 CDS complement(26034..27692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65070 note possible pseudo, frameshifted CDS complement(27689..29407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65080 note possible pseudo, frameshifted CDS complement(29425..30420) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 transl_table 11 codon_start 1 locus_tag LOCUS_65090 gene cydB CDS complement(30433..31821) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 transl_table 11 codon_start 1 locus_tag LOCUS_65100 CDS complement(31938..33440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65110 CDS complement(33444..34025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65120 CDS complement(34185..35882) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 transl_table 11 codon_start 1 locus_tag LOCUS_65130 CDS complement(35889..36185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65140 CDS complement(36522..36722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65150 CDS 37079..38044 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 transl_table 11 codon_start 1 locus_tag LOCUS_65160 CDS complement(38064..39287) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222809.1 transl_table 11 codon_start 1 locus_tag LOCUS_65170 CDS complement(39284..39925) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 transl_table 11 codon_start 1 locus_tag LOCUS_65180 CDS 40103..40660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 transl_table 11 codon_start 1 locus_tag LOCUS_65190 CDS 40748..41452 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 transl_table 11 codon_start 1 locus_tag LOCUS_65200 CDS 41555..42229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65210 CDS complement(42207..43577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65220 CDS complement(43570..44262) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 transl_table 11 codon_start 1 locus_tag LOCUS_65230 CDS complement(44366..44881) product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 transl_table 11 codon_start 1 locus_tag LOCUS_65240 CDS complement(44896..45210) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 transl_table 11 codon_start 1 locus_tag LOCUS_65250 CDS complement(45207..46457) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 transl_table 11 codon_start 1 locus_tag LOCUS_65260 CDS complement(46719..47900) product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 transl_table 11 codon_start 1 locus_tag LOCUS_65270 CDS complement(48356..48844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65280 CDS complement(48971..49705) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 transl_table 11 codon_start 1 locus_tag LOCUS_65290 CDS 49847..50722 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 transl_table 11 codon_start 1 locus_tag LOCUS_65300 CDS complement(50688..51179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65310 CDS complement(51389..51733) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 transl_table 11 codon_start 1 locus_tag LOCUS_65320 CDS 51828..54047 product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227243.1 transl_table 11 codon_start 1 locus_tag LOCUS_65330 CDS 54300..54788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65340 CDS 54911..56152 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 transl_table 11 codon_start 1 locus_tag LOCUS_65350 CDS 56336..57376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 transl_table 11 codon_start 1 locus_tag LOCUS_65360 CDS 57428..59056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65370 CDS 59371..60003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65380 CDS complement(59946..60323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65390 CDS 60210..60974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65400 CDS 60992..63673 product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 transl_table 11 codon_start 1 locus_tag LOCUS_65410 tRNA 62638..62716 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 63694..64557 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_65420 CDS 64643..64942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65430 CDS 64939..67092 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 transl_table 11 codon_start 1 locus_tag LOCUS_65440 CDS complement(67128..68408) product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900036.1 transl_table 11 codon_start 1 locus_tag LOCUS_65450 CDS 68892..69110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65460 sequence063 source 1..70343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..2064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65470 CDS 1954..2895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65480 note possible pseudo, frameshifted CDS 2892..3890 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 transl_table 11 codon_start 1 locus_tag LOCUS_65490 CDS complement(3912..4247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 transl_table 11 codon_start 1 locus_tag LOCUS_65500 CDS 4356..5192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65510 CDS 5192..5449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65520 CDS 5457..6338 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 transl_table 11 codon_start 1 locus_tag LOCUS_65530 CDS 6335..7222 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 transl_table 11 codon_start 1 locus_tag LOCUS_65540 CDS 7280..9067 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 transl_table 11 codon_start 1 locus_tag LOCUS_65550 gene recN CDS 9188..10366 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 transl_table 11 codon_start 1 locus_tag LOCUS_65560 gene steA CDS 10380..11321 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_65570 CDS 11347..12174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 transl_table 11 codon_start 1 locus_tag LOCUS_65580 CDS 12171..13718 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 transl_table 11 codon_start 1 locus_tag LOCUS_65590 CDS 13738..14841 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 transl_table 11 codon_start 1 locus_tag LOCUS_65600 CDS 14838..17066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65610 CDS 17145..18824 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 transl_table 11 codon_start 1 locus_tag LOCUS_65620 CDS 18833..19417 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 transl_table 11 codon_start 1 locus_tag LOCUS_65630 CDS complement(19729..20349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65640 CDS complement(20383..20802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65650 CDS 20865..21542 product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 transl_table 11 codon_start 1 locus_tag LOCUS_65660 CDS 21959..22696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65670 CDS 22828..23580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65680 CDS complement(23559..24557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65690 CDS complement(24646..26151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65700 CDS complement(26256..26951) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026985.1 transl_table 11 codon_start 1 locus_tag LOCUS_65710 CDS 27010..27753 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226563.1 transl_table 11 codon_start 1 locus_tag LOCUS_65720 CDS 27758..27997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65730 CDS complement(27998..28669) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 transl_table 11 codon_start 1 locus_tag LOCUS_65740 CDS 28724..29671 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971534.1 transl_table 11 codon_start 1 locus_tag LOCUS_65750 CDS 29791..30906 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 transl_table 11 codon_start 1 locus_tag LOCUS_65760 gene ald CDS 30909..31814 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 transl_table 11 codon_start 1 locus_tag LOCUS_65770 gene xerD CDS 31968..32897 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 transl_table 11 codon_start 1 locus_tag LOCUS_65780 CDS 32902..33570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65790 CDS 33632..34018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65800 CDS complement(34118..34531) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 transl_table 11 codon_start 1 locus_tag LOCUS_65810 CDS 34764..35918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65820 CDS 35915..37381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65830 CDS 37368..38105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65840 CDS complement(38203..39141) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223358.1 transl_table 11 codon_start 1 locus_tag LOCUS_65850 CDS 39244..39840 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895252.1 transl_table 11 codon_start 1 locus_tag LOCUS_65860 CDS complement(39962..40621) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 transl_table 11 codon_start 1 locus_tag LOCUS_65870 CDS 40731..41411 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110867.1 transl_table 11 codon_start 1 locus_tag LOCUS_65880 gene cmk CDS 41408..42811 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 transl_table 11 codon_start 1 locus_tag LOCUS_65890 gene der tRNA 42861..42937 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 43383..44126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65900 CDS 44521..48738 product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 transl_table 11 codon_start 1 locus_tag LOCUS_65910 gene pglW CDS 48742..52302 product BREX-2 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030180.1 transl_table 11 codon_start 1 locus_tag LOCUS_65920 gene pglX CDS 52334..56074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031061.1 transl_table 11 codon_start 1 locus_tag LOCUS_65930 CDS 56071..58827 product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 transl_table 11 codon_start 1 locus_tag LOCUS_65940 gene pglZ CDS 58824..60128 product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 transl_table 11 codon_start 1 locus_tag LOCUS_65950 gene brxD tRNA 59467..59555 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 60125..62239 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 transl_table 11 codon_start 1 locus_tag LOCUS_65960 CDS 62400..63059 product tellurite resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875478.1 transl_table 11 codon_start 1 locus_tag LOCUS_65970 CDS 63137..64492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65980 CDS 64489..67956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65990 CDS 67937..69514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66000 CDS 69514..70281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66010 sequence064 source 1..50176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1430) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 transl_table 11 codon_start 1 locus_tag LOCUS_66020 CDS 1523..1702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66030 CDS 1776..2468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66040 CDS 2478..3035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66050 CDS complement(3029..3472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66060 CDS 3637..4152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66070 CDS complement(4159..4620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66080 CDS complement(4638..4856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66090 CDS 5045..5614 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729526.1 transl_table 11 codon_start 1 locus_tag LOCUS_66100 CDS 5620..6498 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 transl_table 11 codon_start 1 locus_tag LOCUS_66110 CDS complement(6552..7151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66120 CDS complement(7213..7827) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 transl_table 11 codon_start 1 locus_tag LOCUS_66130 CDS complement(7876..8811) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804290.1 transl_table 11 codon_start 1 locus_tag LOCUS_66140 CDS 8832..9896 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258391.1 transl_table 11 codon_start 1 locus_tag LOCUS_66150 CDS 9971..10603 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 transl_table 11 codon_start 1 locus_tag LOCUS_66160 CDS 10648..11820 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 transl_table 11 codon_start 1 locus_tag LOCUS_66170 CDS 11817..12563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66180 CDS 12560..13381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66190 CDS complement(13391..14881) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 transl_table 11 codon_start 1 locus_tag LOCUS_66200 CDS 15003..15836 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726937.1 transl_table 11 codon_start 1 locus_tag LOCUS_66210 CDS complement(15851..16849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66220 CDS complement(17333..18160) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804489.1 transl_table 11 codon_start 1 locus_tag LOCUS_66230 CDS complement(18260..18610) product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 transl_table 11 codon_start 1 locus_tag LOCUS_66240 CDS complement(18640..19107) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 transl_table 11 codon_start 1 locus_tag LOCUS_66250 CDS complement(19182..19538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66260 CDS 19648..19818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66270 CDS complement(19857..20849) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 transl_table 11 codon_start 1 locus_tag LOCUS_66280 CDS complement(20857..22128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66290 CDS complement(22233..22751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66300 CDS complement(22786..23427) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403546.1 transl_table 11 codon_start 1 locus_tag LOCUS_66310 CDS complement(23471..24478) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225625.1 transl_table 11 codon_start 1 locus_tag LOCUS_66320 CDS complement(24483..25121) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 transl_table 11 codon_start 1 locus_tag LOCUS_66330 CDS complement(25114..25467) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079340.1 transl_table 11 codon_start 1 locus_tag LOCUS_66340 CDS 25591..26418 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 transl_table 11 codon_start 1 locus_tag LOCUS_66350 CDS 26496..27890 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 transl_table 11 codon_start 1 locus_tag LOCUS_66360 CDS complement(27969..29426) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 transl_table 11 codon_start 1 locus_tag LOCUS_66370 CDS 29474..30835 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976065.1 transl_table 11 codon_start 1 locus_tag LOCUS_66380 CDS 30897..32414 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113065.1 transl_table 11 codon_start 1 locus_tag LOCUS_66390 CDS complement(32402..33499) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486431.1 transl_table 11 codon_start 1 locus_tag LOCUS_66400 CDS 33399..33698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66410 CDS complement(33794..38326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66420 CDS complement(38610..39356) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 transl_table 11 codon_start 1 locus_tag LOCUS_66430 CDS complement(39353..39859) product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 transl_table 11 codon_start 1 locus_tag LOCUS_66440 CDS complement(39887..40081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66450 CDS 40304..40870 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 transl_table 11 codon_start 1 locus_tag LOCUS_66460 CDS complement(40874..42247) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 transl_table 11 codon_start 1 locus_tag LOCUS_66470 CDS complement(42244..43182) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804376.1 transl_table 11 codon_start 1 locus_tag LOCUS_66480 CDS complement(43194..44090) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804377.1 transl_table 11 codon_start 1 locus_tag LOCUS_66490 CDS complement(44100..46232) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804378.1 transl_table 11 codon_start 1 locus_tag LOCUS_66500 CDS 46411..47991 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389831.1 transl_table 11 codon_start 1 locus_tag LOCUS_66510 CDS 47991..48899 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479983.1 transl_table 11 codon_start 1 locus_tag LOCUS_66520 CDS 49021..49149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66530 CDS 49209..49529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66540 CDS complement(49575..49967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66550 sequence065 source 1..49360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..2011) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 transl_table 11 codon_start 1 locus_tag LOCUS_66560 CDS complement(2178..3158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66570 CDS 3359..3655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66580 CDS complement(3780..4094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66590 CDS 4112..5335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66600 note possible pseudo, frameshifted CDS 5337..5660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66610 CDS complement(5705..6916) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 transl_table 11 codon_start 1 locus_tag LOCUS_66620 CDS 7113..7898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66630 CDS complement(7917..8336) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727240.1 transl_table 11 codon_start 1 locus_tag LOCUS_66640 CDS complement(8422..8703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66650 CDS 8891..10204 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 transl_table 11 codon_start 1 locus_tag LOCUS_66660 gene nhaA CDS 10236..10457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66670 note possible pseudo, frameshifted CDS 10457..11545 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 transl_table 11 codon_start 1 locus_tag LOCUS_66680 note possible pseudo, frameshifted CDS complement(11527..12819) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 transl_table 11 codon_start 1 locus_tag LOCUS_66690 CDS complement(12894..13229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66700 CDS complement(13360..13845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66710 CDS complement(14095..14397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66720 CDS complement(14405..14659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66730 CDS complement(14989..15297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66740 CDS 15563..16114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66750 CDS complement(16255..17565) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406627.1 transl_table 11 codon_start 1 locus_tag LOCUS_66760 CDS 17757..18770 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 transl_table 11 codon_start 1 locus_tag LOCUS_66770 CDS complement(18789..20300) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 transl_table 11 codon_start 1 locus_tag LOCUS_66780 CDS complement(20673..21410) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 transl_table 11 codon_start 1 locus_tag LOCUS_66790 CDS complement(21570..21881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66800 CDS complement(21957..22349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66810 CDS complement(22466..23203) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 transl_table 11 codon_start 1 locus_tag LOCUS_66820 CDS 23919..24605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66830 CDS complement(24693..24977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66840 CDS complement(25370..25819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66850 note possible pseudo, frameshifted CDS complement(26422..26856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031559.1 transl_table 11 codon_start 1 locus_tag LOCUS_66860 CDS complement(26847..27425) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031560.1 transl_table 11 codon_start 1 locus_tag LOCUS_66870 CDS complement(28127..28702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66880 CDS complement(28763..29179) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_66890 CDS complement(29179..29712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66900 CDS complement(29724..30134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66910 CDS 30500..30640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66920 CDS complement(30739..31281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66930 CDS 32668..32850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66940 CDS complement(33040..33456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66950 CDS 34187..34882 product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_66960 gene raaS CDS 34987..35901 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 transl_table 11 codon_start 1 locus_tag LOCUS_66970 CDS 35901..37559 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_66980 CDS complement(37702..38370) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_66990 CDS complement(38363..39526) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_67000 CDS 39429..40427 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225653.1 transl_table 11 codon_start 1 locus_tag LOCUS_67010 CDS 40794..42857 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 transl_table 11 codon_start 1 locus_tag LOCUS_67020 tRNA 41129..41205 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 42932..44272 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975284.1 transl_table 11 codon_start 1 locus_tag LOCUS_67030 CDS 44269..44964 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222065.1 transl_table 11 codon_start 1 locus_tag LOCUS_67040 CDS 45011..45301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67050 CDS complement(45334..46128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67060 CDS 46355..47680 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 transl_table 11 codon_start 1 locus_tag LOCUS_67070 gene nhaA CDS 48002..49291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67080 sequence066 source 1..476196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67090 CDS 715..1527 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 transl_table 11 codon_start 1 locus_tag LOCUS_67100 CDS complement(1520..2110) product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462751.1 transl_table 11 codon_start 1 locus_tag LOCUS_67110 CDS 2219..2749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67120 CDS complement(2785..3912) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777054.1 transl_table 11 codon_start 1 locus_tag LOCUS_67130 CDS 3991..4806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67140 CDS complement(4867..5583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67150 CDS complement(5595..6734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67160 CDS complement(6817..8208) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 transl_table 11 codon_start 1 locus_tag LOCUS_67170 CDS complement(8205..8489) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_67180 CDS complement(8486..9691) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 transl_table 11 codon_start 1 locus_tag LOCUS_67190 CDS 9782..10498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67200 CDS 10569..12134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67210 CDS complement(12152..13669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67220 CDS complement(13711..15087) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 transl_table 11 codon_start 1 locus_tag LOCUS_67230 CDS complement(15128..16009) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970280.1 transl_table 11 codon_start 1 locus_tag LOCUS_67240 CDS complement(16035..17648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 transl_table 11 codon_start 1 locus_tag LOCUS_67250 CDS complement(18045..18554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67260 CDS complement(18934..19728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67270 CDS 19759..20466 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 transl_table 11 codon_start 1 locus_tag LOCUS_67280 CDS 20463..21503 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630214.1 transl_table 11 codon_start 1 locus_tag LOCUS_67290 CDS 21702..22259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67300 CDS 22332..23222 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973952.1 transl_table 11 codon_start 1 locus_tag LOCUS_67310 CDS 23259..23615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67320 CDS complement(23606..25840) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_67330 CDS 25947..26168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67340 CDS 26755..26979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67350 CDS 27415..27636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67360 CDS 27679..29679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67370 CDS 29767..30300 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_67380 CDS 30300..30986 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227870.1 transl_table 11 codon_start 1 locus_tag LOCUS_67390 CDS complement(30970..31695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67400 CDS 31726..32943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67410 CDS complement(32995..33777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67420 CDS complement(33792..34553) product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_67430 gene lieB CDS complement(34550..35293) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 transl_table 11 codon_start 1 locus_tag LOCUS_67440 CDS complement(35398..36060) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729781.1 transl_table 11 codon_start 1 locus_tag LOCUS_67450 CDS complement(36057..37925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67460 CDS 38014..38457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67470 CDS 38485..39069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67480 CDS complement(39077..39244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67490 CDS complement(39257..40156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67500 CDS complement(40811..42847) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 transl_table 11 codon_start 1 locus_tag LOCUS_67510 CDS 42846..43358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67520 CDS complement(43355..43546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67530 CDS 43716..44549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67540 CDS 44631..46184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67550 CDS 46208..46816 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731025.1 transl_table 11 codon_start 1 locus_tag LOCUS_67560 CDS 47043..47999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67570 CDS complement(47881..48303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67580 CDS 48389..50167 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 transl_table 11 codon_start 1 locus_tag LOCUS_67590 CDS complement(50315..50941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67600 CDS complement(51099..51440) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 transl_table 11 codon_start 1 locus_tag LOCUS_67610 CDS complement(51437..51733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67620 CDS complement(51972..53420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67630 CDS 53489..54751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67640 CDS 55039..55239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67650 CDS complement(55373..55636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67660 CDS complement(55711..57819) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 transl_table 11 codon_start 1 locus_tag LOCUS_67670 gene glgX CDS 57906..58529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67680 CDS 58526..59719 product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895344.1 transl_table 11 codon_start 1 locus_tag LOCUS_67690 CDS 59724..60224 product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 transl_table 11 codon_start 1 locus_tag LOCUS_67700 CDS complement(60318..61349) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_67710 CDS complement(61560..62651) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229693.1 transl_table 11 codon_start 1 locus_tag LOCUS_67720 CDS complement(62648..63247) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837539.1 transl_table 11 codon_start 1 locus_tag LOCUS_67730 CDS 63340..64125 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 transl_table 11 codon_start 1 locus_tag LOCUS_67740 CDS complement(64244..64750) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 transl_table 11 codon_start 1 locus_tag LOCUS_67750 CDS 64926..65408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67760 CDS complement(65418..66680) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 transl_table 11 codon_start 1 locus_tag LOCUS_67770 CDS 66772..67887 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225745.1 transl_table 11 codon_start 1 locus_tag LOCUS_67780 CDS complement(67897..68157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67790 CDS 68120..69133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67800 CDS complement(69165..69434) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 transl_table 11 codon_start 1 locus_tag LOCUS_67810 gene fliQ CDS complement(69505..70113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67820 CDS complement(70127..70738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67830 CDS 70962..71384 product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 transl_table 11 codon_start 1 locus_tag LOCUS_67840 CDS 71488..72663 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527955.1 transl_table 11 codon_start 1 locus_tag LOCUS_67850 CDS 73883..74170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67860 note possible pseudo, frameshifted CDS complement(74738..75451) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 transl_table 11 codon_start 1 locus_tag LOCUS_67870 CDS complement(75448..78438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67880 CDS complement(78516..79550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67890 CDS 79607..81019 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 transl_table 11 codon_start 1 locus_tag LOCUS_67900 CDS complement(80960..81547) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728323.1 transl_table 11 codon_start 1 locus_tag LOCUS_67910 CDS 81601..82074 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877376.1 transl_table 11 codon_start 1 locus_tag LOCUS_67920 CDS complement(82083..82661) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 transl_table 11 codon_start 1 locus_tag LOCUS_67930 CDS complement(82728..83621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67940 CDS complement(83666..84577) product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 transl_table 11 codon_start 1 locus_tag LOCUS_67950 CDS 84652..85785 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 transl_table 11 codon_start 1 locus_tag LOCUS_67960 CDS 85882..86097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67970 CDS 86126..86584 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 transl_table 11 codon_start 1 locus_tag LOCUS_67980 CDS 86662..87420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67990 CDS complement(87425..88147) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 transl_table 11 codon_start 1 locus_tag LOCUS_68000 CDS complement(88144..88839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68010 CDS 89214..89411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68020 CDS 89488..89679 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 transl_table 11 codon_start 1 locus_tag LOCUS_68030 CDS complement(89722..91077) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 transl_table 11 codon_start 1 locus_tag LOCUS_68040 CDS 91213..92229 product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 transl_table 11 codon_start 1 locus_tag LOCUS_68050 gene kdd CDS 92235..93764 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 transl_table 11 codon_start 1 locus_tag LOCUS_68060 CDS 93774..95330 product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 transl_table 11 codon_start 1 locus_tag LOCUS_68070 CDS 95327..96061 product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 transl_table 11 codon_start 1 locus_tag LOCUS_68080 CDS 96058..96423 product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 transl_table 11 codon_start 1 locus_tag LOCUS_68090 CDS 96420..97670 product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 transl_table 11 codon_start 1 locus_tag LOCUS_68100 gene glmL CDS 98213..99847 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 transl_table 11 codon_start 1 locus_tag LOCUS_68110 gene lnt CDS 99844..100629 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_68120 CDS 100679..101209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68130 CDS complement(101276..101614) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 transl_table 11 codon_start 1 locus_tag LOCUS_68140 CDS complement(101978..102913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68150 CDS complement(103113..104255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68160 CDS complement(104426..105007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68170 CDS complement(105009..106103) product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 transl_table 11 codon_start 1 locus_tag LOCUS_68180 CDS 106127..106588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68190 CDS complement(106649..107179) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 transl_table 11 codon_start 1 locus_tag LOCUS_68200 CDS complement(107176..107679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68210 CDS complement(107928..108131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68220 CDS 108394..109590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68230 CDS 109747..110055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68240 CDS 110024..110293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68250 CDS 110462..111115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68260 CDS complement(111099..112889) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 transl_table 11 codon_start 1 locus_tag LOCUS_68270 CDS complement(112890..114401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68280 CDS complement(114415..115239) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 transl_table 11 codon_start 1 locus_tag LOCUS_68290 CDS complement(115232..116158) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 transl_table 11 codon_start 1 locus_tag LOCUS_68300 CDS complement(116155..117399) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_68310 CDS complement(117396..118424) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_68320 CDS 118582..118728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68330 CDS 118838..119905 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971615.1 transl_table 11 codon_start 1 locus_tag LOCUS_68340 CDS 119993..120868 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806998.1 transl_table 11 codon_start 1 locus_tag LOCUS_68350 gene dapA CDS complement(120995..121537) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 transl_table 11 codon_start 1 locus_tag LOCUS_68360 CDS complement(121591..122376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68370 CDS complement(122373..123035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68380 CDS 123097..123576 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 transl_table 11 codon_start 1 locus_tag LOCUS_68390 CDS complement(124844..125752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68400 CDS complement(125814..126737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68410 CDS complement(127352..127750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68420 CDS 127667..128401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68430 note possible pseudo, frameshifted CDS complement(128471..128866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68440 CDS 129202..130554 product ISL3-like element IS469 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029007.1 transl_table 11 codon_start 1 locus_tag LOCUS_68450 CDS complement(130570..130935) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 transl_table 11 codon_start 1 locus_tag LOCUS_68460 CDS complement(131190..131369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68470 CDS complement(131442..132944) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_68480 CDS 133076..139168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68490 CDS 139180..139878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68500 CDS complement(140042..140833) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 transl_table 11 codon_start 1 locus_tag LOCUS_68510 CDS 140738..141136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68520 CDS 141136..142044 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 transl_table 11 codon_start 1 locus_tag LOCUS_68530 CDS 142084..142632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68540 CDS 142641..143177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68550 CDS 143255..143608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68560 CDS 143835..144575 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 transl_table 11 codon_start 1 locus_tag LOCUS_68570 CDS 144864..145214 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223907.1 transl_table 11 codon_start 1 locus_tag LOCUS_68580 CDS 145226..146476 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 transl_table 11 codon_start 1 locus_tag LOCUS_68590 CDS 146548..147048 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226547.1 transl_table 11 codon_start 1 locus_tag LOCUS_68600 CDS 147062..147469 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 transl_table 11 codon_start 1 locus_tag LOCUS_68610 CDS 147473..148609 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 transl_table 11 codon_start 1 locus_tag LOCUS_68620 CDS complement(149151..149588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68630 CDS 149676..150296 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 transl_table 11 codon_start 1 locus_tag LOCUS_68640 CDS complement(150505..151293) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726808.1 transl_table 11 codon_start 1 locus_tag LOCUS_68650 CDS complement(151336..151695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877697.1 transl_table 11 codon_start 1 locus_tag LOCUS_68660 CDS 151774..152568 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 transl_table 11 codon_start 1 locus_tag LOCUS_68670 CDS complement(152656..153159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68680 CDS 153492..153944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68690 CDS 154034..156043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68700 CDS 156062..156511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68710 note possible pseudo, internal stop codon, frameshifted CDS complement(156523..157473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68720 CDS complement(157448..158824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68730 CDS complement(158821..161757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68740 CDS complement(161759..164032) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 transl_table 11 codon_start 1 locus_tag LOCUS_68750 CDS complement(164372..164875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68760 CDS complement(164887..165207) product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909510.1 transl_table 11 codon_start 1 locus_tag LOCUS_68770 CDS complement(165204..165758) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 transl_table 11 codon_start 1 locus_tag LOCUS_68780 CDS 165849..167627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68790 CDS 167617..168054 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 transl_table 11 codon_start 1 locus_tag LOCUS_68800 CDS complement(167991..170135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68810 CDS complement(170169..170693) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 transl_table 11 codon_start 1 locus_tag LOCUS_68820 CDS 170803..171747 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 transl_table 11 codon_start 1 locus_tag LOCUS_68830 CDS 171744..172535 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223407.1 transl_table 11 codon_start 1 locus_tag LOCUS_68840 CDS 172553..173644 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 transl_table 11 codon_start 1 locus_tag LOCUS_68850 CDS 173641..174252 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_68860 CDS 174356..175174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68870 CDS complement(175304..176215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68880 CDS 176294..176704 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 transl_table 11 codon_start 1 locus_tag LOCUS_68890 CDS 176724..178892 product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 transl_table 11 codon_start 1 locus_tag LOCUS_68900 CDS 178892..181069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68910 CDS 181066..182676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68920 CDS 182669..184666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68930 CDS 184663..185991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68940 CDS 185988..187685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68950 CDS complement(187702..188610) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 transl_table 11 codon_start 1 locus_tag LOCUS_68960 CDS 188700..188909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68970 CDS 189268..190224 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 transl_table 11 codon_start 1 locus_tag LOCUS_68980 CDS complement(190221..190643) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 transl_table 11 codon_start 1 locus_tag LOCUS_68990 tRNA 190993..191082 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 191125..191667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69000 CDS complement(191664..192437) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 transl_table 11 codon_start 1 locus_tag LOCUS_69010 CDS 192568..193029 product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 transl_table 11 codon_start 1 locus_tag LOCUS_69020 CDS 193055..194029 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 transl_table 11 codon_start 1 locus_tag LOCUS_69030 CDS complement(194018..194968) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 transl_table 11 codon_start 1 locus_tag LOCUS_69040 CDS 195014..195766 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 transl_table 11 codon_start 1 locus_tag LOCUS_69050 gene pcaD CDS 195772..195963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69060 CDS 195966..196460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69070 CDS complement(196535..198136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69080 CDS complement(198143..198814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69090 CDS complement(198814..199899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69100 note possible pseudo, frameshifted CDS complement(199892..200080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69110 CDS complement(200071..201495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69120 CDS complement(201492..201992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69130 CDS complement(201985..203952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69140 CDS complement(203949..204395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69150 CDS complement(204412..206253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69160 CDS complement(206272..207099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69170 CDS complement(207096..207695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69180 CDS 207819..209015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69190 CDS 209111..210760 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 transl_table 11 codon_start 1 locus_tag LOCUS_69200 CDS 210774..214676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69210 CDS 214667..215578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69220 CDS 215735..215968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69230 CDS complement(216092..216472) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 transl_table 11 codon_start 1 locus_tag LOCUS_69240 CDS 216542..217258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69250 CDS 217351..217665 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095268.1 transl_table 11 codon_start 1 locus_tag LOCUS_69260 gene sugE CDS 217754..218470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69270 CDS complement(218471..219253) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 transl_table 11 codon_start 1 locus_tag LOCUS_69280 CDS complement(219279..219938) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 transl_table 11 codon_start 1 locus_tag LOCUS_69290 CDS complement(219938..220267) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 transl_table 11 codon_start 1 locus_tag LOCUS_69300 CDS complement(220313..221164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69310 CDS complement(221215..221457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69320 tRNA 221764..221849 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(222325..222888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69330 CDS complement(222885..225215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69340 CDS 225153..225548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69350 CDS 225558..227054 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 transl_table 11 codon_start 1 locus_tag LOCUS_69360 CDS 227051..228850 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 transl_table 11 codon_start 1 locus_tag LOCUS_69370 CDS 228847..229338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69380 CDS 229416..230795 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 transl_table 11 codon_start 1 locus_tag LOCUS_69390 CDS 230795..231151 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 transl_table 11 codon_start 1 locus_tag LOCUS_69400 CDS 231229..231873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69410 CDS complement(231864..232418) product chloramphenicol phosphotransferase CPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969619.1 transl_table 11 codon_start 1 locus_tag LOCUS_69420 CDS complement(232415..232924) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 transl_table 11 codon_start 1 locus_tag LOCUS_69430 CDS complement(232934..233884) product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477940.1 transl_table 11 codon_start 1 locus_tag LOCUS_69440 CDS complement(233881..234717) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 transl_table 11 codon_start 1 locus_tag LOCUS_69450 CDS complement(234773..235702) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 transl_table 11 codon_start 1 locus_tag LOCUS_69460 gene xerC CDS complement(235715..237298) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722120.1 transl_table 11 codon_start 1 locus_tag LOCUS_69470 CDS 237282..237533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69480 CDS 238141..239676 product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 transl_table 11 codon_start 1 locus_tag LOCUS_69490 CDS 239673..241154 product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 transl_table 11 codon_start 1 locus_tag LOCUS_69500 CDS 241141..242256 product staphyloferrin B biosynthesis decarboxylase SbnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 transl_table 11 codon_start 1 locus_tag LOCUS_69510 gene sbnH CDS complement(242268..243089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69520 CDS complement(243083..243448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69530 CDS complement(243472..243720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69540 CDS 244501..248373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69550 CDS complement(248567..248959) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 transl_table 11 codon_start 1 locus_tag LOCUS_69560 CDS complement(248984..249331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69570 CDS complement(249422..249922) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115099.1 transl_table 11 codon_start 1 locus_tag LOCUS_69580 gene def CDS complement(249951..250442) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973981.1 transl_table 11 codon_start 1 locus_tag LOCUS_69590 CDS complement(250439..251305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69600 CDS complement(251579..252163) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_69610 CDS complement(252176..253270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69620 CDS 253500..253700 product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 transl_table 11 codon_start 1 locus_tag LOCUS_69630 CDS complement(253776..256580) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 transl_table 11 codon_start 1 locus_tag LOCUS_69640 gene gcvP CDS 256801..257796 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_69650 gene mgrA CDS 257812..258513 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027961.1 transl_table 11 codon_start 1 locus_tag LOCUS_69660 CDS 258510..259289 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977059.1 transl_table 11 codon_start 1 locus_tag LOCUS_69670 CDS 259314..259676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69680 CDS 260123..260386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69690 CDS complement(260493..261197) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227762.1 transl_table 11 codon_start 1 locus_tag LOCUS_69700 CDS 261285..261656 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227761.1 transl_table 11 codon_start 1 locus_tag LOCUS_69710 CDS 261799..262452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69720 CDS 262463..264955 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 transl_table 11 codon_start 1 locus_tag LOCUS_69730 CDS 264952..266538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69740 CDS 266535..267203 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 transl_table 11 codon_start 1 locus_tag LOCUS_69750 CDS complement(267166..269877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226575.1 transl_table 11 codon_start 1 locus_tag LOCUS_69760 CDS 269876..270547 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 transl_table 11 codon_start 1 locus_tag LOCUS_69770 CDS 270687..271577 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 transl_table 11 codon_start 1 locus_tag LOCUS_69780 CDS 271597..272514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69790 CDS complement(272502..276362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69800 CDS 276498..278864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69810 CDS complement(278872..281121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69820 CDS complement(281126..281296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69830 CDS complement(281390..282151) product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222871.1 transl_table 11 codon_start 1 locus_tag LOCUS_69840 CDS complement(282201..282830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69850 CDS complement(282868..283422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69860 CDS complement(283581..284045) product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 transl_table 11 codon_start 1 locus_tag LOCUS_69870 CDS complement(284153..284830) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_69880 CDS complement(284902..285351) product glycogen accumulation regulator GarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899041.1 transl_table 11 codon_start 1 locus_tag LOCUS_69890 gene garA CDS complement(285604..285984) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 transl_table 11 codon_start 1 locus_tag LOCUS_69900 gene gcvH CDS complement(286025..286963) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 transl_table 11 codon_start 1 locus_tag LOCUS_69910 CDS complement(286976..287308) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 transl_table 11 codon_start 1 locus_tag LOCUS_69920 CDS complement(287305..288207) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 transl_table 11 codon_start 1 locus_tag LOCUS_69930 CDS complement(288207..288812) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 transl_table 11 codon_start 1 locus_tag LOCUS_69940 CDS 289118..290035 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 transl_table 11 codon_start 1 locus_tag LOCUS_69950 CDS complement(290026..290979) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 transl_table 11 codon_start 1 locus_tag LOCUS_69960 CDS complement(291004..292956) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 transl_table 11 codon_start 1 locus_tag LOCUS_69970 CDS complement(293036..294454) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 transl_table 11 codon_start 1 locus_tag LOCUS_69980 CDS 294439..295098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69990 CDS 295169..295990 product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 transl_table 11 codon_start 1 locus_tag LOCUS_70000 CDS 296003..297637 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 transl_table 11 codon_start 1 locus_tag LOCUS_70010 CDS complement(297627..298256) product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 transl_table 11 codon_start 1 locus_tag LOCUS_70020 CDS 298337..299632 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 transl_table 11 codon_start 1 locus_tag LOCUS_70030 CDS 299642..300109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70040 CDS complement(300189..300596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70050 CDS 300689..302905 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 transl_table 11 codon_start 1 locus_tag LOCUS_70060 tRNA 301785..301881 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(302912..303724) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 transl_table 11 codon_start 1 locus_tag LOCUS_70070 CDS 303749..303964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70080 CDS 303986..304429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70090 CDS complement(304416..305303) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224202.1 transl_table 11 codon_start 1 locus_tag LOCUS_70100 CDS 305557..306570 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225952.1 transl_table 11 codon_start 1 locus_tag LOCUS_70110 CDS complement(306564..306980) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224742.1 transl_table 11 codon_start 1 locus_tag LOCUS_70120 CDS 307012..307710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70130 CDS 307729..308166 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876692.1 transl_table 11 codon_start 1 locus_tag LOCUS_70140 CDS 308299..309342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70150 CDS complement(309344..311242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70160 CDS complement(311328..313751) product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230375.1 transl_table 11 codon_start 1 locus_tag LOCUS_70170 CDS complement(313748..314194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222254.1 transl_table 11 codon_start 1 locus_tag LOCUS_70180 CDS complement(314194..314682) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837759.1 transl_table 11 codon_start 1 locus_tag LOCUS_70190 CDS complement(314747..315772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70200 CDS complement(315900..316499) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228711.1 transl_table 11 codon_start 1 locus_tag LOCUS_70210 CDS 316561..317724 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 transl_table 11 codon_start 1 locus_tag LOCUS_70220 CDS 317714..318919 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 transl_table 11 codon_start 1 locus_tag LOCUS_70230 CDS 318919..320955 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 transl_table 11 codon_start 1 locus_tag LOCUS_70240 CDS 320952..322013 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 transl_table 11 codon_start 1 locus_tag LOCUS_70250 CDS 322052..323098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70260 CDS 323266..324639 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_70270 CDS 324704..324862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70280 CDS complement(324852..325661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70290 CDS complement(325694..326185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70300 CDS 326284..328680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70310 CDS 328899..330017 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 transl_table 11 codon_start 1 locus_tag LOCUS_70320 CDS 330010..330909 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 transl_table 11 codon_start 1 locus_tag LOCUS_70330 CDS 330897..331742 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 transl_table 11 codon_start 1 locus_tag LOCUS_70340 CDS 331739..332758 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 transl_table 11 codon_start 1 locus_tag LOCUS_70350 CDS 332825..333616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70360 CDS 333736..335037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70370 CDS complement(335067..335639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70380 CDS complement(335667..336305) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 transl_table 11 codon_start 1 locus_tag LOCUS_70390 CDS 336364..336747 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222198.1 transl_table 11 codon_start 1 locus_tag LOCUS_70400 CDS 336760..337527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70410 CDS complement(337550..337939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70420 CDS 338145..338927 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031462.1 transl_table 11 codon_start 1 locus_tag LOCUS_70430 CDS 339696..341207 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 transl_table 11 codon_start 1 locus_tag LOCUS_70440 CDS 341242..341838 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 transl_table 11 codon_start 1 locus_tag LOCUS_70450 CDS 341835..342767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70460 CDS 342764..343603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70470 CDS complement(343690..344775) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 transl_table 11 codon_start 1 locus_tag LOCUS_70480 CDS 344862..346379 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_70490 CDS 346376..347656 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 transl_table 11 codon_start 1 locus_tag LOCUS_70500 CDS 347656..347793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70510 CDS 347790..349055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70520 CDS 349052..350176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70530 CDS 350173..351522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70540 CDS complement(351476..352489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70550 CDS complement(352492..353607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70560 CDS complement(353607..354350) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 transl_table 11 codon_start 1 locus_tag LOCUS_70570 CDS complement(354431..355099) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 transl_table 11 codon_start 1 locus_tag LOCUS_70580 CDS complement(355173..355745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70590 CDS complement(356032..358221) product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 transl_table 11 codon_start 1 locus_tag LOCUS_70600 CDS 358446..359930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70610 CDS 359976..362381 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 transl_table 11 codon_start 1 locus_tag LOCUS_70620 CDS 362424..363590 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 transl_table 11 codon_start 1 locus_tag LOCUS_70630 CDS complement(363633..364172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70640 CDS complement(365191..365802) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 transl_table 11 codon_start 1 locus_tag LOCUS_70650 CDS complement(365825..367414) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 transl_table 11 codon_start 1 locus_tag LOCUS_70660 CDS 367621..369879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70670 CDS 369891..370430 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 transl_table 11 codon_start 1 locus_tag LOCUS_70680 CDS complement(370427..371707) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 transl_table 11 codon_start 1 locus_tag LOCUS_70690 CDS 371780..373102 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 transl_table 11 codon_start 1 locus_tag LOCUS_70700 CDS 373107..374057 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029696.1 transl_table 11 codon_start 1 locus_tag LOCUS_70710 CDS 374093..375304 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 transl_table 11 codon_start 1 locus_tag LOCUS_70720 CDS 375322..375531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70730 CDS complement(375626..375922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70740 CDS 375921..376904 product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 transl_table 11 codon_start 1 locus_tag LOCUS_70750 CDS complement(376910..378238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70760 CDS 378518..379750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70770 CDS 379781..380725 product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 transl_table 11 codon_start 1 locus_tag LOCUS_70780 CDS complement(380722..381213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70790 CDS 381288..381707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70800 CDS 381915..382940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70810 CDS 383145..383603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70820 CDS complement(383611..384549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70830 CDS complement(384733..385362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70840 CDS 385876..386277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70850 CDS complement(386317..387393) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 transl_table 11 codon_start 1 locus_tag LOCUS_70860 CDS 387492..388157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70870 CDS 388154..388783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70880 CDS 388780..389886 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 transl_table 11 codon_start 1 locus_tag LOCUS_70890 gene menC CDS 389987..391141 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 transl_table 11 codon_start 1 locus_tag LOCUS_70900 CDS complement(391218..392228) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742196.1 transl_table 11 codon_start 1 locus_tag LOCUS_70910 CDS complement(392291..393280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70920 CDS 393465..394382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70930 CDS complement(394389..394757) product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055699632.1 transl_table 11 codon_start 1 locus_tag LOCUS_70940 CDS 394857..395405 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 transl_table 11 codon_start 1 locus_tag LOCUS_70950 CDS 395380..396036 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225031.1 transl_table 11 codon_start 1 locus_tag LOCUS_70960 CDS 396033..398045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70970 CDS complement(398036..399673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70980 CDS complement(399670..400488) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226652.1 transl_table 11 codon_start 1 locus_tag LOCUS_70990 CDS complement(400525..401547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71000 CDS complement(401559..402761) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 transl_table 11 codon_start 1 locus_tag LOCUS_71010 gene lhgO CDS complement(402773..404674) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 transl_table 11 codon_start 1 locus_tag LOCUS_71020 CDS 404900..405289 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 transl_table 11 codon_start 1 locus_tag LOCUS_71030 CDS complement(405299..406225) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 transl_table 11 codon_start 1 locus_tag LOCUS_71040 CDS complement(406282..406920) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 transl_table 11 codon_start 1 locus_tag LOCUS_71050 CDS complement(407018..407722) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 transl_table 11 codon_start 1 locus_tag LOCUS_71060 CDS complement(407719..408435) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 transl_table 11 codon_start 1 locus_tag LOCUS_71070 CDS 408556..409224 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 transl_table 11 codon_start 1 locus_tag LOCUS_71080 CDS 409221..409991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71090 CDS 410025..410456 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243975.1 transl_table 11 codon_start 1 locus_tag LOCUS_71100 CDS 410578..412203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71110 CDS 412124..412843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71120 CDS complement(412883..413275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71130 CDS complement(413371..413667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71140 CDS complement(413868..414026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71150 CDS complement(414121..415533) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 transl_table 11 codon_start 1 locus_tag LOCUS_71160 CDS complement(415607..415837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71170 CDS 415830..416705 product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 transl_table 11 codon_start 1 locus_tag LOCUS_71180 CDS complement(416758..417360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71190 CDS 417535..418155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71200 CDS 418244..420724 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_71210 CDS 420721..421077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71220 CDS complement(421034..422260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71230 CDS 422398..423174 product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 transl_table 11 codon_start 1 locus_tag LOCUS_71240 CDS 423261..423464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71250 CDS 423565..424467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71260 CDS complement(424726..428742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71270 CDS complement(429158..429985) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_71280 CDS 429972..430577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71290 CDS 430753..431502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224437.1 transl_table 11 codon_start 1 locus_tag LOCUS_71300 CDS complement(431546..433096) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 transl_table 11 codon_start 1 locus_tag LOCUS_71310 CDS complement(433245..433700) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_71320 CDS complement(433697..434590) product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 transl_table 11 codon_start 1 locus_tag LOCUS_71330 gene couO CDS complement(434635..435594) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 transl_table 11 codon_start 1 locus_tag LOCUS_71340 CDS complement(435557..436765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71350 CDS complement(436762..437595) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930731.1 transl_table 11 codon_start 1 locus_tag LOCUS_71360 CDS complement(437592..438245) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 transl_table 11 codon_start 1 locus_tag LOCUS_71370 CDS complement(438242..439012) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 transl_table 11 codon_start 1 locus_tag LOCUS_71380 CDS complement(439012..440193) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 transl_table 11 codon_start 1 locus_tag LOCUS_71390 CDS 440282..441067 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 transl_table 11 codon_start 1 locus_tag LOCUS_71400 CDS complement(441057..442268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71410 CDS complement(442320..443006) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 transl_table 11 codon_start 1 locus_tag LOCUS_71420 CDS complement(443014..443874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71430 CDS complement(443939..444889) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_71440 CDS complement(444886..445848) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 transl_table 11 codon_start 1 locus_tag LOCUS_71450 CDS complement(445845..446855) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 transl_table 11 codon_start 1 locus_tag LOCUS_71460 CDS complement(447457..448920) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 transl_table 11 codon_start 1 locus_tag LOCUS_71470 CDS 448919..449401 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972016.1 transl_table 11 codon_start 1 locus_tag LOCUS_71480 CDS complement(449377..450270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71490 CDS complement(450371..451090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71500 CDS complement(451313..452308) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 transl_table 11 codon_start 1 locus_tag LOCUS_71510 CDS complement(452359..452970) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338162.1 transl_table 11 codon_start 1 locus_tag LOCUS_71520 CDS 453087..454469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71530 CDS 454469..455119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71540 CDS 455161..456726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71550 CDS 456738..459164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71560 CDS complement(459354..459548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71570 CDS complement(459686..460639) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 transl_table 11 codon_start 1 locus_tag LOCUS_71580 CDS complement(460812..461873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71590 CDS complement(461870..462676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71600 CDS complement(462673..463233) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226925.1 transl_table 11 codon_start 1 locus_tag LOCUS_71610 CDS complement(463256..465802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71620 note possible pseudo, internal stop codon CDS complement(465840..466769) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 transl_table 11 codon_start 1 locus_tag LOCUS_71630 CDS complement(466979..468187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71640 CDS 468443..469660 product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 transl_table 11 codon_start 1 locus_tag LOCUS_71650 gene egtA CDS 469657..470958 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 transl_table 11 codon_start 1 locus_tag LOCUS_71660 gene egtB CDS 470958..471701 product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 transl_table 11 codon_start 1 locus_tag LOCUS_71670 gene egtC CDS 471698..472666 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 transl_table 11 codon_start 1 locus_tag LOCUS_71680 gene egtD CDS 472895..473491 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229206.1 transl_table 11 codon_start 1 locus_tag LOCUS_71690 CDS 473588..474796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71700 CDS 474866..475357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71710 sequence067 source 1..49153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71720 CDS 429..3170 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_71730 CDS complement(3279..7655) product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227339.1 transl_table 11 codon_start 1 locus_tag LOCUS_71740 CDS 7549..7764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71750 CDS 7793..8101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71760 CDS 8248..11031 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_71770 CDS 11089..11619 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_71780 CDS complement(11597..12877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133404327.1 transl_table 11 codon_start 1 locus_tag LOCUS_71790 CDS 12988..13281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71800 CDS 13348..17754 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 transl_table 11 codon_start 1 locus_tag LOCUS_71810 CDS complement(17806..18396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029717.1 transl_table 11 codon_start 1 locus_tag LOCUS_71820 CDS complement(18402..18692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71830 CDS 18798..19454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71840 CDS complement(19502..20170) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 transl_table 11 codon_start 1 locus_tag LOCUS_71850 CDS complement(20231..20866) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 transl_table 11 codon_start 1 locus_tag LOCUS_71860 CDS complement(20839..22104) product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 transl_table 11 codon_start 1 locus_tag LOCUS_71870 CDS 22203..23222 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 transl_table 11 codon_start 1 locus_tag LOCUS_71880 CDS 23350..24462 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 transl_table 11 codon_start 1 locus_tag LOCUS_71890 CDS 24480..25517 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031339.1 transl_table 11 codon_start 1 locus_tag LOCUS_71900 CDS 25528..26943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71910 CDS 27207..27932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71920 CDS complement(27907..29847) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 transl_table 11 codon_start 1 locus_tag LOCUS_71930 CDS complement(29986..30666) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101572.1 transl_table 11 codon_start 1 locus_tag LOCUS_71940 CDS complement(30663..31697) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 transl_table 11 codon_start 1 locus_tag LOCUS_71950 CDS 31772..32236 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 transl_table 11 codon_start 1 locus_tag LOCUS_71960 CDS 32327..33187 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_71970 CDS complement(33148..34284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71980 CDS complement(34286..35770) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020509122.1 transl_table 11 codon_start 1 locus_tag LOCUS_71990 CDS complement(35827..36897) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_72000 gene solA CDS complement(36894..37397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72010 CDS complement(37497..37799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72020 CDS complement(37796..38692) product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 transl_table 11 codon_start 1 locus_tag LOCUS_72030 CDS 38940..40124 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 transl_table 11 codon_start 1 locus_tag LOCUS_72040 CDS 40203..40967 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 transl_table 11 codon_start 1 locus_tag LOCUS_72050 CDS complement(41235..42890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72060 CDS 42987..43187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72070 CDS 43308..43973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72080 CDS 44012..48904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72090 sequence068 source 1..46120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..528 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227298.1:universal stress protein locus_tag LOCUS_72100 CDS 604..1524 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 transl_table 11 codon_start 1 locus_tag LOCUS_72110 CDS 1951..3126 product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 transl_table 11 codon_start 1 locus_tag LOCUS_72120 CDS 3228..6905 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 transl_table 11 codon_start 1 locus_tag LOCUS_72130 CDS 6905..8587 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 transl_table 11 codon_start 1 locus_tag LOCUS_72140 gene narH CDS 8584..9249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72150 CDS 9246..10013 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 transl_table 11 codon_start 1 locus_tag LOCUS_72160 gene narI CDS 10079..10675 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167344383.1 transl_table 11 codon_start 1 locus_tag LOCUS_72170 CDS 10796..10975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72180 CDS complement(11001..13697) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 transl_table 11 codon_start 1 locus_tag LOCUS_72190 CDS complement(13731..14618) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729766.1 transl_table 11 codon_start 1 locus_tag LOCUS_72200 CDS complement(14678..14872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72210 CDS complement(15023..15682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72220 CDS complement(15941..16417) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 transl_table 11 codon_start 1 locus_tag LOCUS_72230 CDS complement(16461..17153) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 transl_table 11 codon_start 1 locus_tag LOCUS_72240 CDS complement(17184..17816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72250 CDS complement(17825..18865) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 transl_table 11 codon_start 1 locus_tag LOCUS_72260 CDS 19019..21676 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 transl_table 11 codon_start 1 locus_tag LOCUS_72270 gene ppdK CDS 21686..22069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72280 CDS complement(22118..22762) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 transl_table 11 codon_start 1 locus_tag LOCUS_72290 CDS 22877..23836 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 transl_table 11 codon_start 1 locus_tag LOCUS_72300 CDS 23931..24941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72310 CDS complement(25244..27649) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 transl_table 11 codon_start 1 locus_tag LOCUS_72320 CDS complement(27884..28501) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227299.1 transl_table 11 codon_start 1 locus_tag LOCUS_72330 CDS complement(28503..29516) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 transl_table 11 codon_start 1 locus_tag LOCUS_72340 gene gap CDS 29732..30208 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 transl_table 11 codon_start 1 locus_tag LOCUS_72350 CDS 30254..31177 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 transl_table 11 codon_start 1 locus_tag LOCUS_72360 CDS 31174..32751 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_72370 CDS 32949..34400 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 transl_table 11 codon_start 1 locus_tag LOCUS_72380 CDS 34479..35372 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 transl_table 11 codon_start 1 locus_tag LOCUS_72390 gene fba1 CDS 35386..35892 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 transl_table 11 codon_start 1 locus_tag LOCUS_72400 CDS complement(35962..36378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72410 CDS complement(36514..36909) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895387.1 transl_table 11 codon_start 1 locus_tag LOCUS_72420 CDS complement(37013..37303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72430 CDS 37550..37831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72440 CDS complement(37855..38193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72450 CDS complement(38199..39149) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730443.1 transl_table 11 codon_start 1 locus_tag LOCUS_72460 CDS complement(39188..40063) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 transl_table 11 codon_start 1 locus_tag LOCUS_72470 CDS 40174..41610 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730410.1 transl_table 11 codon_start 1 locus_tag LOCUS_72480 CDS 41640..43145 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 transl_table 11 codon_start 1 locus_tag LOCUS_72490 CDS complement(43402..44976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72500 CDS complement(45029..45940) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 transl_table 11 codon_start 1 locus_tag LOCUS_72510 sequence069 source 1..45795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72520 CDS complement(957..2282) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229897.1 transl_table 11 codon_start 1 locus_tag LOCUS_72530 CDS 2364..2888 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 transl_table 11 codon_start 1 locus_tag LOCUS_72540 CDS complement(3066..3458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72550 CDS complement(3703..3945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72560 CDS 4116..5231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72570 CDS 5247..6311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72580 CDS 6841..8517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72590 CDS complement(9520..10683) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223381.1 transl_table 11 codon_start 1 locus_tag LOCUS_72600 CDS 11204..12445 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030568499.1 transl_table 11 codon_start 1 locus_tag LOCUS_72610 CDS complement(12449..12928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72620 CDS 13167..13415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72630 CDS complement(13473..13691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72640 CDS 13656..13880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72650 CDS complement(14063..14269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72660 CDS 14397..15293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72670 CDS complement(15311..16681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72680 CDS complement(16801..17022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72690 CDS complement(17019..18044) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 transl_table 11 codon_start 1 locus_tag LOCUS_72700 CDS 18756..19079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72710 CDS 19250..20680 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 transl_table 11 codon_start 1 locus_tag LOCUS_72720 CDS 20684..21703 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 transl_table 11 codon_start 1 locus_tag LOCUS_72730 CDS 21700..22488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72740 CDS 22676..23488 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_72750 CDS 23485..23850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72760 CDS 24108..25316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72770 CDS 25395..25547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72780 CDS 25720..28734 product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 transl_table 11 codon_start 1 locus_tag LOCUS_72790 CDS 28731..29954 product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 transl_table 11 codon_start 1 locus_tag LOCUS_72800 CDS 29970..30785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72810 CDS 30782..31867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031309.1 transl_table 11 codon_start 1 locus_tag LOCUS_72820 CDS 31946..32182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72830 tRNA 32436..32509 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS complement(32600..34063) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183125562.1 transl_table 11 codon_start 1 locus_tag LOCUS_72840 CDS complement(34159..34428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72850 CDS complement(35832..36122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72860 CDS 36045..36938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72870 CDS complement(37291..38046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72880 CDS complement(38626..39138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72890 CDS 39319..40473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72900 CDS 40470..43688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72910 CDS 43688..45721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72920 sequence070 source 1..35132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..5109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72930 CDS complement(5234..5479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72940 CDS complement(5521..5772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72950 CDS complement(6287..6502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72960 CDS complement(6547..7776) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222105.1 transl_table 11 codon_start 1 locus_tag LOCUS_72970 CDS complement(7786..9378) product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 transl_table 11 codon_start 1 locus_tag LOCUS_72980 CDS 9553..11715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72990 CDS 11819..12283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73000 CDS 12810..14501 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226995.1 transl_table 11 codon_start 1 locus_tag LOCUS_73010 CDS 14498..15871 product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_73020 CDS 16309..16713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73030 CDS complement(16700..16981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73040 CDS complement(16999..19314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73050 CDS 19596..21725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73060 note possible pseudo, internal stop codon, frameshifted CDS 21736..22986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73070 CDS 22990..24165 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 transl_table 11 codon_start 1 locus_tag LOCUS_73080 CDS 24176..25111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73090 CDS complement(25112..25678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73100 CDS complement(25709..26905) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 transl_table 11 codon_start 1 locus_tag LOCUS_73110 CDS complement(27251..28018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73120 CDS 28456..30861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73130 CDS complement(30835..31341) product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 transl_table 11 codon_start 1 locus_tag LOCUS_73140 CDS complement(31307..31807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73150 note possible pseudo, frameshifted CDS complement(31804..32481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73160 note possible pseudo, frameshifted CDS complement(32525..32992) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 transl_table 11 codon_start 1 locus_tag LOCUS_73170 CDS 33638..35017 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_73180 gene tnpB sequence071 source 1..33231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..1174 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 transl_table 11 codon_start 1 locus_tag LOCUS_73190 CDS 1195..1941 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_73200 CDS 2012..3472 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 transl_table 11 codon_start 1 locus_tag LOCUS_73210 CDS 3549..4181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73220 CDS complement(4246..4854) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 transl_table 11 codon_start 1 locus_tag LOCUS_73230 CDS 4957..5742 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 transl_table 11 codon_start 1 locus_tag LOCUS_73240 CDS 5772..7154 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_73250 CDS 7446..7871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73260 CDS complement(8156..8527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 transl_table 11 codon_start 1 locus_tag LOCUS_73270 CDS 8822..9160 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 transl_table 11 codon_start 1 locus_tag LOCUS_73280 CDS 9421..9759 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 transl_table 11 codon_start 1 locus_tag LOCUS_73290 CDS 9756..11441 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803883.1 transl_table 11 codon_start 1 locus_tag LOCUS_73300 tRNA complement(11000..11100) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 11512..12225 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 transl_table 11 codon_start 1 locus_tag LOCUS_73310 CDS 12313..12936 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 transl_table 11 codon_start 1 locus_tag LOCUS_73320 CDS 13087..13854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73330 CDS complement(14392..15243) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 transl_table 11 codon_start 1 locus_tag LOCUS_73340 CDS complement(15250..16431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73350 CDS complement(16442..17419) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_73360 CDS complement(17416..18390) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067334.1 transl_table 11 codon_start 1 locus_tag LOCUS_73370 CDS complement(18387..19862) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 transl_table 11 codon_start 1 locus_tag LOCUS_73380 CDS 20179..23715 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 transl_table 11 codon_start 1 locus_tag LOCUS_73390 CDS complement(23767..25194) product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639946.1 transl_table 11 codon_start 1 locus_tag LOCUS_73400 CDS 25696..28524 product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 transl_table 11 codon_start 1 locus_tag LOCUS_73410 CDS 28539..30239 product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 transl_table 11 codon_start 1 locus_tag LOCUS_73420 CDS 30261..33116 product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 transl_table 11 codon_start 1 locus_tag LOCUS_73430 sequence072 source 1..33094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1083 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224879.1 transl_table 11 codon_start 1 locus_tag LOCUS_73440 CDS 1207..1542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73450 CDS 1535..2821 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 transl_table 11 codon_start 1 locus_tag LOCUS_73460 CDS 2811..3554 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 transl_table 11 codon_start 1 locus_tag LOCUS_73470 CDS 3603..4088 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_73480 CDS complement(4106..5575) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 transl_table 11 codon_start 1 locus_tag LOCUS_73490 CDS complement(5575..6207) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 transl_table 11 codon_start 1 locus_tag LOCUS_73500 CDS complement(6342..11009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73510 CDS complement(11041..12141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73520 CDS 12254..12688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73530 CDS 12618..12851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73540 CDS complement(12839..13363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73550 CDS 13809..14174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73560 CDS complement(14927..16180) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 transl_table 11 codon_start 1 locus_tag LOCUS_73570 gene efeB CDS complement(16180..17322) product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 transl_table 11 codon_start 1 locus_tag LOCUS_73580 CDS complement(17363..18205) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229933.1 transl_table 11 codon_start 1 locus_tag LOCUS_73590 CDS 18291..19250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73600 CDS complement(19298..19666) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228278.1 transl_table 11 codon_start 1 locus_tag LOCUS_73610 CDS complement(19805..20023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73620 CDS complement(20185..20475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73630 CDS 20595..21680 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 transl_table 11 codon_start 1 locus_tag LOCUS_73640 CDS 21677..22285 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 transl_table 11 codon_start 1 locus_tag LOCUS_73650 CDS 22365..22943 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 transl_table 11 codon_start 1 locus_tag LOCUS_73660 CDS 22933..23982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73670 CDS 24187..25032 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 transl_table 11 codon_start 1 locus_tag LOCUS_73680 CDS complement(25575..26507) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 transl_table 11 codon_start 1 locus_tag LOCUS_73690 CDS complement(26504..27940) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803737.1 transl_table 11 codon_start 1 locus_tag LOCUS_73700 CDS complement(27960..29105) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030660.1 transl_table 11 codon_start 1 locus_tag LOCUS_73710 CDS 29318..31075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73720 CDS 31145..32104 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 transl_table 11 codon_start 1 locus_tag LOCUS_73730 CDS 32101..32979 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 transl_table 11 codon_start 1 locus_tag LOCUS_73740 sequence073 source 1..33022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..1006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204944093.1 transl_table 11 codon_start 1 locus_tag LOCUS_73750 CDS 1328..9889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73760 CDS 9911..10258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73770 CDS complement(10339..11031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73780 CDS complement(11036..11620) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 transl_table 11 codon_start 1 locus_tag LOCUS_73790 CDS 11936..13333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73800 CDS 13419..14162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73810 CDS complement(14326..14811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73820 CDS complement(15013..15279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73830 CDS complement(15276..15539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73840 note possible pseudo, frameshifted CDS 15701..17095 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 transl_table 11 codon_start 1 locus_tag LOCUS_73850 CDS 17092..17313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73860 CDS complement(17250..17525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73870 CDS complement(17544..18014) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 transl_table 11 codon_start 1 locus_tag LOCUS_73880 CDS complement(18331..19731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73890 CDS 20007..20384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73900 CDS 20949..21398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73910 CDS 21517..22101 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227281.1 transl_table 11 codon_start 1 locus_tag LOCUS_73920 CDS complement(22243..22572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73930 CDS complement(22851..23354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73940 CDS complement(23408..24037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73950 CDS complement(24052..25410) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 transl_table 11 codon_start 1 locus_tag LOCUS_73960 CDS complement(25407..27125) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 transl_table 11 codon_start 1 locus_tag LOCUS_73970 CDS complement(27122..27643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73980 CDS complement(27640..27858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73990 CDS complement(27855..28271) product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 transl_table 11 codon_start 1 locus_tag LOCUS_74000 CDS complement(28268..29695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74010 CDS complement(29682..30515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74020 CDS complement(30515..30964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74030 CDS complement(31374..32648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74040 note possible pseudo, frameshifted sequence074 source 1..32689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(452..1150) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402282.1 transl_table 11 codon_start 1 locus_tag LOCUS_74050 CDS complement(1343..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74060 CDS 1643..2611 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 transl_table 11 codon_start 1 locus_tag LOCUS_74070 CDS complement(2704..3570) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 transl_table 11 codon_start 1 locus_tag LOCUS_74080 CDS complement(3884..4279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74090 CDS 4167..4688 product DUF6069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227728.1 transl_table 11 codon_start 1 locus_tag LOCUS_74100 CDS complement(4783..5346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74110 CDS 6223..6504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74120 CDS complement(6808..8061) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 transl_table 11 codon_start 1 locus_tag LOCUS_74130 CDS complement(8065..8232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74140 CDS 8430..8843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74150 CDS complement(9047..9433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74160 CDS 9567..11084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74170 CDS complement(11091..11450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74180 CDS complement(11453..13351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74190 CDS complement(13365..13883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74200 CDS 14127..16070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74210 CDS complement(16119..17198) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 transl_table 11 codon_start 1 locus_tag LOCUS_74220 CDS complement(17237..17575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74230 CDS 17918..18496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74240 CDS complement(18650..19972) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 transl_table 11 codon_start 1 locus_tag LOCUS_74250 gene nhaA CDS complement(20274..20804) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079420.1 transl_table 11 codon_start 1 locus_tag LOCUS_74260 CDS complement(20845..22125) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 transl_table 11 codon_start 1 locus_tag LOCUS_74270 gene eno CDS complement(22173..22427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74280 CDS complement(22475..25228) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022472.1 transl_table 11 codon_start 1 locus_tag LOCUS_74290 CDS 25560..26417 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729766.1 transl_table 11 codon_start 1 locus_tag LOCUS_74300 CDS complement(26487..27155) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 transl_table 11 codon_start 1 locus_tag LOCUS_74310 CDS 27597..28565 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920994.1 transl_table 11 codon_start 1 locus_tag LOCUS_74320 CDS 28572..29516 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_74330 gene pstC CDS 29513..30424 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 transl_table 11 codon_start 1 locus_tag LOCUS_74340 gene pstA CDS 30432..31307 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 transl_table 11 codon_start 1 locus_tag LOCUS_74350 gene pstB CDS 31309..32070 product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 transl_table 11 codon_start 1 locus_tag LOCUS_74360 gene regX CDS 32139..32504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74370 sequence075 source 1..27545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1194..1382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74380 CDS complement(1412..1891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74390 CDS 2098..2508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74400 CDS complement(2924..3706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74410 CDS complement(4091..4435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74420 CDS 4475..5029 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 transl_table 11 codon_start 1 locus_tag LOCUS_74430 CDS 5214..6803 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 transl_table 11 codon_start 1 locus_tag LOCUS_74440 CDS 6803..7474 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368469.1 transl_table 11 codon_start 1 locus_tag LOCUS_74450 CDS complement(7692..10817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74460 CDS 11164..13710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74470 CDS 13727..14014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74480 CDS 14017..14610 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 transl_table 11 codon_start 1 locus_tag LOCUS_74490 CDS 14646..15461 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 transl_table 11 codon_start 1 locus_tag LOCUS_74500 CDS 15524..15976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74510 CDS complement(15952..17571) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036284.1 transl_table 11 codon_start 1 locus_tag LOCUS_74520 CDS complement(17568..18857) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896959.1 transl_table 11 codon_start 1 locus_tag LOCUS_74530 CDS 19034..19735 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227450.1 transl_table 11 codon_start 1 locus_tag LOCUS_74540 CDS 19728..20915 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223404.1 transl_table 11 codon_start 1 locus_tag LOCUS_74550 CDS 21373..26673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74560 CDS 26693..26854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74570 sequence076 source 1..27500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74580 CDS 690..2354 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 transl_table 11 codon_start 1 locus_tag LOCUS_74590 CDS 2351..5929 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 transl_table 11 codon_start 1 locus_tag LOCUS_74600 gene nifJ CDS 5929..6975 product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 transl_table 11 codon_start 1 locus_tag LOCUS_74610 CDS 6989..7123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74620 CDS 7134..8294 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 transl_table 11 codon_start 1 locus_tag LOCUS_74630 CDS 8291..8770 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 transl_table 11 codon_start 1 locus_tag LOCUS_74640 CDS 8767..9624 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 transl_table 11 codon_start 1 locus_tag LOCUS_74650 CDS 9624..10439 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 transl_table 11 codon_start 1 locus_tag LOCUS_74660 CDS 10436..11734 product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_74670 CDS 11731..12264 product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 transl_table 11 codon_start 1 locus_tag LOCUS_74680 CDS 12535..13971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74690 CDS 14117..15163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74700 CDS complement(15240..17726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74710 CDS complement(17888..18400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74720 CDS complement(18453..18644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74730 CDS complement(19409..19747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74740 CDS complement(19822..22827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74750 CDS complement(22824..25754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74760 CDS 25842..26711 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 transl_table 11 codon_start 1 locus_tag LOCUS_74770 CDS 26922..27314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74780 sequence077 source 1..437558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74790 CDS complement(576..1139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74800 CDS complement(1171..2025) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 transl_table 11 codon_start 1 locus_tag LOCUS_74810 CDS 2070..2372 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 transl_table 11 codon_start 1 locus_tag LOCUS_74820 CDS complement(2380..3090) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 transl_table 11 codon_start 1 locus_tag LOCUS_74830 CDS complement(3113..4057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74840 CDS complement(4054..4662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74850 CDS complement(4705..5349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74860 CDS 5428..5733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74870 CDS 5771..6178 product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225078.1 transl_table 11 codon_start 1 locus_tag LOCUS_74880 CDS complement(6427..6792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74890 CDS 7169..7669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74900 CDS complement(7980..8303) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 transl_table 11 codon_start 1 locus_tag LOCUS_74910 CDS complement(8293..9003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74920 CDS 9163..9999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74930 CDS 9999..10202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74940 CDS 10209..10649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74950 CDS 10664..11536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74960 CDS 11601..11990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74970 CDS 11879..13141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74980 CDS 13138..13818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74990 CDS 13815..14090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75000 CDS 14090..14572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75010 CDS 14578..15591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75020 CDS 15588..17213 product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990145.1 transl_table 11 codon_start 1 locus_tag LOCUS_75030 CDS 17346..17549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75040 CDS 17542..17727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75050 CDS 17727..18929 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 transl_table 11 codon_start 1 locus_tag LOCUS_75060 CDS complement(19011..20438) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074864.1 transl_table 11 codon_start 1 locus_tag LOCUS_75070 gene glnA CDS 20669..21061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75080 CDS complement(21217..21909) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 transl_table 11 codon_start 1 locus_tag LOCUS_75090 CDS 22090..22275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75100 CDS 22272..25286 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 transl_table 11 codon_start 1 locus_tag LOCUS_75110 CDS complement(25639..25860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75120 CDS complement(25895..26896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75130 CDS complement(27070..27966) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 transl_table 11 codon_start 1 locus_tag LOCUS_75140 gene lipA CDS 28365..29630 product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 transl_table 11 codon_start 1 locus_tag LOCUS_75150 gene aspS CDS 29660..30778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75160 CDS complement(30775..30939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75170 CDS complement(30939..31583) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 transl_table 11 codon_start 1 locus_tag LOCUS_75180 gene lipB CDS complement(31597..33474) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 transl_table 11 codon_start 1 locus_tag LOCUS_75190 CDS complement(33475..34383) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 transl_table 11 codon_start 1 locus_tag LOCUS_75200 CDS complement(34468..36294) product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224050.1 transl_table 11 codon_start 1 locus_tag LOCUS_75210 gene sucB CDS complement(36328..37716) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 transl_table 11 codon_start 1 locus_tag LOCUS_75220 gene lpdA CDS 37881..38198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 transl_table 11 codon_start 1 locus_tag LOCUS_75230 CDS complement(38219..39754) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 transl_table 11 codon_start 1 locus_tag LOCUS_75240 CDS 39895..40998 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 transl_table 11 codon_start 1 locus_tag LOCUS_75250 gene gcvT CDS complement(40995..41735) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 transl_table 11 codon_start 1 locus_tag LOCUS_75260 CDS complement(41732..43612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75270 CDS 43690..43887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 transl_table 11 codon_start 1 locus_tag LOCUS_75280 CDS 43899..44717 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 transl_table 11 codon_start 1 locus_tag LOCUS_75290 CDS complement(44854..45852) product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 transl_table 11 codon_start 1 locus_tag LOCUS_75300 CDS complement(45921..50567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75310 CDS complement(50829..51383) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 transl_table 11 codon_start 1 locus_tag LOCUS_75320 CDS 51450..52133 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 transl_table 11 codon_start 1 locus_tag LOCUS_75330 CDS 52133..52441 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227128.1 transl_table 11 codon_start 1 locus_tag LOCUS_75340 CDS complement(52445..53230) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 transl_table 11 codon_start 1 locus_tag LOCUS_75350 CDS 53278..53835 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 transl_table 11 codon_start 1 locus_tag LOCUS_75360 CDS complement(53840..54463) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 transl_table 11 codon_start 1 locus_tag LOCUS_75370 CDS complement(54566..56053) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 transl_table 11 codon_start 1 locus_tag LOCUS_75380 gene murA CDS complement(56174..57385) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 transl_table 11 codon_start 1 locus_tag LOCUS_75390 gene nadA CDS 57354..58565 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 transl_table 11 codon_start 1 locus_tag LOCUS_75400 CDS 58695..59063 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 transl_table 11 codon_start 1 locus_tag LOCUS_75410 CDS 59185..60162 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224071.1 transl_table 11 codon_start 1 locus_tag LOCUS_75420 CDS 60217..60717 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002136.1 transl_table 11 codon_start 1 locus_tag LOCUS_75430 CDS complement(60753..60968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75440 note possible pseudo, frameshifted CDS complement(60968..62113) product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 transl_table 11 codon_start 1 locus_tag LOCUS_75450 note possible pseudo, frameshifted CDS 62304..63242 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 transl_table 11 codon_start 1 locus_tag LOCUS_75460 CDS 63250..63675 product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907986.1 transl_table 11 codon_start 1 locus_tag LOCUS_75470 tRNA complement(63811..63905) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS complement(65015..65221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75480 CDS complement(65343..66401) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 transl_table 11 codon_start 1 locus_tag LOCUS_75490 gene trpD CDS complement(66452..66889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 transl_table 11 codon_start 1 locus_tag LOCUS_75500 CDS complement(66940..67917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75510 CDS complement(67948..68214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75520 CDS 68099..68641 product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411389.1 transl_table 11 codon_start 1 locus_tag LOCUS_75530 CDS 68694..69548 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 transl_table 11 codon_start 1 locus_tag LOCUS_75540 CDS 69545..70651 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093315.1 transl_table 11 codon_start 1 locus_tag LOCUS_75550 CDS 70648..72255 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028848093.1 transl_table 11 codon_start 1 locus_tag LOCUS_75560 CDS 72375..72662 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 transl_table 11 codon_start 1 locus_tag LOCUS_75570 CDS complement(73182..74030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75580 CDS complement(74012..74494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75590 CDS complement(74545..76335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75600 CDS complement(76444..78243) product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 transl_table 11 codon_start 1 locus_tag LOCUS_75610 CDS 78347..79717 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 transl_table 11 codon_start 1 locus_tag LOCUS_75620 CDS 79835..80056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75630 CDS 80133..81389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75640 CDS 81389..82516 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 transl_table 11 codon_start 1 locus_tag LOCUS_75650 CDS 82866..83246 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 transl_table 11 codon_start 1 locus_tag LOCUS_75660 CDS complement(83287..83583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75670 CDS 83720..84175 product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 transl_table 11 codon_start 1 locus_tag LOCUS_75680 CDS complement(84303..84911) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 transl_table 11 codon_start 1 locus_tag LOCUS_75690 CDS complement(84979..86661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75700 CDS 86758..87207 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 transl_table 11 codon_start 1 locus_tag LOCUS_75710 CDS 87222..88163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75720 CDS 88189..89139 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 transl_table 11 codon_start 1 locus_tag LOCUS_75730 CDS 89155..89838 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 transl_table 11 codon_start 1 locus_tag LOCUS_75740 CDS 89864..91207 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 transl_table 11 codon_start 1 locus_tag LOCUS_75750 CDS 91204..91983 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259151.1 transl_table 11 codon_start 1 locus_tag LOCUS_75760 CDS complement(91969..93381) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 transl_table 11 codon_start 1 locus_tag LOCUS_75770 CDS complement(93457..94290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75780 CDS 94430..95161 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080236.1 transl_table 11 codon_start 1 locus_tag LOCUS_75790 CDS complement(95242..95931) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419728.1 transl_table 11 codon_start 1 locus_tag LOCUS_75800 gene crp CDS 96104..97024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75810 CDS 97032..97520 product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 transl_table 11 codon_start 1 locus_tag LOCUS_75820 CDS 97699..98727 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 transl_table 11 codon_start 1 locus_tag LOCUS_75830 CDS 98789..99610 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 transl_table 11 codon_start 1 locus_tag LOCUS_75840 gene proC CDS 99839..100702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 transl_table 11 codon_start 1 locus_tag LOCUS_75850 CDS complement(100665..101639) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 transl_table 11 codon_start 1 locus_tag LOCUS_75860 CDS 101820..102752 product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 transl_table 11 codon_start 1 locus_tag LOCUS_75870 CDS 102749..103720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976283.1 transl_table 11 codon_start 1 locus_tag LOCUS_75880 CDS complement(103724..104683) product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 transl_table 11 codon_start 1 locus_tag LOCUS_75890 CDS complement(104680..105582) product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 transl_table 11 codon_start 1 locus_tag LOCUS_75900 CDS complement(105585..107444) product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 transl_table 11 codon_start 1 locus_tag LOCUS_75910 CDS 107606..108124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75920 CDS complement(108121..108786) product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036280.1 transl_table 11 codon_start 1 locus_tag LOCUS_75930 CDS 109014..110471 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222227.1 transl_table 11 codon_start 1 locus_tag LOCUS_75940 CDS 110511..111944 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 transl_table 11 codon_start 1 locus_tag LOCUS_75950 CDS 111937..112965 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 transl_table 11 codon_start 1 locus_tag LOCUS_75960 gene ltaE CDS complement(113028..113633) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 transl_table 11 codon_start 1 locus_tag LOCUS_75970 CDS complement(113757..115181) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227868.1 transl_table 11 codon_start 1 locus_tag LOCUS_75980 CDS 115592..116059 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_75990 CDS complement(116229..116876) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313375.1 transl_table 11 codon_start 1 locus_tag LOCUS_76000 CDS complement(116879..117802) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 transl_table 11 codon_start 1 locus_tag LOCUS_76010 gene metF CDS 117857..118924 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 transl_table 11 codon_start 1 locus_tag LOCUS_76020 CDS complement(118921..119277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76030 CDS complement(119274..119603) product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 transl_table 11 codon_start 1 locus_tag LOCUS_76040 CDS complement(119608..119961) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 transl_table 11 codon_start 1 locus_tag LOCUS_76050 CDS 119989..120696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76060 CDS 120812..122785 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 transl_table 11 codon_start 1 locus_tag LOCUS_76070 gene pknB CDS 122776..123633 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 transl_table 11 codon_start 1 locus_tag LOCUS_76080 CDS 123766..124350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76090 CDS 124411..125727 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 transl_table 11 codon_start 1 locus_tag LOCUS_76100 CDS complement(125736..126482) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 transl_table 11 codon_start 1 locus_tag LOCUS_76110 CDS complement(126482..128428) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 transl_table 11 codon_start 1 locus_tag LOCUS_76120 CDS complement(128430..129062) product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 transl_table 11 codon_start 1 locus_tag LOCUS_76130 CDS 129233..130150 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 transl_table 11 codon_start 1 locus_tag LOCUS_76140 CDS 130235..131038 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888902.1 transl_table 11 codon_start 1 locus_tag LOCUS_76150 CDS 131158..132936 product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 transl_table 11 codon_start 1 locus_tag LOCUS_76160 CDS complement(132933..134354) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 transl_table 11 codon_start 1 locus_tag LOCUS_76170 gene crtI CDS complement(134366..135439) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 transl_table 11 codon_start 1 locus_tag LOCUS_76180 CDS complement(135448..136203) product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 transl_table 11 codon_start 1 locus_tag LOCUS_76190 CDS complement(136190..136768) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 transl_table 11 codon_start 1 locus_tag LOCUS_76200 CDS complement(136780..137424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76210 note possible pseudo, internal stop codon, frameshifted CDS complement(137442..137939) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092530.1 transl_table 11 codon_start 1 locus_tag LOCUS_76220 CDS complement(137941..139221) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 transl_table 11 codon_start 1 locus_tag LOCUS_76230 CDS complement(139275..140084) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_76240 CDS 140205..140867 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296486.1 transl_table 11 codon_start 1 locus_tag LOCUS_76250 CDS complement(140836..141060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76260 CDS 140989..141708 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 transl_table 11 codon_start 1 locus_tag LOCUS_76270 CDS 141705..144710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76280 CDS 144707..144922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76290 CDS 145091..145945 product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 transl_table 11 codon_start 1 locus_tag LOCUS_76300 CDS complement(145890..146354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76310 CDS 146441..147547 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_76320 CDS 147548..148207 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 transl_table 11 codon_start 1 locus_tag LOCUS_76330 CDS complement(148211..148996) product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 transl_table 11 codon_start 1 locus_tag LOCUS_76340 CDS 149090..150154 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 transl_table 11 codon_start 1 locus_tag LOCUS_76350 CDS 150811..151371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76360 CDS 151629..152486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76370 CDS 152488..154743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76380 CDS 154736..155044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76390 CDS 155031..158468 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 transl_table 11 codon_start 1 locus_tag LOCUS_76400 CDS 158601..159050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76410 CDS 159083..159829 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 transl_table 11 codon_start 1 locus_tag LOCUS_76420 CDS 159826..160998 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 transl_table 11 codon_start 1 locus_tag LOCUS_76430 CDS 161038..162333 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 transl_table 11 codon_start 1 locus_tag LOCUS_76440 gene dinB CDS 162434..162820 product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 transl_table 11 codon_start 1 locus_tag LOCUS_76450 CDS 163105..164373 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_76460 CDS 164502..164834 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 transl_table 11 codon_start 1 locus_tag LOCUS_76470 CDS 164831..165610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76480 CDS complement(165624..168062) product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 transl_table 11 codon_start 1 locus_tag LOCUS_76490 CDS complement(168059..169357) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 transl_table 11 codon_start 1 locus_tag LOCUS_76500 CDS complement(169360..170403) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 transl_table 11 codon_start 1 locus_tag LOCUS_76510 CDS 170733..173564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76520 CDS 173757..176555 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 transl_table 11 codon_start 1 locus_tag LOCUS_76530 gene leuS CDS complement(176716..177447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76540 CDS complement(177484..178194) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 transl_table 11 codon_start 1 locus_tag LOCUS_76550 CDS complement(178228..179523) product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 transl_table 11 codon_start 1 locus_tag LOCUS_76560 CDS 180092..180904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76570 CDS 181479..181910 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 transl_table 11 codon_start 1 locus_tag LOCUS_76580 gene mraZ CDS 182175..183263 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 transl_table 11 codon_start 1 locus_tag LOCUS_76590 gene rsmH CDS 183260..184168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76600 CDS 184175..186526 product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 transl_table 11 codon_start 1 locus_tag LOCUS_76610 gene ftsI CDS 186602..188116 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 transl_table 11 codon_start 1 locus_tag LOCUS_76620 CDS 188113..189498 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_76630 CDS 189495..190601 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 transl_table 11 codon_start 1 locus_tag LOCUS_76640 gene mraY CDS 190667..192049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76650 CDS 192049..193161 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 transl_table 11 codon_start 1 locus_tag LOCUS_76660 gene murG CDS 193193..194620 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 transl_table 11 codon_start 1 locus_tag LOCUS_76670 gene murC CDS 194628..195389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76680 CDS 195685..196827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76690 CDS 196835..197542 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 transl_table 11 codon_start 1 locus_tag LOCUS_76700 CDS 197792..198490 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 transl_table 11 codon_start 1 locus_tag LOCUS_76710 gene sepF CDS 198536..198841 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 transl_table 11 codon_start 1 locus_tag LOCUS_76720 CDS 198885..199697 product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 transl_table 11 codon_start 1 locus_tag LOCUS_76730 gene wag31 CDS 199732..200814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76740 CDS 200935..201258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76750 CDS 201346..202875 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224832.1 transl_table 11 codon_start 1 locus_tag LOCUS_76760 CDS 203261..203686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76770 CDS 203716..204330 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 transl_table 11 codon_start 1 locus_tag LOCUS_76780 gene lspA CDS 204327..205256 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 transl_table 11 codon_start 1 locus_tag LOCUS_76790 CDS 205272..206255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76800 CDS 206484..207908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76810 CDS 207985..211518 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 transl_table 11 codon_start 1 locus_tag LOCUS_76820 gene dnaE CDS 211574..212359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76830 CDS complement(212487..213194) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 transl_table 11 codon_start 1 locus_tag LOCUS_76840 CDS 213345..214673 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 transl_table 11 codon_start 1 locus_tag LOCUS_76850 gene hisD CDS 214786..215769 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 transl_table 11 codon_start 1 locus_tag LOCUS_76860 CDS 215766..216377 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 transl_table 11 codon_start 1 locus_tag LOCUS_76870 gene hisB CDS 216377..216535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76880 CDS 216535..217152 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 transl_table 11 codon_start 1 locus_tag LOCUS_76890 gene hisH CDS 217156..217482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76900 CDS 217499..218218 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 transl_table 11 codon_start 1 locus_tag LOCUS_76910 gene priA CDS complement(218267..219160) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 transl_table 11 codon_start 1 locus_tag LOCUS_76920 CDS 219233..220114 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 transl_table 11 codon_start 1 locus_tag LOCUS_76930 CDS 220111..220872 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 transl_table 11 codon_start 1 locus_tag LOCUS_76940 gene hisF CDS 220894..221580 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 transl_table 11 codon_start 1 locus_tag LOCUS_76950 CDS complement(221660..222145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76960 CDS complement(222415..223044) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 transl_table 11 codon_start 1 locus_tag LOCUS_76970 CDS 223092..224558 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 transl_table 11 codon_start 1 locus_tag LOCUS_76980 CDS complement(224701..225150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76990 CDS complement(225299..227122) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 transl_table 11 codon_start 1 locus_tag LOCUS_77000 CDS 227411..227572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77010 CDS complement(227576..228841) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 transl_table 11 codon_start 1 locus_tag LOCUS_77020 CDS complement(228942..230084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77030 CDS complement(231484..232794) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_77040 CDS complement(232943..233554) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 transl_table 11 codon_start 1 locus_tag LOCUS_77050 CDS 233665..235452 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 transl_table 11 codon_start 1 locus_tag LOCUS_77060 CDS 235449..237206 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 transl_table 11 codon_start 1 locus_tag LOCUS_77070 CDS complement(237443..238051) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 transl_table 11 codon_start 1 locus_tag LOCUS_77080 gene rpsD CDS 238159..238884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77090 CDS complement(238885..239496) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 transl_table 11 codon_start 1 locus_tag LOCUS_77100 CDS complement(239506..240243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139544.1 transl_table 11 codon_start 1 locus_tag LOCUS_77110 CDS complement(240308..241024) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 transl_table 11 codon_start 1 locus_tag LOCUS_77120 CDS complement(241159..244191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77130 CDS 244427..244804 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 transl_table 11 codon_start 1 locus_tag LOCUS_77140 gene hisI CDS 244801..246333 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 transl_table 11 codon_start 1 locus_tag LOCUS_77150 CDS 246330..246878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77160 CDS complement(246962..247228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77170 CDS 247594..248445 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_77180 gene trpC CDS 248442..249683 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 transl_table 11 codon_start 1 locus_tag LOCUS_77190 gene trpB CDS 249680..250483 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 transl_table 11 codon_start 1 locus_tag LOCUS_77200 gene trpA CDS 250535..251713 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 transl_table 11 codon_start 1 locus_tag LOCUS_77210 gene lgt CDS 251720..252865 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 transl_table 11 codon_start 1 locus_tag LOCUS_77220 CDS 252847..252984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77230 CDS 253142..254296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77240 CDS complement(254405..255271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77250 CDS 255464..260002 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 transl_table 11 codon_start 1 locus_tag LOCUS_77260 gene gltB CDS 259995..261467 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224181.1 transl_table 11 codon_start 1 locus_tag LOCUS_77270 CDS complement(261449..261877) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975634.1 transl_table 11 codon_start 1 locus_tag LOCUS_77280 CDS complement(261874..262356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77290 CDS complement(262341..265505) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215788549.1 transl_table 11 codon_start 1 locus_tag LOCUS_77300 CDS 265782..267218 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 transl_table 11 codon_start 1 locus_tag LOCUS_77310 gene pyk CDS 267215..268099 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 transl_table 11 codon_start 1 locus_tag LOCUS_77320 CDS complement(268096..268734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77330 CDS 268897..269439 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 transl_table 11 codon_start 1 locus_tag LOCUS_77340 CDS complement(269905..270246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77350 CDS complement(270451..271182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77360 tRNA complement(271232..271306) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 271436..272059 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 transl_table 11 codon_start 1 locus_tag LOCUS_77370 CDS 272268..273434 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 transl_table 11 codon_start 1 locus_tag LOCUS_77380 CDS 273518..274468 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 transl_table 11 codon_start 1 locus_tag LOCUS_77390 CDS 274465..275574 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 transl_table 11 codon_start 1 locus_tag LOCUS_77400 CDS complement(275612..275791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77410 CDS 275792..276538 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 transl_table 11 codon_start 1 locus_tag LOCUS_77420 CDS 276528..277238 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 transl_table 11 codon_start 1 locus_tag LOCUS_77430 CDS 277265..278170 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 transl_table 11 codon_start 1 locus_tag LOCUS_77440 CDS 278179..279183 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 transl_table 11 codon_start 1 locus_tag LOCUS_77450 CDS 279180..279950 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_77460 CDS 280004..282703 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 transl_table 11 codon_start 1 locus_tag LOCUS_77470 gene polA CDS 282842..283174 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 transl_table 11 codon_start 1 locus_tag LOCUS_77480 CDS complement(283187..283405) product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 transl_table 11 codon_start 1 locus_tag LOCUS_77490 CDS complement(283442..284263) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 transl_table 11 codon_start 1 locus_tag LOCUS_77500 CDS 284589..286100 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 transl_table 11 codon_start 1 locus_tag LOCUS_77510 gene rpsA CDS 286373..287557 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 transl_table 11 codon_start 1 locus_tag LOCUS_77520 gene coaE CDS 287986..290103 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895262.1 transl_table 11 codon_start 1 locus_tag LOCUS_77530 gene uvrB CDS 290141..291094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77540 CDS complement(291173..291523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77550 CDS 291852..292853 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 transl_table 11 codon_start 1 locus_tag LOCUS_77560 CDS complement(292905..294767) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 transl_table 11 codon_start 1 locus_tag LOCUS_77570 gene typA CDS 294924..295733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77580 CDS 295893..296318 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230480.1 transl_table 11 codon_start 1 locus_tag LOCUS_77590 CDS complement(296403..297014) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 transl_table 11 codon_start 1 locus_tag LOCUS_77600 gene clpP CDS 297214..297828 product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266760.1 transl_table 11 codon_start 1 locus_tag LOCUS_77610 gene rutB CDS complement(297825..298415) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223251.1 transl_table 11 codon_start 1 locus_tag LOCUS_77620 CDS 298554..299669 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_77630 CDS 299825..301336 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 transl_table 11 codon_start 1 locus_tag LOCUS_77640 CDS complement(301385..302029) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 transl_table 11 codon_start 1 locus_tag LOCUS_77650 CDS complement(302029..302736) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 transl_table 11 codon_start 1 locus_tag LOCUS_77660 CDS 302951..303988 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 transl_table 11 codon_start 1 locus_tag LOCUS_77670 gene rsgA CDS 304040..305830 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 transl_table 11 codon_start 1 locus_tag LOCUS_77680 CDS 305979..309101 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 transl_table 11 codon_start 1 locus_tag LOCUS_77690 gene uvrA CDS 309337..309858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77700 CDS 309967..312153 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 transl_table 11 codon_start 1 locus_tag LOCUS_77710 gene uvrC CDS 312351..313250 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 transl_table 11 codon_start 1 locus_tag LOCUS_77720 gene rapZ CDS 313247..314221 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_77730 gene yvcK CDS 314280..315260 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 transl_table 11 codon_start 1 locus_tag LOCUS_77740 gene whiA CDS 315300..316040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77750 CDS 316470..317468 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 transl_table 11 codon_start 1 locus_tag LOCUS_77760 gene gap CDS 317525..318667 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 transl_table 11 codon_start 1 locus_tag LOCUS_77770 CDS 318667..319455 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 transl_table 11 codon_start 1 locus_tag LOCUS_77780 gene tpiA CDS 319564..319821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77790 CDS 319977..320321 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 transl_table 11 codon_start 1 locus_tag LOCUS_77800 CDS complement(320394..320993) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 transl_table 11 codon_start 1 locus_tag LOCUS_77810 CDS 321057..321464 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 transl_table 11 codon_start 1 locus_tag LOCUS_77820 CDS complement(321461..322180) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 transl_table 11 codon_start 1 locus_tag LOCUS_77830 gene pgl CDS complement(322250..323263) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 transl_table 11 codon_start 1 locus_tag LOCUS_77840 gene opcA CDS complement(323260..324777) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 transl_table 11 codon_start 1 locus_tag LOCUS_77850 gene zwf CDS complement(324871..326007) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 transl_table 11 codon_start 1 locus_tag LOCUS_77860 gene tal CDS complement(326019..328151) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 transl_table 11 codon_start 1 locus_tag LOCUS_77870 gene tkt CDS 328415..329368 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 transl_table 11 codon_start 1 locus_tag LOCUS_77880 CDS 330599..330892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77890 CDS 330894..331793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 transl_table 11 codon_start 1 locus_tag LOCUS_77900 CDS 332638..332916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77910 CDS complement(332890..333828) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 transl_table 11 codon_start 1 locus_tag LOCUS_77920 CDS 333945..334682 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 transl_table 11 codon_start 1 locus_tag LOCUS_77930 CDS 334682..336103 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 transl_table 11 codon_start 1 locus_tag LOCUS_77940 gene sufB CDS 336141..337262 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 transl_table 11 codon_start 1 locus_tag LOCUS_77950 gene sufD CDS 337259..337591 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_77960 CDS 337588..338349 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 transl_table 11 codon_start 1 locus_tag LOCUS_77970 gene sufC CDS 338375..339604 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 transl_table 11 codon_start 1 locus_tag LOCUS_77980 CDS 339604..340074 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 transl_table 11 codon_start 1 locus_tag LOCUS_77990 CDS 340071..340457 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 transl_table 11 codon_start 1 locus_tag LOCUS_78000 CDS 340490..341236 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 transl_table 11 codon_start 1 locus_tag LOCUS_78010 CDS complement(341342..342037) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227682.1 transl_table 11 codon_start 1 locus_tag LOCUS_78020 CDS complement(342229..343761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78030 CDS complement(343748..344896) product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444889.1 transl_table 11 codon_start 1 locus_tag LOCUS_78040 CDS 345277..345879 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467104.1 transl_table 11 codon_start 1 locus_tag LOCUS_78050 CDS complement(345979..346659) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977507.1 transl_table 11 codon_start 1 locus_tag LOCUS_78060 CDS 346692..347324 product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 transl_table 11 codon_start 1 locus_tag LOCUS_78070 CDS complement(347321..348220) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 transl_table 11 codon_start 1 locus_tag LOCUS_78080 CDS 348442..350046 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 transl_table 11 codon_start 1 locus_tag LOCUS_78090 CDS 350474..350701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78100 CDS 350698..351492 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 transl_table 11 codon_start 1 locus_tag LOCUS_78110 CDS 351589..353517 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 transl_table 11 codon_start 1 locus_tag LOCUS_78120 CDS complement(353527..353925) product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 transl_table 11 codon_start 1 locus_tag LOCUS_78130 gene vapC29 CDS complement(353922..354149) product antitoxin VapB29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403213.1 transl_table 11 codon_start 1 locus_tag LOCUS_78140 CDS complement(354202..354759) product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 transl_table 11 codon_start 1 locus_tag LOCUS_78150 CDS complement(354852..355394) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 transl_table 11 codon_start 1 locus_tag LOCUS_78160 gene mug CDS complement(355416..356177) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 transl_table 11 codon_start 1 locus_tag LOCUS_78170 CDS complement(356205..356948) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 transl_table 11 codon_start 1 locus_tag LOCUS_78180 CDS complement(357051..357338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78190 CDS complement(357608..358444) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224517.1 transl_table 11 codon_start 1 locus_tag LOCUS_78200 CDS complement(358437..359327) product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224518.1 transl_table 11 codon_start 1 locus_tag LOCUS_78210 CDS complement(359469..360080) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 transl_table 11 codon_start 1 locus_tag LOCUS_78220 CDS 360159..360863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78230 CDS 361010..361927 product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 transl_table 11 codon_start 1 locus_tag LOCUS_78240 CDS complement(362004..362249) product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 transl_table 11 codon_start 1 locus_tag LOCUS_78250 CDS complement(362360..363202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78260 CDS complement(363199..364083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 transl_table 11 codon_start 1 locus_tag LOCUS_78270 CDS complement(364080..365159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78280 CDS complement(365156..365695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78290 CDS complement(365853..366260) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389543.1 transl_table 11 codon_start 1 locus_tag LOCUS_78300 gene coaD CDS complement(366328..369099) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 transl_table 11 codon_start 1 locus_tag LOCUS_78310 gene acnA CDS 369290..369679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78320 CDS 369711..372881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78330 CDS 372956..373723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78340 CDS complement(373775..375001) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228198.1 transl_table 11 codon_start 1 locus_tag LOCUS_78350 CDS complement(374998..375417) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 transl_table 11 codon_start 1 locus_tag LOCUS_78360 CDS 375569..376060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78370 CDS 376122..377018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78380 CDS complement(377055..378524) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 transl_table 11 codon_start 1 locus_tag LOCUS_78390 CDS complement(378602..379261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78400 CDS 379360..380298 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 transl_table 11 codon_start 1 locus_tag LOCUS_78410 CDS complement(380291..380680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78420 CDS complement(380691..382055) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_78430 CDS complement(382052..382546) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 transl_table 11 codon_start 1 locus_tag LOCUS_78440 CDS complement(382556..382963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78450 CDS 383029..384150 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 transl_table 11 codon_start 1 locus_tag LOCUS_78460 CDS 384132..385067 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 transl_table 11 codon_start 1 locus_tag LOCUS_78470 CDS 385064..386014 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_78480 CDS complement(386412..387362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78490 CDS complement(387949..388593) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_78500 CDS complement(388590..389795) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 transl_table 11 codon_start 1 locus_tag LOCUS_78510 CDS 389901..390605 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 transl_table 11 codon_start 1 locus_tag LOCUS_78520 CDS 390632..391399 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 transl_table 11 codon_start 1 locus_tag LOCUS_78530 gene fabI CDS 391420..392433 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_78540 CDS 392433..393215 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 transl_table 11 codon_start 1 locus_tag LOCUS_78550 CDS 393225..393647 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093972.1 transl_table 11 codon_start 1 locus_tag LOCUS_78560 CDS complement(393608..394132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78570 CDS 394204..395049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78580 CDS complement(395052..395576) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908540.1 transl_table 11 codon_start 1 locus_tag LOCUS_78590 CDS complement(395732..396226) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259518.1 transl_table 11 codon_start 1 locus_tag LOCUS_78600 CDS complement(396219..396947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78610 CDS 397091..397897 product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 transl_table 11 codon_start 1 locus_tag LOCUS_78620 CDS complement(397878..399323) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104558.1 transl_table 11 codon_start 1 locus_tag LOCUS_78630 CDS 399345..400259 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877118.1 transl_table 11 codon_start 1 locus_tag LOCUS_78640 CDS complement(400581..401885) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 transl_table 11 codon_start 1 locus_tag LOCUS_78650 CDS 402063..402488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78660 CDS 402500..403633 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 transl_table 11 codon_start 1 locus_tag LOCUS_78670 CDS complement(403667..404479) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 transl_table 11 codon_start 1 locus_tag LOCUS_78680 CDS complement(404485..405072) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284165.1 transl_table 11 codon_start 1 locus_tag LOCUS_78690 CDS complement(405140..405805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78700 CDS 405966..407111 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 transl_table 11 codon_start 1 locus_tag LOCUS_78710 CDS 407181..409865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78720 CDS complement(409967..410449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78730 CDS complement(410461..411756) product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 transl_table 11 codon_start 1 locus_tag LOCUS_78740 gene murL CDS 411836..413185 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 transl_table 11 codon_start 1 locus_tag LOCUS_78750 gene murD CDS 413826..414797 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 transl_table 11 codon_start 1 locus_tag LOCUS_78760 CDS 414904..416340 product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 transl_table 11 codon_start 1 locus_tag LOCUS_78770 gene ngcE CDS 416370..417278 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 transl_table 11 codon_start 1 locus_tag LOCUS_78780 CDS 417297..418226 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_78790 CDS complement(418266..418475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78800 CDS complement(418544..419392) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 transl_table 11 codon_start 1 locus_tag LOCUS_78810 CDS 419519..420292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78820 CDS 420665..421900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78830 CDS complement(421897..422742) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 transl_table 11 codon_start 1 locus_tag LOCUS_78840 CDS 422894..423607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78850 CDS 423621..424514 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 transl_table 11 codon_start 1 locus_tag LOCUS_78860 CDS complement(424483..425514) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_78870 gene mgrA CDS 425624..426550 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 transl_table 11 codon_start 1 locus_tag LOCUS_78880 CDS 426573..427709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78890 CDS 427778..428890 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 transl_table 11 codon_start 1 locus_tag LOCUS_78900 CDS complement(428898..429767) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 transl_table 11 codon_start 1 locus_tag LOCUS_78910 CDS 429906..431582 product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 transl_table 11 codon_start 1 locus_tag LOCUS_78920 CDS 431716..435309 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227000.1 transl_table 11 codon_start 1 locus_tag LOCUS_78930 gene metH CDS 435317..435832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78940 CDS 435848..436177 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093593.1 transl_table 11 codon_start 1 locus_tag LOCUS_78950 CDS complement(436291..436467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78960 misc_feature complement(436662..>437558) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404761.1:IS607 family element RNA-guided endonuclease TnpB locus_tag LOCUS_78970 sequence078 source 1..22777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78980 CDS complement(398..1621) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 transl_table 11 codon_start 1 locus_tag LOCUS_78990 CDS complement(1656..1934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79000 CDS 1954..4596 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_79010 CDS 4875..7526 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_79020 CDS complement(7540..7860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79030 CDS 8197..9747 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_79040 CDS 9881..10234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79050 CDS complement(10350..11279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79060 CDS complement(11575..12792) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 transl_table 11 codon_start 1 locus_tag LOCUS_79070 CDS complement(12818..13276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79080 CDS complement(14021..16048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79090 CDS 16872..17648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79100 CDS 17716..18558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 transl_table 11 codon_start 1 locus_tag LOCUS_79110 CDS 18579..19367 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403622.1 transl_table 11 codon_start 1 locus_tag LOCUS_79120 CDS 19382..21547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79130 CDS complement(21866..22666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79140 sequence079 source 1..22566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79150 CDS complement(402..647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79160 CDS 807..1610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79170 note possible pseudo, internal stop codon CDS complement(1687..2085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79180 note possible pseudo, internal stop codon, frameshifted CDS complement(1977..2390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79190 CDS complement(2646..2867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79200 CDS complement(2861..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79210 CDS 3541..4611 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211231800.1 transl_table 11 codon_start 1 locus_tag LOCUS_79220 CDS 5121..5951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79230 CDS 6894..7748 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 transl_table 11 codon_start 1 locus_tag LOCUS_79240 CDS 7947..8768 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_79250 CDS 9022..9249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79260 CDS 9242..9886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79270 CDS complement(10616..11167) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 transl_table 11 codon_start 1 locus_tag LOCUS_79280 CDS 11336..11548 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 transl_table 11 codon_start 1 locus_tag LOCUS_79290 CDS 11545..12768 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 transl_table 11 codon_start 1 locus_tag LOCUS_79300 CDS complement(13237..13485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79310 note possible pseudo, internal stop codon CDS complement(13625..13849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79320 CDS 13932..14633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79330 CDS 14827..15162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79340 note possible pseudo, internal stop codon, frameshifted CDS complement(15192..15479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79350 CDS 15635..15901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79360 note possible pseudo, frameshifted CDS 15959..17227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79370 CDS complement(17392..18711) product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 transl_table 11 codon_start 1 locus_tag LOCUS_79380 CDS 19027..19917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79390 CDS complement(19877..20248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79400 CDS complement(20472..20984) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 transl_table 11 codon_start 1 locus_tag LOCUS_79410 CDS complement(21320..21769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79420 note possible pseudo, frameshifted sequence080 source 1..20507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..2031) product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 transl_table 11 codon_start 1 locus_tag LOCUS_79430 CDS complement(2042..4363) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 transl_table 11 codon_start 1 locus_tag LOCUS_79440 CDS 4632..5114 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247583.1 transl_table 11 codon_start 1 locus_tag LOCUS_79450 CDS 5209..5562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 transl_table 11 codon_start 1 locus_tag LOCUS_79460 CDS complement(5649..7256) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 transl_table 11 codon_start 1 locus_tag LOCUS_79470 CDS complement(7324..9396) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 transl_table 11 codon_start 1 locus_tag LOCUS_79480 CDS complement(9718..10029) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078104.1 transl_table 11 codon_start 1 locus_tag LOCUS_79490 CDS complement(10095..10466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79500 CDS 10768..13194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79510 CDS 13209..13679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79520 CDS 13732..14622 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226717.1 transl_table 11 codon_start 1 locus_tag LOCUS_79530 CDS 14983..15486 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 transl_table 11 codon_start 1 locus_tag LOCUS_79540 CDS 15693..15926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79550 CDS complement(15968..16693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79560 CDS complement(16695..18623) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027426.1 transl_table 11 codon_start 1 locus_tag LOCUS_79570 CDS 18711..19574 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_79580 CDS 19647..20321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79590 sequence081 source 1..20088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..1391) product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852612.1 transl_table 11 codon_start 1 locus_tag LOCUS_79600 CDS 1670..3334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79610 CDS complement(3477..4031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79620 CDS 4244..5137 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030940.1 transl_table 11 codon_start 1 locus_tag LOCUS_79630 CDS complement(5694..7175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79640 CDS complement(7306..7977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79650 CDS complement(8049..8816) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 transl_table 11 codon_start 1 locus_tag LOCUS_79660 CDS 9163..10359 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 transl_table 11 codon_start 1 locus_tag LOCUS_79670 CDS complement(10793..11908) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967840.1 transl_table 11 codon_start 1 locus_tag LOCUS_79680 CDS 12051..12671 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044576605.1 transl_table 11 codon_start 1 locus_tag LOCUS_79690 CDS 12892..13680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79700 CDS 13689..14495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79710 CDS 14788..17613 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_79720 CDS complement(17738..18184) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 transl_table 11 codon_start 1 locus_tag LOCUS_79730 CDS 18608..19339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79740 CDS 19370..19723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79750 sequence082 source 1..19935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..2091 product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 transl_table 11 codon_start 1 locus_tag LOCUS_79760 CDS 2188..2940 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225581.1 transl_table 11 codon_start 1 locus_tag LOCUS_79770 CDS 3157..3591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79780 CDS complement(3588..4412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79790 CDS complement(4567..4941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79800 CDS 4871..6547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79810 CDS 6544..8016 product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 transl_table 11 codon_start 1 locus_tag LOCUS_79820 CDS 8013..8564 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408271.1 transl_table 11 codon_start 1 locus_tag LOCUS_79830 CDS 8566..9444 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 transl_table 11 codon_start 1 locus_tag LOCUS_79840 CDS complement(9426..9671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79850 CDS 9993..10550 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 transl_table 11 codon_start 1 locus_tag LOCUS_79860 CDS 10543..11784 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 transl_table 11 codon_start 1 locus_tag LOCUS_79870 CDS complement(11734..12120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79880 CDS 12089..13306 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896739.1 transl_table 11 codon_start 1 locus_tag LOCUS_79890 CDS complement(13401..14120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79900 CDS 14329..16740 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 transl_table 11 codon_start 1 locus_tag LOCUS_79910 CDS complement(16768..18471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79920 CDS 18565..19104 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049681146.1 transl_table 11 codon_start 1 locus_tag LOCUS_79930 CDS complement(19126..19692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79940 sequence083 source 1..16316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..2204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79950 CDS complement(2210..2644) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 transl_table 11 codon_start 1 locus_tag LOCUS_79960 CDS complement(2641..3777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79970 CDS complement(3895..5217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79980 CDS complement(5214..8237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79990 CDS 8534..8890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80000 CDS 8976..9464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80010 CDS 9509..9715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80020 CDS complement(10014..10382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80030 note possible pseudo, internal stop codon, frameshifted CDS complement(10602..11474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80040 CDS complement(11615..12436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80050 CDS complement(12463..13299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80060 CDS complement(13296..14324) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 transl_table 11 codon_start 1 locus_tag LOCUS_80070 CDS complement(14363..15229) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_80080 CDS 15430..16194 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 transl_table 11 codon_start 1 locus_tag LOCUS_80090 sequence084 source 1..14490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80100 note possible pseudo, frameshifted CDS complement(525..839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80110 note possible pseudo, frameshifted CDS 982..1611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80120 CDS 1737..2999 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085927.1 transl_table 11 codon_start 1 locus_tag LOCUS_80130 CDS 3168..3407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80140 CDS complement(3691..3933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80150 note possible pseudo, frameshifted CDS complement(3930..4412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80160 note possible pseudo, frameshifted CDS complement(5218..6771) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227841.1 transl_table 11 codon_start 1 locus_tag LOCUS_80170 CDS complement(7379..7633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80180 CDS 8447..9121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80190 CDS complement(9009..9521) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 transl_table 11 codon_start 1 locus_tag LOCUS_80200 CDS complement(9686..10351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80210 CDS 10704..11435 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 transl_table 11 codon_start 1 locus_tag LOCUS_80220 CDS 11504..11809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80230 CDS complement(11864..12085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80240 CDS complement(12141..12614) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 transl_table 11 codon_start 1 locus_tag LOCUS_80250 CDS complement(12666..13574) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 transl_table 11 codon_start 1 locus_tag LOCUS_80260 gene ilvC sequence085 source 1..12850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..849 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892317.1 transl_table 11 codon_start 1 locus_tag LOCUS_80270 CDS 1012..3522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80280 CDS complement(3529..6291) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_80290 CDS complement(6288..8843) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_80300 CDS 9444..12185 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_80310 sequence086 source 1..12392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1182..2276 product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090354.1 transl_table 11 codon_start 1 locus_tag LOCUS_80320 gene pqsH CDS 2304..3155 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743809.1 transl_table 11 codon_start 1 locus_tag LOCUS_80330 CDS complement(3178..3825) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 transl_table 11 codon_start 1 locus_tag LOCUS_80340 CDS complement(4141..5487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80350 CDS complement(5549..6073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80360 CDS 6313..7632 product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 transl_table 11 codon_start 1 locus_tag LOCUS_80370 CDS 8264..8797 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 transl_table 11 codon_start 1 locus_tag LOCUS_80380 CDS complement(8894..9034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80390 CDS complement(9137..9355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80400 CDS complement(9485..9733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80410 note possible pseudo, internal stop codon CDS 9994..10458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80420 note possible pseudo, frameshifted CDS 10437..10670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80430 CDS 10654..11043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80440 CDS complement(11136..11984) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 transl_table 11 codon_start 1 locus_tag LOCUS_80450 sequence087 source 1..11784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1193) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895405.1 transl_table 11 codon_start 1 locus_tag LOCUS_80460 CDS 1493..3310 product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 transl_table 11 codon_start 1 locus_tag LOCUS_80470 CDS 3307..4725 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 transl_table 11 codon_start 1 locus_tag LOCUS_80480 CDS 5229..6227 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 transl_table 11 codon_start 1 locus_tag LOCUS_80490 CDS complement(6289..6723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80500 CDS complement(6792..7100) product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 transl_table 11 codon_start 1 locus_tag LOCUS_80510 CDS complement(7247..7486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80520 CDS complement(7586..8236) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 transl_table 11 codon_start 1 locus_tag LOCUS_80530 CDS complement(8391..9329) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 transl_table 11 codon_start 1 locus_tag LOCUS_80540 CDS complement(9620..10093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80550 CDS complement(10090..10923) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_80560 CDS complement(11037..11546) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 transl_table 11 codon_start 1 locus_tag LOCUS_80570 sequence088 source 1..409883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80580 CDS complement(1234..1974) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 transl_table 11 codon_start 1 locus_tag LOCUS_80590 CDS complement(2041..2385) product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 transl_table 11 codon_start 1 locus_tag LOCUS_80600 CDS 2665..3783 product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 transl_table 11 codon_start 1 locus_tag LOCUS_80610 CDS complement(3960..4463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80620 CDS complement(4620..6260) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 transl_table 11 codon_start 1 locus_tag LOCUS_80630 CDS complement(6276..7292) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 transl_table 11 codon_start 1 locus_tag LOCUS_80640 CDS 7336..8928 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 transl_table 11 codon_start 1 locus_tag LOCUS_80650 CDS complement(8925..9089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80660 CDS complement(9142..10725) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 transl_table 11 codon_start 1 locus_tag LOCUS_80670 CDS complement(10735..12405) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 transl_table 11 codon_start 1 locus_tag LOCUS_80680 CDS 12518..14602 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 transl_table 11 codon_start 1 locus_tag LOCUS_80690 CDS 14613..15605 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 transl_table 11 codon_start 1 locus_tag LOCUS_80700 CDS 15672..16493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80710 CDS 16633..16956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80720 CDS complement(17064..17375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80730 CDS complement(17454..18377) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 transl_table 11 codon_start 1 locus_tag LOCUS_80740 tRNA complement(17793..17867) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 18817..18890 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 19130..19202 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 19203..19277 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 19524..19820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80750 CDS 19817..21049 product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 transl_table 11 codon_start 1 locus_tag LOCUS_80760 CDS 21138..21524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80770 CDS 21514..21972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80780 CDS 21965..22381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80790 CDS complement(22462..23166) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223221.1 transl_table 11 codon_start 1 locus_tag LOCUS_80800 CDS 23194..24024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80810 CDS complement(24008..24793) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807981.1 transl_table 11 codon_start 1 locus_tag LOCUS_80820 CDS 24866..26602 product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226369.1 transl_table 11 codon_start 1 locus_tag LOCUS_80830 CDS complement(26599..27816) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 transl_table 11 codon_start 1 locus_tag LOCUS_80840 CDS complement(27813..28484) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 transl_table 11 codon_start 1 locus_tag LOCUS_80850 CDS complement(28481..29713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80860 CDS complement(29716..30585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80870 CDS complement(30663..31652) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 transl_table 11 codon_start 1 locus_tag LOCUS_80880 CDS 31773..33059 product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 transl_table 11 codon_start 1 locus_tag LOCUS_80890 CDS 33011..33646 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 transl_table 11 codon_start 1 locus_tag LOCUS_80900 CDS complement(33631..34560) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 transl_table 11 codon_start 1 locus_tag LOCUS_80910 CDS 34793..35833 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 transl_table 11 codon_start 1 locus_tag LOCUS_80920 CDS 35902..36729 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 transl_table 11 codon_start 1 locus_tag LOCUS_80930 CDS 36810..37535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80940 CDS 37532..38302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80950 CDS 38320..39612 product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190686.1 transl_table 11 codon_start 1 locus_tag LOCUS_80960 CDS 39615..40271 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223971.1 transl_table 11 codon_start 1 locus_tag LOCUS_80970 CDS complement(40255..40998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_80980 CDS complement(40991..41479) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 transl_table 11 codon_start 1 locus_tag LOCUS_80990 CDS complement(41557..42024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81000 CDS complement(42088..43062) product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 transl_table 11 codon_start 1 locus_tag LOCUS_81010 gene ligD CDS complement(43072..44805) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_81020 CDS complement(44932..46908) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 transl_table 11 codon_start 1 locus_tag LOCUS_81030 CDS 46937..48637 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_81040 CDS 48691..49728 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 transl_table 11 codon_start 1 locus_tag LOCUS_81050 CDS complement(49861..50334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81060 CDS 50408..50848 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223318.1 transl_table 11 codon_start 1 locus_tag LOCUS_81070 CDS 50869..51555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81080 CDS 51565..53370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81090 CDS 53376..53825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81100 CDS complement(53822..55036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81110 CDS 55313..56983 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157683565.1 transl_table 11 codon_start 1 locus_tag LOCUS_81120 CDS complement(57005..57139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81130 CDS 57173..58180 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055585491.1 transl_table 11 codon_start 1 locus_tag LOCUS_81140 CDS 58210..59610 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 transl_table 11 codon_start 1 locus_tag LOCUS_81150 gene zwf CDS 59654..60100 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228499.1 transl_table 11 codon_start 1 locus_tag LOCUS_81160 CDS 60097..61464 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 transl_table 11 codon_start 1 locus_tag LOCUS_81170 CDS 61476..62048 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 transl_table 11 codon_start 1 locus_tag LOCUS_81180 CDS complement(62073..62804) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 transl_table 11 codon_start 1 locus_tag LOCUS_81190 CDS complement(62797..63540) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_81200 gene cobM CDS complement(63537..64751) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 transl_table 11 codon_start 1 locus_tag LOCUS_81210 CDS 64915..66579 product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 transl_table 11 codon_start 1 locus_tag LOCUS_81220 CDS 66646..67170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81230 CDS 67182..67931 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 transl_table 11 codon_start 1 locus_tag LOCUS_81240 CDS 68038..69699 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 transl_table 11 codon_start 1 locus_tag LOCUS_81250 CDS 69696..71402 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203682078.1 transl_table 11 codon_start 1 locus_tag LOCUS_81260 CDS complement(71522..72085) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310114.1 transl_table 11 codon_start 1 locus_tag LOCUS_81270 CDS 72364..74001 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 transl_table 11 codon_start 1 locus_tag LOCUS_81280 CDS complement(74081..74242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81290 CDS 74199..74360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81300 CDS complement(74441..74935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81310 CDS complement(75015..75221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81320 CDS complement(75407..76588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81330 tRNA 76776..76849 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA 76885..76956 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA 76978..77052 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS complement(77317..78150) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 transl_table 11 codon_start 1 locus_tag LOCUS_81340 CDS complement(78479..79216) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 transl_table 11 codon_start 1 locus_tag LOCUS_81350 CDS complement(79290..80228) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228296.1 transl_table 11 codon_start 1 locus_tag LOCUS_81360 CDS 80504..81157 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 transl_table 11 codon_start 1 locus_tag LOCUS_81370 CDS 81447..81704 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 transl_table 11 codon_start 1 locus_tag LOCUS_81380 CDS 81704..82138 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_81390 CDS 82629..83243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81400 CDS 83398..83775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81410 CDS 83772..85841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229912.1 transl_table 11 codon_start 1 locus_tag LOCUS_81420 CDS complement(85875..87428) product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 transl_table 11 codon_start 1 locus_tag LOCUS_81430 CDS complement(87438..87869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81440 CDS complement(87913..88992) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 transl_table 11 codon_start 1 locus_tag LOCUS_81450 CDS 88882..89196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81460 CDS complement(89149..89535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81470 CDS 89589..90215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81480 CDS 90292..90771 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803700.1 transl_table 11 codon_start 1 locus_tag LOCUS_81490 CDS 91168..91719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81500 CDS complement(92022..93632) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 transl_table 11 codon_start 1 locus_tag LOCUS_81510 CDS complement(93629..94270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81520 CDS 94499..95347 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_81530 CDS 95384..95623 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 transl_table 11 codon_start 1 locus_tag LOCUS_81540 CDS complement(95884..96399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81550 CDS complement(96529..98418) product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286347.1 transl_table 11 codon_start 1 locus_tag LOCUS_81560 CDS 98688..99641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81570 CDS complement(99622..100965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81580 CDS 101131..101820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81590 CDS complement(101834..103021) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 transl_table 11 codon_start 1 locus_tag LOCUS_81600 CDS complement(103053..103883) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 transl_table 11 codon_start 1 locus_tag LOCUS_81610 CDS complement(104017..105390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81620 CDS complement(105873..106253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81630 CDS 106372..106713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81640 CDS 106814..107281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81650 CDS 107338..110331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81660 CDS 110393..110998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81670 CDS complement(111041..115666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81680 CDS complement(115764..116150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81690 CDS 116134..116535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81700 CDS complement(116888..117664) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 transl_table 11 codon_start 1 locus_tag LOCUS_81710 CDS 117920..119380 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974143.1 transl_table 11 codon_start 1 locus_tag LOCUS_81720 CDS 119395..120429 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 transl_table 11 codon_start 1 locus_tag LOCUS_81730 CDS 120558..122360 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 transl_table 11 codon_start 1 locus_tag LOCUS_81740 CDS 122357..123307 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 transl_table 11 codon_start 1 locus_tag LOCUS_81750 CDS 123304..125631 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 transl_table 11 codon_start 1 locus_tag LOCUS_81760 CDS 125642..126790 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_81770 gene solA CDS 126795..127913 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 transl_table 11 codon_start 1 locus_tag LOCUS_81780 CDS 128024..128782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81790 CDS 128858..129673 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 transl_table 11 codon_start 1 locus_tag LOCUS_81800 CDS 129670..130794 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 transl_table 11 codon_start 1 locus_tag LOCUS_81810 CDS 130791..132695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81820 CDS 132692..133489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81830 CDS 133483..134736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81840 CDS 134733..135977 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056727.1 transl_table 11 codon_start 1 locus_tag LOCUS_81850 CDS 135994..137289 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 transl_table 11 codon_start 1 locus_tag LOCUS_81860 CDS complement(137223..138929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81870 CDS complement(139048..140637) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 transl_table 11 codon_start 1 locus_tag LOCUS_81880 tRNA 141151..141224 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 CDS complement(141256..142425) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900454.1 transl_table 11 codon_start 1 locus_tag LOCUS_81890 gene cobG CDS 142679..146287 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086495.1 transl_table 11 codon_start 1 locus_tag LOCUS_81900 gene cobN CDS 146379..146879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81910 CDS 147074..148852 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 transl_table 11 codon_start 1 locus_tag LOCUS_81920 CDS 148908..150164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81930 CDS 150239..151285 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 transl_table 11 codon_start 1 locus_tag LOCUS_81940 CDS 151295..151936 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 transl_table 11 codon_start 1 locus_tag LOCUS_81950 CDS 151976..152689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81960 CDS 152805..154223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_81970 CDS 154233..155138 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228570.1 transl_table 11 codon_start 1 locus_tag LOCUS_81980 CDS 155913..156938 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 transl_table 11 codon_start 1 locus_tag LOCUS_81990 CDS 156970..158718 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 transl_table 11 codon_start 1 locus_tag LOCUS_82000 CDS 158897..159874 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 transl_table 11 codon_start 1 locus_tag LOCUS_82010 CDS 159924..161012 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 transl_table 11 codon_start 1 locus_tag LOCUS_82020 CDS 161021..162079 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 transl_table 11 codon_start 1 locus_tag LOCUS_82030 CDS complement(162128..162514) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 transl_table 11 codon_start 1 locus_tag LOCUS_82040 CDS 162751..163992 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731284.1 transl_table 11 codon_start 1 locus_tag LOCUS_82050 gene dinB CDS 164184..164969 product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228664.1 transl_table 11 codon_start 1 locus_tag LOCUS_82060 gene cobF CDS complement(164942..166132) product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 transl_table 11 codon_start 1 locus_tag LOCUS_82070 gene tetA(P) CDS complement(166303..167172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82080 CDS 167223..167597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82090 CDS 167587..168786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82100 CDS 168841..169185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82110 CDS 169172..169378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82120 CDS 169476..171518 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 transl_table 11 codon_start 1 locus_tag LOCUS_82130 CDS 171629..174361 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744980.1 transl_table 11 codon_start 1 locus_tag LOCUS_82140 CDS 174748..175215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82150 CDS complement(175311..175853) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 transl_table 11 codon_start 1 locus_tag LOCUS_82160 CDS complement(175941..176270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82170 CDS complement(176267..176956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82180 CDS complement(177132..178292) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 transl_table 11 codon_start 1 locus_tag LOCUS_82190 CDS complement(178320..178757) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 transl_table 11 codon_start 1 locus_tag LOCUS_82200 CDS complement(178866..179519) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 transl_table 11 codon_start 1 locus_tag LOCUS_82210 CDS complement(179516..180703) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 transl_table 11 codon_start 1 locus_tag LOCUS_82220 CDS complement(180743..181699) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230081.1 transl_table 11 codon_start 1 locus_tag LOCUS_82230 CDS complement(181718..182062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82240 CDS complement(182240..183124) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776639.1 transl_table 11 codon_start 1 locus_tag LOCUS_82250 CDS complement(183121..184014) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776638.1 transl_table 11 codon_start 1 locus_tag LOCUS_82260 CDS complement(184096..185388) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 transl_table 11 codon_start 1 locus_tag LOCUS_82270 CDS complement(185634..186650) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 transl_table 11 codon_start 1 locus_tag LOCUS_82280 CDS 187257..192398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82290 CDS complement(192760..193158) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 transl_table 11 codon_start 1 locus_tag LOCUS_82300 CDS complement(193168..194385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82310 CDS complement(194462..195571) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898281.1 transl_table 11 codon_start 1 locus_tag LOCUS_82320 CDS complement(195602..196069) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227882.1 transl_table 11 codon_start 1 locus_tag LOCUS_82330 gene rnhA CDS 196167..197084 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 transl_table 11 codon_start 1 locus_tag LOCUS_82340 CDS 197081..197839 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 transl_table 11 codon_start 1 locus_tag LOCUS_82350 CDS 198537..201413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82360 CDS complement(201487..203436) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 transl_table 11 codon_start 1 locus_tag LOCUS_82370 CDS complement(203433..205169) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 transl_table 11 codon_start 1 locus_tag LOCUS_82380 CDS complement(205169..205774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82390 CDS 205962..207596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 transl_table 11 codon_start 1 locus_tag LOCUS_82400 CDS 207744..208592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82410 CDS complement(208642..209679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82420 CDS 209841..210440 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 transl_table 11 codon_start 1 locus_tag LOCUS_82430 CDS 210437..211135 product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 transl_table 11 codon_start 1 locus_tag LOCUS_82440 CDS complement(211148..211783) product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 transl_table 11 codon_start 1 locus_tag LOCUS_82450 CDS complement(211789..212823) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 transl_table 11 codon_start 1 locus_tag LOCUS_82460 CDS complement(212820..213416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82470 CDS complement(213599..214411) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 transl_table 11 codon_start 1 locus_tag LOCUS_82480 gene modA CDS complement(214408..214806) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 transl_table 11 codon_start 1 locus_tag LOCUS_82490 CDS 214860..215876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82500 CDS complement(215883..216134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82510 CDS complement(216290..216781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82520 CDS complement(217078..217887) product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804073.1 transl_table 11 codon_start 1 locus_tag LOCUS_82530 CDS complement(217943..219244) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878220.1 transl_table 11 codon_start 1 locus_tag LOCUS_82540 CDS 219399..220739 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776532.1 transl_table 11 codon_start 1 locus_tag LOCUS_82550 CDS 220679..221554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82560 CDS 221559..222056 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 transl_table 11 codon_start 1 locus_tag LOCUS_82570 CDS complement(222058..223530) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 transl_table 11 codon_start 1 locus_tag LOCUS_82580 CDS complement(223534..225192) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223371.1 transl_table 11 codon_start 1 locus_tag LOCUS_82590 CDS complement(225201..226370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82600 CDS 226537..228150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82610 CDS complement(228184..229407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82620 CDS complement(229404..230183) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919769.1 transl_table 11 codon_start 1 locus_tag LOCUS_82630 CDS 230215..230637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82640 CDS 230634..231122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82650 CDS 231167..231670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82660 CDS 231660..232265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82670 CDS 232328..233050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82680 CDS complement(232996..234768) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495724.1 transl_table 11 codon_start 1 locus_tag LOCUS_82690 CDS complement(234787..236556) product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 transl_table 11 codon_start 1 locus_tag LOCUS_82700 CDS complement(236614..239190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82710 CDS 239507..240577 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 transl_table 11 codon_start 1 locus_tag LOCUS_82720 CDS 240896..242974 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 transl_table 11 codon_start 1 locus_tag LOCUS_82730 CDS complement(242992..243840) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 transl_table 11 codon_start 1 locus_tag LOCUS_82740 CDS complement(244022..245056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82750 CDS complement(245053..246246) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 transl_table 11 codon_start 1 locus_tag LOCUS_82760 CDS complement(246243..247097) product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 transl_table 11 codon_start 1 locus_tag LOCUS_82770 CDS complement(247142..247444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82780 CDS 247779..248765 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 transl_table 11 codon_start 1 locus_tag LOCUS_82790 CDS 249004..250386 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 transl_table 11 codon_start 1 locus_tag LOCUS_82800 CDS 250446..251390 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 transl_table 11 codon_start 1 locus_tag LOCUS_82810 CDS 251395..252267 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 transl_table 11 codon_start 1 locus_tag LOCUS_82820 CDS 252358..253950 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 transl_table 11 codon_start 1 locus_tag LOCUS_82830 CDS 254054..257605 product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 transl_table 11 codon_start 1 locus_tag LOCUS_82840 CDS 257615..258583 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 transl_table 11 codon_start 1 locus_tag LOCUS_82850 CDS complement(258946..260379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82860 CDS 260443..260991 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224360.1 transl_table 11 codon_start 1 locus_tag LOCUS_82870 CDS complement(261028..262038) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765006.1 transl_table 11 codon_start 1 locus_tag LOCUS_82880 CDS 262392..263075 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_82890 CDS 263385..264209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82900 CDS complement(264206..264847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 transl_table 11 codon_start 1 locus_tag LOCUS_82910 CDS 264993..266081 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_82920 CDS 266069..266833 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_82930 CDS complement(266837..268342) product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104502.1 transl_table 11 codon_start 1 locus_tag LOCUS_82940 CDS complement(268339..269421) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727499.1 transl_table 11 codon_start 1 locus_tag LOCUS_82950 CDS complement(269418..270563) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 transl_table 11 codon_start 1 locus_tag LOCUS_82960 CDS complement(270722..271723) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 transl_table 11 codon_start 1 locus_tag LOCUS_82970 CDS 271806..273491 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989371.1 transl_table 11 codon_start 1 locus_tag LOCUS_82980 CDS complement(273488..275266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_82990 CDS complement(275355..275567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83000 CDS complement(275629..277203) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 transl_table 11 codon_start 1 locus_tag LOCUS_83010 CDS 277259..277891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83020 CDS complement(277888..278253) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974289.1 transl_table 11 codon_start 1 locus_tag LOCUS_83030 CDS complement(278294..280477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83040 CDS complement(280517..281026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83050 CDS 280991..281143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83060 CDS complement(281127..282011) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 transl_table 11 codon_start 1 locus_tag LOCUS_83070 CDS 282106..283149 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_83080 CDS 283170..284582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83090 CDS 284624..284881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83100 CDS complement(284895..285821) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 transl_table 11 codon_start 1 locus_tag LOCUS_83110 CDS complement(285818..286465) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029031.1 transl_table 11 codon_start 1 locus_tag LOCUS_83120 CDS complement(286455..287066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83130 CDS complement(287144..290200) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 transl_table 11 codon_start 1 locus_tag LOCUS_83140 CDS complement(290783..291640) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 transl_table 11 codon_start 1 locus_tag LOCUS_83150 CDS 291746..292420 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 transl_table 11 codon_start 1 locus_tag LOCUS_83160 CDS complement(292443..294473) product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203995958.1 transl_table 11 codon_start 1 locus_tag LOCUS_83170 CDS complement(294562..295428) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 transl_table 11 codon_start 1 locus_tag LOCUS_83180 CDS 295505..296242 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 transl_table 11 codon_start 1 locus_tag LOCUS_83190 CDS complement(296187..296816) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 transl_table 11 codon_start 1 locus_tag LOCUS_83200 gene prfH CDS complement(296813..297859) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 transl_table 11 codon_start 1 locus_tag LOCUS_83210 CDS 297986..298162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83220 CDS 298402..298980 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 transl_table 11 codon_start 1 locus_tag LOCUS_83230 CDS 298987..300084 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 transl_table 11 codon_start 1 locus_tag LOCUS_83240 CDS complement(300081..300614) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 transl_table 11 codon_start 1 locus_tag LOCUS_83250 CDS complement(300670..302004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 transl_table 11 codon_start 1 locus_tag LOCUS_83260 CDS 302111..303004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 transl_table 11 codon_start 1 locus_tag LOCUS_83270 CDS 303015..304139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83280 CDS 304136..304759 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228272.1 transl_table 11 codon_start 1 locus_tag LOCUS_83290 CDS 305107..306747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83300 CDS 306939..309125 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111541.1 transl_table 11 codon_start 1 locus_tag LOCUS_83310 CDS 309181..309678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83320 CDS 309678..310961 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005135613.1 transl_table 11 codon_start 1 locus_tag LOCUS_83330 CDS 311123..312157 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 transl_table 11 codon_start 1 locus_tag LOCUS_83340 CDS 312321..313121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83350 CDS 313404..313907 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727619.1 transl_table 11 codon_start 1 locus_tag LOCUS_83360 CDS complement(313950..314885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83370 CDS 315075..315995 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135794525.1 transl_table 11 codon_start 1 locus_tag LOCUS_83380 CDS 316074..316952 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730107.1 transl_table 11 codon_start 1 locus_tag LOCUS_83390 CDS 316949..319621 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_83400 CDS complement(319553..320203) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223225.1 transl_table 11 codon_start 1 locus_tag LOCUS_83410 CDS complement(320200..320937) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 transl_table 11 codon_start 1 locus_tag LOCUS_83420 CDS 320879..321043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83430 CDS 321034..322005 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_83440 CDS 321998..322975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83450 CDS 323014..324480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83460 CDS 324477..325235 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 transl_table 11 codon_start 1 locus_tag LOCUS_83470 CDS 325417..327555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83480 CDS complement(327710..328507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83490 CDS complement(328510..329142) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 transl_table 11 codon_start 1 locus_tag LOCUS_83500 CDS 329227..329826 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 transl_table 11 codon_start 1 locus_tag LOCUS_83510 CDS complement(330022..330540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83520 CDS complement(331062..331676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83530 CDS complement(331845..332141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83540 CDS 332204..333469 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 transl_table 11 codon_start 1 locus_tag LOCUS_83550 CDS 333607..339678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83560 CDS 339754..340260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83570 CDS complement(340341..340844) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089000.1 transl_table 11 codon_start 1 locus_tag LOCUS_83580 gene msrA CDS complement(340930..342468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83590 CDS 342711..343604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224792.1 transl_table 11 codon_start 1 locus_tag LOCUS_83600 CDS complement(343605..343784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83610 CDS complement(343850..344305) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 transl_table 11 codon_start 1 locus_tag LOCUS_83620 CDS complement(344371..345255) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 transl_table 11 codon_start 1 locus_tag LOCUS_83630 CDS complement(345406..345837) product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 transl_table 11 codon_start 1 locus_tag LOCUS_83640 CDS 346114..346515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83650 tRNA 346566..346638 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS complement(346922..347473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83660 note possible pseudo, frameshifted CDS complement(347470..348021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83670 CDS complement(348208..348843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83680 note possible pseudo, frameshifted CDS complement(348840..349124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83690 note possible pseudo, frameshifted CDS 349536..350693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83700 CDS 350709..351218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83710 CDS complement(351706..352194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83720 CDS 352479..353198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83730 CDS 353480..353797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83740 CDS 353829..354632 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 transl_table 11 codon_start 1 locus_tag LOCUS_83750 CDS 354629..354889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83760 CDS 354886..356418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83770 CDS 356522..357046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83780 CDS 357131..359941 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_83790 CDS complement(360235..360900) product TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894516.1 transl_table 11 codon_start 1 locus_tag LOCUS_83800 CDS 361045..362259 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 transl_table 11 codon_start 1 locus_tag LOCUS_83810 CDS complement(362396..364144) product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224937.1 transl_table 11 codon_start 1 locus_tag LOCUS_83820 CDS complement(364172..364960) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224936.1 transl_table 11 codon_start 1 locus_tag LOCUS_83830 CDS complement(364978..365811) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224935.1 transl_table 11 codon_start 1 locus_tag LOCUS_83840 CDS complement(365943..367145) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224934.1 transl_table 11 codon_start 1 locus_tag LOCUS_83850 CDS 367478..368491 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224933.1 transl_table 11 codon_start 1 locus_tag LOCUS_83860 CDS 368571..370391 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225159.1 transl_table 11 codon_start 1 locus_tag LOCUS_83870 CDS 370420..371901 product arabinofuranosidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225158.1 transl_table 11 codon_start 1 locus_tag LOCUS_83880 CDS 372363..373862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 transl_table 11 codon_start 1 locus_tag LOCUS_83890 CDS complement(374224..376896) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 transl_table 11 codon_start 1 locus_tag LOCUS_83900 CDS complement(376920..379604) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731565.1 transl_table 11 codon_start 1 locus_tag LOCUS_83910 CDS 379677..380510 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 transl_table 11 codon_start 1 locus_tag LOCUS_83920 CDS 380507..381442 product CFTR inhibitory factor Cif inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114004.1 transl_table 11 codon_start 1 locus_tag LOCUS_83930 gene cif CDS 381450..382226 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 transl_table 11 codon_start 1 locus_tag LOCUS_83940 CDS 382255..383634 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_83950 CDS complement(383785..384687) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 transl_table 11 codon_start 1 locus_tag LOCUS_83960 CDS 384723..385220 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975419.1 transl_table 11 codon_start 1 locus_tag LOCUS_83970 CDS 386035..387900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_83980 CDS 388032..389039 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_83990 CDS complement(389010..390206) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727419.1 transl_table 11 codon_start 1 locus_tag LOCUS_84000 CDS complement(390203..391300) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 transl_table 11 codon_start 1 locus_tag LOCUS_84010 CDS complement(391334..393694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84020 CDS complement(393762..394724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84030 CDS complement(394758..395570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84040 CDS complement(395749..397059) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257253.1 transl_table 11 codon_start 1 locus_tag LOCUS_84050 CDS complement(397056..398303) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 transl_table 11 codon_start 1 locus_tag LOCUS_84060 CDS complement(398310..399647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84070 CDS 399757..400053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84080 CDS 400053..400379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84090 CDS complement(400342..400875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84100 CDS 401631..401852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84110 CDS 402015..408938 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 transl_table 11 codon_start 1 locus_tag LOCUS_84120 CDS 408942..409241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84130 CDS complement(409287..409763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84140 sequence089 source 1..9642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..6318 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225652.1 transl_table 11 codon_start 1 locus_tag LOCUS_84150 CDS 6451..6642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84160 CDS complement(6639..7382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84170 CDS 7528..8217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84180 CDS 8639..9550 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225407.1 transl_table 11 codon_start 1 locus_tag LOCUS_84190 sequence090 source 1..9230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84200 CDS complement(710..3325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84210 CDS 3355..4788 product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 transl_table 11 codon_start 1 locus_tag LOCUS_84220 CDS complement(4900..6105) product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 transl_table 11 codon_start 1 locus_tag LOCUS_84230 CDS 6297..6785 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 transl_table 11 codon_start 1 locus_tag LOCUS_84240 CDS 6782..8056 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 transl_table 11 codon_start 1 locus_tag LOCUS_84250 CDS complement(8513..9103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84260 sequence091 source 1..8627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84270 CDS 4049..4501 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 transl_table 11 codon_start 1 locus_tag LOCUS_84280 CDS complement(4864..5589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898997.1 transl_table 11 codon_start 1 locus_tag LOCUS_84290 CDS 5794..6486 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728668.1 transl_table 11 codon_start 1 locus_tag LOCUS_84300 CDS complement(6609..7607) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 transl_table 11 codon_start 1 locus_tag LOCUS_84310 CDS complement(7777..8256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84320 sequence092 source 1..8346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..528 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227298.1:universal stress protein locus_tag LOCUS_84330 CDS 858..1727 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 transl_table 11 codon_start 1 locus_tag LOCUS_84340 CDS 1787..2641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84350 CDS complement(2736..3023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84360 CDS complement(3011..3988) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_84370 CDS complement(4391..4555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84380 CDS 5152..6111 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 transl_table 11 codon_start 1 locus_tag LOCUS_84390 CDS complement(6614..6949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84400 CDS 7222..7371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84410 CDS complement(7337..7963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84420 sequence093 source 1..5463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 153..1667 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 2097..5213 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5337..5447 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence094 source 1..4685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..1249) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 transl_table 11 codon_start 1 locus_tag LOCUS_84430 CDS complement(1246..2421) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 transl_table 11 codon_start 1 locus_tag LOCUS_84440 CDS 2536..3246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84450 CDS complement(3239..4453) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928935.1 transl_table 11 codon_start 1 locus_tag LOCUS_84460 sequence095 source 1..3851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84470 CDS complement(456..1217) product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 transl_table 11 codon_start 1 locus_tag LOCUS_84480 gene istB CDS complement(1261..2058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84490 note possible pseudo, frameshifted CDS complement(1944..2903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84500 note possible pseudo, frameshifted CDS complement(3140..3703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84510 sequence096 source 1..3051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence097 source 1..3116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84520 CDS complement(1785..2162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84530 CDS complement(2401..2766) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 transl_table 11 codon_start 1 locus_tag LOCUS_84540 sequence098 source 1..351403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1106) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 transl_table 11 codon_start 1 locus_tag LOCUS_84550 CDS complement(1140..1445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84560 CDS complement(1554..2324) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_84570 gene trpC CDS complement(2356..2715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84580 CDS 2621..5863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84590 CDS 6043..6399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84600 CDS complement(6452..6943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84610 CDS 7175..7660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84620 CDS complement(7967..8470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84630 CDS 8745..9881 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 transl_table 11 codon_start 1 locus_tag LOCUS_84640 CDS 10114..10296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84650 CDS 10293..10592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84660 CDS 10589..10789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84670 CDS complement(10808..13603) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389880.1 transl_table 11 codon_start 1 locus_tag LOCUS_84680 CDS complement(13605..13871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84690 CDS complement(13879..14439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84700 CDS 14467..14700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84710 CDS 14697..14870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84720 CDS complement(15050..15814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84730 CDS complement(15820..16218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84740 CDS complement(16222..16617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84750 CDS 16616..16870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84760 CDS complement(17050..17544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84770 CDS complement(17595..19076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775718.1 transl_table 11 codon_start 1 locus_tag LOCUS_84780 CDS complement(19073..19312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84790 CDS complement(19339..19542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84800 CDS 19663..20307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84810 CDS 20294..21445 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 transl_table 11 codon_start 1 locus_tag LOCUS_84820 CDS complement(21489..22340) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 transl_table 11 codon_start 1 locus_tag LOCUS_84830 CDS complement(22337..23320) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_84840 CDS complement(23445..23894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84850 CDS complement(23987..26674) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_84860 CDS 26852..27106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84870 CDS complement(27110..27619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84880 CDS 27722..28405 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 transl_table 11 codon_start 1 locus_tag LOCUS_84890 CDS 28402..29670 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 transl_table 11 codon_start 1 locus_tag LOCUS_84900 CDS 29687..30307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84910 CDS complement(30353..30826) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098129.1 transl_table 11 codon_start 1 locus_tag LOCUS_84920 CDS 31642..31980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84930 CDS 32038..32715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84940 CDS complement(32836..33708) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 transl_table 11 codon_start 1 locus_tag LOCUS_84950 CDS 33788..34447 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 transl_table 11 codon_start 1 locus_tag LOCUS_84960 CDS complement(34448..35518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84970 CDS complement(35518..35910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_84980 CDS 36201..37226 product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 transl_table 11 codon_start 1 locus_tag LOCUS_84990 CDS complement(37107..38006) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 transl_table 11 codon_start 1 locus_tag LOCUS_85000 CDS 38118..38951 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 transl_table 11 codon_start 1 locus_tag LOCUS_85010 CDS 38961..39683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85020 CDS 39693..40952 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 transl_table 11 codon_start 1 locus_tag LOCUS_85030 CDS complement(41004..41951) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_85040 CDS complement(42165..42485) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 transl_table 11 codon_start 1 locus_tag LOCUS_85050 CDS complement(42482..42961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85060 CDS complement(43283..43861) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 transl_table 11 codon_start 1 locus_tag LOCUS_85070 CDS 44079..45173 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_85080 CDS 45263..45865 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 transl_table 11 codon_start 1 locus_tag LOCUS_85090 CDS complement(46000..46533) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 transl_table 11 codon_start 1 locus_tag LOCUS_85100 gene def CDS 46701..46859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85110 CDS 46856..47695 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 transl_table 11 codon_start 1 locus_tag LOCUS_85120 CDS complement(47730..48317) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970387.1 transl_table 11 codon_start 1 locus_tag LOCUS_85130 CDS 48557..49672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85140 CDS 49669..50838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85150 CDS complement(50835..51038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85160 CDS 51156..52517 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 transl_table 11 codon_start 1 locus_tag LOCUS_85170 CDS complement(52514..53278) product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742157.1 transl_table 11 codon_start 1 locus_tag LOCUS_85180 CDS complement(53330..54802) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775784.1 transl_table 11 codon_start 1 locus_tag LOCUS_85190 CDS 55066..56655 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729028.1 transl_table 11 codon_start 1 locus_tag LOCUS_85200 CDS 56703..57218 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854343.1 transl_table 11 codon_start 1 locus_tag LOCUS_85210 CDS 57218..57910 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 transl_table 11 codon_start 1 locus_tag LOCUS_85220 CDS complement(57894..58856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85230 CDS complement(59134..59382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85240 CDS complement(59516..59659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85250 CDS complement(59684..61129) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 transl_table 11 codon_start 1 locus_tag LOCUS_85260 CDS complement(61126..62328) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227362.1 transl_table 11 codon_start 1 locus_tag LOCUS_85270 CDS complement(62341..62784) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 transl_table 11 codon_start 1 locus_tag LOCUS_85280 CDS complement(62876..63445) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 transl_table 11 codon_start 1 locus_tag LOCUS_85290 CDS complement(63551..65125) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_85300 CDS 65217..66485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85310 CDS 66491..67225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85320 CDS complement(67222..68019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85330 CDS complement(68161..68580) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 transl_table 11 codon_start 1 locus_tag LOCUS_85340 CDS complement(68863..70029) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 transl_table 11 codon_start 1 locus_tag LOCUS_85350 CDS complement(70026..70955) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 transl_table 11 codon_start 1 locus_tag LOCUS_85360 CDS complement(70958..71863) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 transl_table 11 codon_start 1 locus_tag LOCUS_85370 CDS complement(71910..73313) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 transl_table 11 codon_start 1 locus_tag LOCUS_85380 CDS complement(73417..74394) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 transl_table 11 codon_start 1 locus_tag LOCUS_85390 CDS 74487..75554 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 transl_table 11 codon_start 1 locus_tag LOCUS_85400 CDS 75551..76363 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 transl_table 11 codon_start 1 locus_tag LOCUS_85410 CDS 76360..77673 product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223432.1 transl_table 11 codon_start 1 locus_tag LOCUS_85420 CDS complement(77807..80578) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 transl_table 11 codon_start 1 locus_tag LOCUS_85430 CDS 80722..81276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85440 CDS 81276..82265 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112900.1 transl_table 11 codon_start 1 locus_tag LOCUS_85450 CDS complement(82243..82794) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095318.1 transl_table 11 codon_start 1 locus_tag LOCUS_85460 CDS complement(82791..84158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85470 CDS 84249..84446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85480 CDS complement(84419..85504) product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090354.1 transl_table 11 codon_start 1 locus_tag LOCUS_85490 gene pqsH CDS complement(85501..85707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85500 CDS complement(85707..86045) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228573.1 transl_table 11 codon_start 1 locus_tag LOCUS_85510 CDS complement(86106..86720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85520 CDS complement(86829..88466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85530 CDS 88693..89427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85540 CDS 89532..91976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85550 CDS complement(91993..92319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85560 CDS complement(92520..93881) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 transl_table 11 codon_start 1 locus_tag LOCUS_85570 CDS complement(93956..94900) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015385292.1 transl_table 11 codon_start 1 locus_tag LOCUS_85580 CDS complement(94897..96441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85590 CDS 96698..97633 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_85600 CDS complement(97587..100451) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_85610 CDS complement(100589..101125) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 transl_table 11 codon_start 1 locus_tag LOCUS_85620 CDS 101689..102498 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 transl_table 11 codon_start 1 locus_tag LOCUS_85630 CDS complement(102583..103215) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 transl_table 11 codon_start 1 locus_tag LOCUS_85640 CDS complement(103310..106114) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_85650 CDS 106335..106526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85660 CDS complement(106573..107097) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 transl_table 11 codon_start 1 locus_tag LOCUS_85670 CDS complement(107192..107731) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 transl_table 11 codon_start 1 locus_tag LOCUS_85680 CDS complement(108016..108816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85690 CDS 109015..110904 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 transl_table 11 codon_start 1 locus_tag LOCUS_85700 CDS 110938..111285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85710 CDS 111282..113957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85720 CDS 113966..116188 product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930065.1 transl_table 11 codon_start 1 locus_tag LOCUS_85730 CDS 116185..118860 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 transl_table 11 codon_start 1 locus_tag LOCUS_85740 CDS 118864..120492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85750 CDS complement(121309..121812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85760 CDS 121892..122458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85770 CDS 122539..122958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 transl_table 11 codon_start 1 locus_tag LOCUS_85780 CDS 122962..123186 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 transl_table 11 codon_start 1 locus_tag LOCUS_85790 CDS 123498..123920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85800 CDS 124706..126715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85810 CDS complement(126696..127607) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 transl_table 11 codon_start 1 locus_tag LOCUS_85820 CDS complement(127664..127933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85830 CDS complement(128229..128624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85840 CDS complement(128708..129199) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 transl_table 11 codon_start 1 locus_tag LOCUS_85850 CDS 129284..129859 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035107705.1 transl_table 11 codon_start 1 locus_tag LOCUS_85860 tRNA complement(130473..130566) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 CDS 130783..131907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85870 CDS 131944..133191 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224782.1 transl_table 11 codon_start 1 locus_tag LOCUS_85880 CDS 133200..133688 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832408.1 transl_table 11 codon_start 1 locus_tag LOCUS_85890 CDS complement(134022..135077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85900 CDS complement(135144..135737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85910 CDS 135877..136089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85920 CDS 136153..137043 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 transl_table 11 codon_start 1 locus_tag LOCUS_85930 CDS 137106..137393 product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225328.1 transl_table 11 codon_start 1 locus_tag LOCUS_85940 CDS complement(137398..138081) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225799.1 transl_table 11 codon_start 1 locus_tag LOCUS_85950 CDS 138179..139135 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225800.1 transl_table 11 codon_start 1 locus_tag LOCUS_85960 CDS complement(139266..139661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85970 CDS complement(139680..141710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85980 CDS complement(142062..143726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_85990 CDS 143703..143978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86000 CDS 144030..144767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972573.1 transl_table 11 codon_start 1 locus_tag LOCUS_86010 CDS complement(144671..144880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86020 CDS complement(145002..145379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86030 CDS complement(145434..147635) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 transl_table 11 codon_start 1 locus_tag LOCUS_86040 CDS complement(147691..148425) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224951.1 transl_table 11 codon_start 1 locus_tag LOCUS_86050 CDS complement(148422..149282) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389975.1 transl_table 11 codon_start 1 locus_tag LOCUS_86060 CDS complement(149299..150156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86070 CDS 150233..151948 product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 transl_table 11 codon_start 1 locus_tag LOCUS_86080 CDS complement(151945..153414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86090 CDS 153534..154370 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_86100 CDS complement(154394..155737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86110 CDS complement(155754..157499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86120 CDS complement(157797..158180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86130 CDS complement(158491..160584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86140 CDS complement(161001..161594) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 transl_table 11 codon_start 1 locus_tag LOCUS_86150 CDS complement(161591..162550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86160 CDS complement(162628..163383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86170 CDS complement(163377..164525) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_86180 gene dgoD CDS complement(164506..165228) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 transl_table 11 codon_start 1 locus_tag LOCUS_86190 CDS complement(165254..166003) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 transl_table 11 codon_start 1 locus_tag LOCUS_86200 CDS 166105..167382 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 transl_table 11 codon_start 1 locus_tag LOCUS_86210 CDS 167454..168293 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 transl_table 11 codon_start 1 locus_tag LOCUS_86220 CDS 168293..169171 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 transl_table 11 codon_start 1 locus_tag LOCUS_86230 CDS 169327..170532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86240 CDS 170535..172517 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111257634.1 transl_table 11 codon_start 1 locus_tag LOCUS_86250 CDS 172514..173428 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 transl_table 11 codon_start 1 locus_tag LOCUS_86260 CDS 173456..173704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86270 CDS 173698..174015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86280 CDS complement(174016..174807) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 transl_table 11 codon_start 1 locus_tag LOCUS_86290 CDS 174904..175362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86300 CDS 175442..176515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86310 CDS 176543..177055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86320 CDS 177171..177404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86330 CDS 177657..178103 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 transl_table 11 codon_start 1 locus_tag LOCUS_86340 CDS complement(178085..179356) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 transl_table 11 codon_start 1 locus_tag LOCUS_86350 CDS complement(179422..180114) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803868.1 transl_table 11 codon_start 1 locus_tag LOCUS_86360 CDS complement(180159..180335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86370 CDS complement(180366..180827) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 transl_table 11 codon_start 1 locus_tag LOCUS_86380 CDS complement(180824..181375) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 transl_table 11 codon_start 1 locus_tag LOCUS_86390 CDS 181437..182369 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 transl_table 11 codon_start 1 locus_tag LOCUS_86400 CDS complement(182356..185373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 transl_table 11 codon_start 1 locus_tag LOCUS_86410 CDS 185523..186260 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 transl_table 11 codon_start 1 locus_tag LOCUS_86420 CDS complement(186270..186884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86430 CDS complement(186909..187778) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 transl_table 11 codon_start 1 locus_tag LOCUS_86440 CDS complement(187859..188443) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044576605.1 transl_table 11 codon_start 1 locus_tag LOCUS_86450 CDS complement(188459..188794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86460 CDS 188750..189283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86470 CDS complement(189325..189846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86480 CDS complement(189824..189991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86490 CDS 190117..191322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86500 CDS 191349..191513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86510 CDS 191554..191883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86520 CDS 192266..192778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86530 CDS complement(192775..193458) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 transl_table 11 codon_start 1 locus_tag LOCUS_86540 CDS complement(193455..194978) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 transl_table 11 codon_start 1 locus_tag LOCUS_86550 CDS 195059..196417 product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 transl_table 11 codon_start 1 locus_tag LOCUS_86560 CDS 196503..198326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86570 CDS complement(198374..199120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86580 CDS 199358..199804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86590 CDS complement(199950..201284) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030223.1 transl_table 11 codon_start 1 locus_tag LOCUS_86600 CDS 201355..201555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86610 CDS complement(201642..205115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86620 CDS 205189..207186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86630 CDS 207418..207540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86640 CDS complement(207587..207874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86650 CDS 208160..208321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86660 CDS 208318..208968 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468046.1 transl_table 11 codon_start 1 locus_tag LOCUS_86670 CDS 209046..209843 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090346754.1 transl_table 11 codon_start 1 locus_tag LOCUS_86680 CDS 209874..210689 product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 transl_table 11 codon_start 1 locus_tag LOCUS_86690 gene cdtA CDS 210717..211712 product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 transl_table 11 codon_start 1 locus_tag LOCUS_86700 gene cdtB CDS 211720..213828 product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 transl_table 11 codon_start 1 locus_tag LOCUS_86710 gene cdtC CDS 214080..215018 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 transl_table 11 codon_start 1 locus_tag LOCUS_86720 CDS 215079..215321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86730 CDS 215363..216142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86740 CDS 216144..218864 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_86750 CDS 219067..220539 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 transl_table 11 codon_start 1 locus_tag LOCUS_86760 CDS complement(220778..221386) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888554.1 transl_table 11 codon_start 1 locus_tag LOCUS_86770 CDS 221695..222126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86780 CDS 222123..222992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86790 CDS 223104..223640 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_86800 CDS 223637..224272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86810 CDS complement(224437..224982) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227354.1 transl_table 11 codon_start 1 locus_tag LOCUS_86820 CDS 225104..225544 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 transl_table 11 codon_start 1 locus_tag LOCUS_86830 CDS complement(225866..226888) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 transl_table 11 codon_start 1 locus_tag LOCUS_86840 CDS 227073..228068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978628.1 transl_table 11 codon_start 1 locus_tag LOCUS_86850 CDS complement(228178..229245) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 transl_table 11 codon_start 1 locus_tag LOCUS_86860 CDS 229181..229426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86870 CDS 229564..230556 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 transl_table 11 codon_start 1 locus_tag LOCUS_86880 CDS 230618..232138 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 transl_table 11 codon_start 1 locus_tag LOCUS_86890 CDS 232135..233151 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 transl_table 11 codon_start 1 locus_tag LOCUS_86900 CDS 233148..234167 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 transl_table 11 codon_start 1 locus_tag LOCUS_86910 gene yjfF CDS 234170..235825 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 transl_table 11 codon_start 1 locus_tag LOCUS_86920 gene araB CDS 235822..236517 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 transl_table 11 codon_start 1 locus_tag LOCUS_86930 CDS 236510..237991 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 transl_table 11 codon_start 1 locus_tag LOCUS_86940 gene araA CDS complement(238123..238968) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 transl_table 11 codon_start 1 locus_tag LOCUS_86950 CDS complement(239234..239608) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 transl_table 11 codon_start 1 locus_tag LOCUS_86960 CDS 239713..240195 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 transl_table 11 codon_start 1 locus_tag LOCUS_86970 CDS 240715..241188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86980 CDS 241266..241904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_86990 CDS complement(241897..242592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87000 CDS complement(242809..244365) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 transl_table 11 codon_start 1 locus_tag LOCUS_87010 CDS complement(244369..245592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87020 CDS 245716..247380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87030 CDS 247475..248428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87040 CDS 248382..248702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87050 CDS 248699..249418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87060 CDS complement(249415..249660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87070 CDS complement(249570..250187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87080 CDS complement(250326..251456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87090 CDS 251613..252305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87100 CDS complement(252394..253401) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639357.1 transl_table 11 codon_start 1 locus_tag LOCUS_87110 CDS complement(253544..254065) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729010.1 transl_table 11 codon_start 1 locus_tag LOCUS_87120 CDS 254412..254834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87130 CDS complement(254720..255721) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 transl_table 11 codon_start 1 locus_tag LOCUS_87140 CDS complement(255864..256454) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 transl_table 11 codon_start 1 locus_tag LOCUS_87150 CDS 256555..257943 product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 transl_table 11 codon_start 1 locus_tag LOCUS_87160 CDS complement(258142..258378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87170 CDS 258463..259863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87180 CDS 259939..260520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87190 CDS complement(260648..261820) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 transl_table 11 codon_start 1 locus_tag LOCUS_87200 CDS 261978..264053 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 transl_table 11 codon_start 1 locus_tag LOCUS_87210 CDS 264050..264976 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 transl_table 11 codon_start 1 locus_tag LOCUS_87220 CDS 264973..265860 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 transl_table 11 codon_start 1 locus_tag LOCUS_87230 CDS 265885..267204 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 transl_table 11 codon_start 1 locus_tag LOCUS_87240 CDS 267211..269289 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185048585.1 transl_table 11 codon_start 1 locus_tag LOCUS_87250 CDS 269477..270082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87260 CDS complement(269988..272240) product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 transl_table 11 codon_start 1 locus_tag LOCUS_87270 gene catB CDS 272444..273217 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 transl_table 11 codon_start 1 locus_tag LOCUS_87280 gene aat CDS complement(273208..274248) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 transl_table 11 codon_start 1 locus_tag LOCUS_87290 CDS 274383..275609 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_87300 CDS 275617..276504 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_87310 CDS 276488..277699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87320 CDS 277791..278519 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381484.1 transl_table 11 codon_start 1 locus_tag LOCUS_87330 gene livG CDS 278509..279252 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 transl_table 11 codon_start 1 locus_tag LOCUS_87340 CDS 279458..280378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87350 CDS 280387..282456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87360 CDS complement(282616..283275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87370 CDS 283581..284885 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079826.1 transl_table 11 codon_start 1 locus_tag LOCUS_87380 CDS 285089..286498 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749132.1 transl_table 11 codon_start 1 locus_tag LOCUS_87390 CDS complement(286596..288248) product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730751.1 transl_table 11 codon_start 1 locus_tag LOCUS_87400 CDS complement(288471..289232) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_87410 CDS complement(289277..290551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87420 CDS complement(290548..291240) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 transl_table 11 codon_start 1 locus_tag LOCUS_87430 CDS complement(291237..292232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87440 CDS 292419..294005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87450 CDS complement(294044..295006) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582817.1 transl_table 11 codon_start 1 locus_tag LOCUS_87460 CDS complement(295331..296875) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 transl_table 11 codon_start 1 locus_tag LOCUS_87470 CDS 296974..297360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87480 CDS complement(297365..298012) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_87490 CDS 298097..301021 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_87500 CDS 301103..301243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87510 CDS 301309..307395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87520 CDS complement(307408..309405) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173038923.1 transl_table 11 codon_start 1 locus_tag LOCUS_87530 CDS 309404..310300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87540 CDS complement(310276..312189) product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 transl_table 11 codon_start 1 locus_tag LOCUS_87550 CDS complement(312267..312872) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_87560 CDS complement(312869..314068) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 transl_table 11 codon_start 1 locus_tag LOCUS_87570 CDS complement(314095..314535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87580 note possible pseudo, internal stop codon CDS 314560..314964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87590 CDS 315022..315297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87600 CDS 315368..316189 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_87610 CDS complement(316349..316900) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 transl_table 11 codon_start 1 locus_tag LOCUS_87620 CDS complement(316910..317116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87630 CDS 317028..317942 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 transl_table 11 codon_start 1 locus_tag LOCUS_87640 CDS complement(317970..318632) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223971.1 transl_table 11 codon_start 1 locus_tag LOCUS_87650 CDS complement(318623..320437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87660 CDS 320405..321223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87670 CDS complement(321224..322366) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 transl_table 11 codon_start 1 locus_tag LOCUS_87680 CDS 322449..323117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87690 CDS 323307..323618 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 transl_table 11 codon_start 1 locus_tag LOCUS_87700 CDS complement(323689..323934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87710 CDS complement(324110..325864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87720 CDS complement(325924..326310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87730 CDS complement(326375..327667) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 transl_table 11 codon_start 1 locus_tag LOCUS_87740 CDS 328009..328611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87750 CDS 328599..328889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87760 CDS complement(328968..329135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87770 CDS 329548..330123 product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973073.1 transl_table 11 codon_start 1 locus_tag LOCUS_87780 CDS 330320..330706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87790 CDS 330643..330900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87800 CDS complement(330957..331415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87810 CDS complement(331412..332956) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 transl_table 11 codon_start 1 locus_tag LOCUS_87820 CDS complement(332953..334068) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 transl_table 11 codon_start 1 locus_tag LOCUS_87830 CDS complement(334105..334776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87840 CDS 334930..336345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 transl_table 11 codon_start 1 locus_tag LOCUS_87850 CDS complement(336347..339433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 transl_table 11 codon_start 1 locus_tag LOCUS_87860 CDS complement(339478..340149) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031806.1 transl_table 11 codon_start 1 locus_tag LOCUS_87870 CDS 340254..340892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87880 CDS complement(340795..341502) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_87890 CDS complement(341495..342655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87900 CDS 342748..343419 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 transl_table 11 codon_start 1 locus_tag LOCUS_87910 CDS 343416..344372 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 transl_table 11 codon_start 1 locus_tag LOCUS_87920 CDS 344470..344667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87930 CDS 344738..345445 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 transl_table 11 codon_start 1 locus_tag LOCUS_87940 CDS complement(345397..346170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_87950 CDS complement(346253..347017) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852896.1 transl_table 11 codon_start 1 locus_tag LOCUS_87960 CDS complement(347052..348044) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 transl_table 11 codon_start 1 locus_tag LOCUS_87970 CDS 348243..349499 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 transl_table 11 codon_start 1 locus_tag LOCUS_87980 CDS 349508..350461 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 transl_table 11 codon_start 1 locus_tag LOCUS_87990 CDS 350458..351288 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 transl_table 11 codon_start 1 locus_tag LOCUS_88000 sequence099 source 1..3096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1331..1555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88010 sequence100 source 1..2349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence101 source 1..2317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88020 CDS 840..1010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88030 CDS 2001..2171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88040 sequence102 source 1..2313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88050 CDS complement(942..2186) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110092.1 transl_table 11 codon_start 1 locus_tag LOCUS_88060 gene ugpC sequence103 source 1..1822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..626 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206973.1:SulP family inorganic anion transporter locus_tag LOCUS_88070 CDS complement(909..1418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88080 sequence104 source 1..1770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..1739 product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 transl_table 11 codon_start 1 locus_tag LOCUS_88090 sequence105 source 1..1585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1077..1457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88100 sequence106 source 1..1513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1486 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728499.1 transl_table 11 codon_start 1 locus_tag LOCUS_88110 sequence107 source 1..1391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence108 source 1..343020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(428..3067) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 transl_table 11 codon_start 1 locus_tag LOCUS_88120 CDS complement(3064..7740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88130 CDS complement(7770..8219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88140 CDS complement(8216..8557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88150 CDS 8673..9449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88160 CDS complement(9482..9799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88170 CDS complement(10249..11628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88180 CDS complement(11610..11930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88190 CDS complement(11946..12278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88200 CDS complement(12357..23228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88210 CDS complement(23239..27246) product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 transl_table 11 codon_start 1 locus_tag LOCUS_88220 CDS complement(27373..28002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88230 CDS 28248..29186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88240 CDS 29382..30047 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939097.1 transl_table 11 codon_start 1 locus_tag LOCUS_88250 CDS complement(30239..30889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256632.1 transl_table 11 codon_start 1 locus_tag LOCUS_88260 CDS complement(30886..32292) product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392113.1 transl_table 11 codon_start 1 locus_tag LOCUS_88270 CDS complement(32563..33144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88280 CDS complement(33370..34536) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 transl_table 11 codon_start 1 locus_tag LOCUS_88290 CDS 34943..36304 product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 transl_table 11 codon_start 1 locus_tag LOCUS_88300 CDS 36337..36912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88310 CDS complement(36990..37913) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 transl_table 11 codon_start 1 locus_tag LOCUS_88320 CDS complement(37980..38393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88330 CDS complement(38552..39217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88340 CDS complement(39422..40864) product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681425.1 transl_table 11 codon_start 1 locus_tag LOCUS_88350 CDS complement(41482..41709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88360 CDS complement(41897..42292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88370 note possible pseudo, frameshifted CDS complement(42373..42717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88380 note possible pseudo, frameshifted CDS 42858..43076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88390 CDS complement(44365..44811) product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 transl_table 11 codon_start 1 locus_tag LOCUS_88400 CDS complement(44808..46289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88410 CDS complement(46948..47592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88420 note possible pseudo, internal stop codon, frameshifted CDS complement(47809..48285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88430 CDS complement(49405..49620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88440 CDS 49519..51846 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_88450 note possible pseudo, frameshifted CDS 52062..53087 product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 transl_table 11 codon_start 1 locus_tag LOCUS_88460 CDS complement(53419..54465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88470 note possible pseudo, internal stop codon, frameshifted CDS complement(54493..54804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88480 note possible pseudo, internal stop codon CDS complement(54954..55079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88490 CDS complement(55604..56815) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766116.1 transl_table 11 codon_start 1 locus_tag LOCUS_88500 CDS 56920..57273 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 transl_table 11 codon_start 1 locus_tag LOCUS_88510 CDS 57655..58203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88520 CDS 58517..59653 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 transl_table 11 codon_start 1 locus_tag LOCUS_88530 CDS complement(59792..60667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88540 CDS 61211..61522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88550 CDS 61550..62131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88560 CDS 62360..63145 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 transl_table 11 codon_start 1 locus_tag LOCUS_88570 CDS 63486..63671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88580 CDS 63683..64369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88590 CDS complement(65137..65910) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 transl_table 11 codon_start 1 locus_tag LOCUS_88600 CDS complement(65907..66560) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729968.1 transl_table 11 codon_start 1 locus_tag LOCUS_88610 CDS complement(66535..67248) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972574.1 transl_table 11 codon_start 1 locus_tag LOCUS_88620 CDS 67735..68484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88630 note possible pseudo, frameshifted CDS 68430..69065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88640 note possible pseudo, frameshifted CDS 69473..70186 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 transl_table 11 codon_start 1 locus_tag LOCUS_88650 CDS complement(70292..71374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88660 CDS complement(71575..71865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88670 CDS 71875..72084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88680 CDS complement(72220..72789) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729010.1 transl_table 11 codon_start 1 locus_tag LOCUS_88690 CDS 72892..73776 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 transl_table 11 codon_start 1 locus_tag LOCUS_88700 CDS 74043..74774 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 transl_table 11 codon_start 1 locus_tag LOCUS_88710 CDS 75209..75373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88720 CDS 75418..77340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88730 CDS 77384..78403 product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 transl_table 11 codon_start 1 locus_tag LOCUS_88740 CDS complement(78534..79478) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 transl_table 11 codon_start 1 locus_tag LOCUS_88750 CDS 79684..79881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88760 CDS complement(79969..81057) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_88770 CDS 81281..81499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88780 note possible pseudo, frameshifted CDS 81714..81911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88790 CDS 82345..83412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88800 CDS complement(83843..85366) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947833.1 transl_table 11 codon_start 1 locus_tag LOCUS_88810 CDS 85436..86080 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079956.1 transl_table 11 codon_start 1 locus_tag LOCUS_88820 CDS complement(86073..86195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88830 note possible pseudo, internal stop codon, frameshifted CDS 86202..86420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88840 CDS 86390..86950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88850 CDS complement(87828..88178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88860 CDS complement(88529..88723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88870 CDS complement(88860..89753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88880 CDS complement(89746..89964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88890 tRNA complement(90145..90230) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS 90405..91538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88900 CDS 91693..94302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88910 CDS 94312..95301 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 transl_table 11 codon_start 1 locus_tag LOCUS_88920 CDS 95298..96611 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 transl_table 11 codon_start 1 locus_tag LOCUS_88930 CDS 96605..98740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88940 CDS complement(98737..99516) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970034.1 transl_table 11 codon_start 1 locus_tag LOCUS_88950 CDS 99615..100604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88960 CDS 100686..101603 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 transl_table 11 codon_start 1 locus_tag LOCUS_88970 CDS 102074..102283 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421425.1 transl_table 11 codon_start 1 locus_tag LOCUS_88980 CDS complement(102309..103085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_88990 CDS complement(103250..103519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89000 CDS 103709..104029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89010 CDS 104229..104588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89020 CDS complement(104628..104819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89030 CDS complement(104828..105550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495146.1 transl_table 11 codon_start 1 locus_tag LOCUS_89040 note possible pseudo, frameshifted CDS 106010..107542 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229994.1 transl_table 11 codon_start 1 locus_tag LOCUS_89050 CDS 107597..109780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89060 CDS complement(109858..110772) product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 transl_table 11 codon_start 1 locus_tag LOCUS_89070 CDS complement(110969..111706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225445.1 transl_table 11 codon_start 1 locus_tag LOCUS_89080 CDS complement(111851..112540) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 transl_table 11 codon_start 1 locus_tag LOCUS_89090 CDS 112639..113412 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_89100 CDS complement(113416..114249) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 transl_table 11 codon_start 1 locus_tag LOCUS_89110 CDS 114199..115035 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227428.1 transl_table 11 codon_start 1 locus_tag LOCUS_89120 CDS complement(115089..115541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89130 note possible pseudo, frameshifted CDS 115790..117031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89140 CDS 117149..117736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 transl_table 11 codon_start 1 locus_tag LOCUS_89150 CDS 117733..119004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89160 CDS complement(118980..120356) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031786.1 transl_table 11 codon_start 1 locus_tag LOCUS_89170 CDS complement(120738..121094) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978264.1 transl_table 11 codon_start 1 locus_tag LOCUS_89180 CDS 121297..121434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89190 CDS complement(121418..122257) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 transl_table 11 codon_start 1 locus_tag LOCUS_89200 CDS complement(122254..123573) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 transl_table 11 codon_start 1 locus_tag LOCUS_89210 CDS complement(123593..124303) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227458.1 transl_table 11 codon_start 1 locus_tag LOCUS_89220 CDS complement(124300..125772) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_89230 CDS 125903..126520 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970387.1 transl_table 11 codon_start 1 locus_tag LOCUS_89240 CDS 126548..127315 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 transl_table 11 codon_start 1 locus_tag LOCUS_89250 CDS 127579..128343 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968478.1 transl_table 11 codon_start 1 locus_tag LOCUS_89260 CDS complement(128540..131158) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_89270 CDS complement(131560..132207) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 transl_table 11 codon_start 1 locus_tag LOCUS_89280 gene lexA CDS complement(132208..132501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89290 CDS 132455..132679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89300 CDS 132846..134153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112672.1 transl_table 11 codon_start 1 locus_tag LOCUS_89310 CDS 134150..139033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89320 CDS 139035..139490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89330 CDS 139617..140009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89340 CDS complement(140101..140391) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217738.1 transl_table 11 codon_start 1 locus_tag LOCUS_89350 CDS complement(140473..140775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89360 CDS 141096..141836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89370 CDS complement(142008..143006) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 transl_table 11 codon_start 1 locus_tag LOCUS_89380 CDS 143132..143980 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_89390 CDS 143993..144712 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 transl_table 11 codon_start 1 locus_tag LOCUS_89400 CDS complement(145172..145540) product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 transl_table 11 codon_start 1 locus_tag LOCUS_89410 gene mazF9 CDS complement(145537..145743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89420 CDS complement(146010..149198) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230032.1 transl_table 11 codon_start 1 locus_tag LOCUS_89430 CDS complement(149212..149835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89440 CDS 150132..150452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89450 CDS 150465..154472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89460 CDS complement(154477..155397) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 transl_table 11 codon_start 1 locus_tag LOCUS_89470 CDS complement(155427..156047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89480 CDS complement(156188..157945) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 transl_table 11 codon_start 1 locus_tag LOCUS_89490 CDS 158060..158296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226168.1 transl_table 11 codon_start 1 locus_tag LOCUS_89500 CDS 158366..160018 product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226169.1 transl_table 11 codon_start 1 locus_tag LOCUS_89510 CDS 160023..161066 product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 transl_table 11 codon_start 1 locus_tag LOCUS_89520 CDS 161066..162235 product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226171.1 transl_table 11 codon_start 1 locus_tag LOCUS_89530 CDS 162232..162621 product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226172.1 transl_table 11 codon_start 1 locus_tag LOCUS_89540 CDS 162614..163684 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226173.1 transl_table 11 codon_start 1 locus_tag LOCUS_89550 CDS 163681..164367 product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226174.1 transl_table 11 codon_start 1 locus_tag LOCUS_89560 CDS 164424..166118 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226176.1 transl_table 11 codon_start 1 locus_tag LOCUS_89570 gene groL CDS 166125..167468 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 transl_table 11 codon_start 1 locus_tag LOCUS_89580 CDS 167577..169466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89590 CDS complement(169521..169736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89600 CDS complement(169817..170827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89610 CDS complement(170860..171741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89620 CDS complement(171749..172633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89630 CDS complement(172635..174146) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 transl_table 11 codon_start 1 locus_tag LOCUS_89640 CDS complement(174578..175366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89650 CDS 175510..178278 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031451.1 transl_table 11 codon_start 1 locus_tag LOCUS_89660 CDS complement(178297..178635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89670 CDS 179028..179828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89680 CDS complement(179795..180355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89690 CDS complement(180352..181740) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 transl_table 11 codon_start 1 locus_tag LOCUS_89700 CDS complement(181750..182595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89710 CDS 182685..183692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486834.1 transl_table 11 codon_start 1 locus_tag LOCUS_89720 CDS complement(184214..184810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89730 note possible pseudo, frameshifted CDS complement(186024..187988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89740 CDS complement(188046..189116) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 transl_table 11 codon_start 1 locus_tag LOCUS_89750 CDS complement(189272..189754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89760 CDS complement(190814..191980) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 transl_table 11 codon_start 1 locus_tag LOCUS_89770 CDS complement(192020..192964) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 transl_table 11 codon_start 1 locus_tag LOCUS_89780 CDS complement(192955..194235) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 transl_table 11 codon_start 1 locus_tag LOCUS_89790 CDS complement(194320..198717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89800 CDS 198851..201391 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_89810 CDS 201384..204143 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_89820 CDS 204218..205033 product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_89830 CDS complement(205015..206349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89840 CDS 206575..207351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89850 CDS complement(207329..207592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89860 CDS complement(207692..210085) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_89870 CDS 210291..212936 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 transl_table 11 codon_start 1 locus_tag LOCUS_89880 CDS 212945..213340 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975062.1 transl_table 11 codon_start 1 locus_tag LOCUS_89890 CDS 213343..215910 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 transl_table 11 codon_start 1 locus_tag LOCUS_89900 CDS complement(216193..216561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_89910 CDS 216615..217274 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 transl_table 11 codon_start 1 locus_tag LOCUS_89920 CDS complement(217253..217978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89930 CDS 218047..218310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89940 CDS complement(218312..218509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89950 CDS 218737..219210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89960 CDS complement(219279..220646) product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 transl_table 11 codon_start 1 locus_tag LOCUS_89970 CDS complement(220771..221427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89980 CDS complement(221412..221657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_89990 CDS 221560..222225 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193046641.1 transl_table 11 codon_start 1 locus_tag LOCUS_90000 CDS complement(222222..223211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90010 CDS complement(223223..223972) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031845.1 transl_table 11 codon_start 1 locus_tag LOCUS_90020 CDS complement(224001..224828) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028225.1 transl_table 11 codon_start 1 locus_tag LOCUS_90030 CDS complement(225047..225481) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 transl_table 11 codon_start 1 locus_tag LOCUS_90040 CDS 225572..226165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90050 CDS complement(226162..227346) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 transl_table 11 codon_start 1 locus_tag LOCUS_90060 CDS 227424..228362 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389676.1 transl_table 11 codon_start 1 locus_tag LOCUS_90070 CDS 228410..229306 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275382.1 transl_table 11 codon_start 1 locus_tag LOCUS_90080 CDS 229300..230022 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275383.1 transl_table 11 codon_start 1 locus_tag LOCUS_90090 CDS 230019..230627 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268145.1 transl_table 11 codon_start 1 locus_tag LOCUS_90100 CDS 230624..231289 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727406.1 transl_table 11 codon_start 1 locus_tag LOCUS_90110 CDS complement(231293..231655) product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727919.1 transl_table 11 codon_start 1 locus_tag LOCUS_90120 CDS 231730..232017 product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 transl_table 11 codon_start 1 locus_tag LOCUS_90130 CDS complement(232010..232546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90140 CDS complement(232521..232730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90150 tRNA complement(232845..232916) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(232941..233014) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(233033..233106) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(233107..233185) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA complement(233187..233260) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(233262..233338) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(233344..233417) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(233435..233508) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(233513..233585) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(233599..233672) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA complement(233678..233751) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA complement(233754..233827) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA complement(233910..233982) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 CDS 234856..235281 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894320.1 transl_table 11 codon_start 1 locus_tag LOCUS_90160 CDS 235278..236030 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 transl_table 11 codon_start 1 locus_tag LOCUS_90170 gene fabG CDS 236109..237485 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729120.1 transl_table 11 codon_start 1 locus_tag LOCUS_90180 CDS complement(237462..238616) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 transl_table 11 codon_start 1 locus_tag LOCUS_90190 CDS 238728..239441 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031453.1 transl_table 11 codon_start 1 locus_tag LOCUS_90200 CDS 239453..240223 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_90210 CDS 240235..240987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90220 CDS complement(241025..241204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90230 CDS 241341..242690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90240 CDS complement(242772..244955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90250 CDS complement(244933..245793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90260 CDS 246114..246284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90270 CDS complement(246335..247273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90280 CDS 248068..249129 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742181.1 transl_table 11 codon_start 1 locus_tag LOCUS_90290 CDS 249126..249776 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 transl_table 11 codon_start 1 locus_tag LOCUS_90300 CDS complement(249780..250025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90310 CDS 250082..251179 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304720.1 transl_table 11 codon_start 1 locus_tag LOCUS_90320 CDS 251212..252540 product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921728.1 transl_table 11 codon_start 1 locus_tag LOCUS_90330 CDS 252622..254973 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 transl_table 11 codon_start 1 locus_tag LOCUS_90340 CDS 254980..255963 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256284.1 transl_table 11 codon_start 1 locus_tag LOCUS_90350 CDS 256026..256640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90360 CDS complement(256573..257151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90370 CDS 257105..257449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90380 CDS 258061..258618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90390 CDS 258620..259348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90400 CDS 259345..259824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90410 CDS complement(260022..261245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90420 CDS complement(261327..264017) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 transl_table 11 codon_start 1 locus_tag LOCUS_90430 CDS complement(264014..266494) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 transl_table 11 codon_start 1 locus_tag LOCUS_90440 CDS 266641..268629 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 transl_table 11 codon_start 1 locus_tag LOCUS_90450 CDS complement(268632..269051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90460 CDS 269271..270092 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037318.1 transl_table 11 codon_start 1 locus_tag LOCUS_90470 CDS complement(270127..270477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90480 CDS complement(270474..271070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90490 CDS complement(271183..271404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90500 CDS 271339..275160 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 transl_table 11 codon_start 1 locus_tag LOCUS_90510 CDS complement(275157..276569) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 transl_table 11 codon_start 1 locus_tag LOCUS_90520 CDS complement(276626..278572) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296490.1 transl_table 11 codon_start 1 locus_tag LOCUS_90530 gene asnB CDS 278714..279397 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_90540 CDS 279394..281136 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225399.1 transl_table 11 codon_start 1 locus_tag LOCUS_90550 CDS 281433..284240 product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 transl_table 11 codon_start 1 locus_tag LOCUS_90560 CDS 284311..286017 product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 transl_table 11 codon_start 1 locus_tag LOCUS_90570 CDS 286103..287203 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 transl_table 11 codon_start 1 locus_tag LOCUS_90580 CDS 287190..288029 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 transl_table 11 codon_start 1 locus_tag LOCUS_90590 CDS 288026..288853 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 transl_table 11 codon_start 1 locus_tag LOCUS_90600 CDS 288837..289391 product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028850.1 transl_table 11 codon_start 1 locus_tag LOCUS_90610 CDS 289391..290239 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 transl_table 11 codon_start 1 locus_tag LOCUS_90620 CDS 290239..291348 product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 transl_table 11 codon_start 1 locus_tag LOCUS_90630 gene eboE CDS 291345..292715 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 transl_table 11 codon_start 1 locus_tag LOCUS_90640 CDS 292712..293782 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 transl_table 11 codon_start 1 locus_tag LOCUS_90650 CDS 293891..294868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90660 CDS 294878..295843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90670 CDS complement(296073..297641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90680 CDS complement(297691..299970) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203814707.1 transl_table 11 codon_start 1 locus_tag LOCUS_90690 CDS complement(300021..300908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90700 CDS complement(300905..301258) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 transl_table 11 codon_start 1 locus_tag LOCUS_90710 CDS 301499..303277 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 transl_table 11 codon_start 1 locus_tag LOCUS_90720 CDS complement(303339..306899) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 transl_table 11 codon_start 1 locus_tag LOCUS_90730 CDS complement(307014..307487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90740 CDS complement(307584..307745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90750 CDS complement(307814..308374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90760 CDS complement(308466..309365) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862198.1 transl_table 11 codon_start 1 locus_tag LOCUS_90770 CDS complement(309434..309730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90780 CDS complement(309703..310038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90790 CDS complement(310049..311485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90800 CDS complement(311476..311700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90810 CDS complement(311937..312311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90820 CDS 312516..312746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90830 CDS 313154..314968 product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 transl_table 11 codon_start 1 locus_tag LOCUS_90840 gene phzE CDS complement(315030..316493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90850 CDS 316492..317841 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_90860 CDS 317829..318515 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_90870 CDS 318601..319179 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 transl_table 11 codon_start 1 locus_tag LOCUS_90880 CDS 319244..319516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90890 CDS complement(319539..320417) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_90900 CDS complement(320442..321011) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 transl_table 11 codon_start 1 locus_tag LOCUS_90910 CDS complement(321037..321309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90920 CDS 321220..322371 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202991912.1 transl_table 11 codon_start 1 locus_tag LOCUS_90930 CDS complement(322352..325357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90940 CDS complement(325433..327088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90950 CDS 327165..328043 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 transl_table 11 codon_start 1 locus_tag LOCUS_90960 CDS 328040..328642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_90970 CDS 328726..329874 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 transl_table 11 codon_start 1 locus_tag LOCUS_90980 CDS 329871..330725 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 transl_table 11 codon_start 1 locus_tag LOCUS_90990 CDS complement(330712..331110) product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 transl_table 11 codon_start 1 locus_tag LOCUS_91000 CDS complement(331107..331937) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 transl_table 11 codon_start 1 locus_tag LOCUS_91010 CDS complement(332164..334761) product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 transl_table 11 codon_start 1 locus_tag LOCUS_91020 CDS complement(334855..337818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91030 CDS complement(338170..338556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91040 CDS complement(338722..339396) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 transl_table 11 codon_start 1 locus_tag LOCUS_91050 CDS complement(339393..340883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91060 CDS 341439..341945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91070 CDS 342026..342850 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 transl_table 11 codon_start 1 locus_tag LOCUS_91080 sequence109 source 1..1353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..1231) product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043791004.1 transl_table 11 codon_start 1 locus_tag LOCUS_91090 sequence110 source 1..1317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..370 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_91100 CDS 367..1287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91110 note possible pseudo, frameshifted sequence111 source 1..1308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(902..1180) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 transl_table 11 codon_start 1 locus_tag LOCUS_91120 sequence112 source 1..1190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91130 note possible pseudo, frameshifted CDS complement(552..911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91140 sequence113 source 1..1142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence114 source 1..1137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91150 sequence115 source 1..1084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence116 source 1..1071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence117 source 1..949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence118 source 1..932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence119 source 1..284630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91160 CDS complement(1019..1345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91170 CDS 1344..2027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91180 CDS 2137..2634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91190 CDS complement(2695..3699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227468.1 transl_table 11 codon_start 1 locus_tag LOCUS_91200 CDS complement(3759..5684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91210 CDS complement(5797..6558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91220 CDS 6637..7314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91230 CDS 7502..7711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91240 CDS 7796..8086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91250 CDS 8881..9621 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 transl_table 11 codon_start 1 locus_tag LOCUS_91260 CDS complement(9625..10410) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226234.1 transl_table 11 codon_start 1 locus_tag LOCUS_91270 CDS complement(10462..11385) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 transl_table 11 codon_start 1 locus_tag LOCUS_91280 CDS complement(11458..11709) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 transl_table 11 codon_start 1 locus_tag LOCUS_91290 CDS 11929..12702 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 transl_table 11 codon_start 1 locus_tag LOCUS_91300 CDS 12699..14327 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 transl_table 11 codon_start 1 locus_tag LOCUS_91310 CDS 14629..15222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91320 CDS complement(15215..15895) product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 transl_table 11 codon_start 1 locus_tag LOCUS_91330 CDS complement(15892..16569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91340 CDS 16662..17285 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 transl_table 11 codon_start 1 locus_tag LOCUS_91350 CDS complement(17404..18843) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405112.1 transl_table 11 codon_start 1 locus_tag LOCUS_91360 CDS complement(18991..20319) product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 transl_table 11 codon_start 1 locus_tag LOCUS_91370 CDS 20483..21121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91380 CDS complement(21118..21945) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 transl_table 11 codon_start 1 locus_tag LOCUS_91390 CDS 21993..23018 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 transl_table 11 codon_start 1 locus_tag LOCUS_91400 CDS 23015..24475 product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222367.1 transl_table 11 codon_start 1 locus_tag LOCUS_91410 CDS 24553..25314 product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 transl_table 11 codon_start 1 locus_tag LOCUS_91420 CDS complement(25321..26307) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 transl_table 11 codon_start 1 locus_tag LOCUS_91430 CDS 26433..27329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91440 CDS 27412..27945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91450 CDS complement(28368..29816) product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224336.1 transl_table 11 codon_start 1 locus_tag LOCUS_91460 CDS 29937..30947 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 transl_table 11 codon_start 1 locus_tag LOCUS_91470 CDS 30944..31594 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143979554.1 transl_table 11 codon_start 1 locus_tag LOCUS_91480 CDS 31591..32250 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_91490 CDS 32265..33188 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 transl_table 11 codon_start 1 locus_tag LOCUS_91500 CDS complement(33361..33957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91510 CDS 34067..34729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91520 CDS 34726..34881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91530 CDS 35182..37767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91540 CDS 37764..38408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91550 CDS complement(38398..42426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91560 CDS 42748..44838 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_91570 CDS complement(44904..45650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91580 CDS 45739..46473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91590 note possible pseudo, frameshifted CDS 46563..46796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91600 note possible pseudo, frameshifted CDS 46807..47439 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031522.1 transl_table 11 codon_start 1 locus_tag LOCUS_91610 CDS complement(47615..49048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91620 CDS 49209..49469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91630 CDS complement(49425..50294) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 transl_table 11 codon_start 1 locus_tag LOCUS_91640 CDS 50475..51026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197003127.1 transl_table 11 codon_start 1 locus_tag LOCUS_91650 CDS complement(51011..51421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91660 CDS complement(51483..52916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91670 CDS complement(52926..55331) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845818.1 transl_table 11 codon_start 1 locus_tag LOCUS_91680 CDS complement(55331..58621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91690 CDS complement(58976..59740) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223184.1 transl_table 11 codon_start 1 locus_tag LOCUS_91700 CDS complement(59737..60642) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 transl_table 11 codon_start 1 locus_tag LOCUS_91710 CDS complement(60649..61512) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093945347.1 transl_table 11 codon_start 1 locus_tag LOCUS_91720 CDS complement(61968..62312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91730 CDS complement(62329..65514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91740 CDS complement(65554..66783) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113320.1 transl_table 11 codon_start 1 locus_tag LOCUS_91750 CDS complement(66780..67766) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113321.1 transl_table 11 codon_start 1 locus_tag LOCUS_91760 CDS complement(67763..68851) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083238.1 transl_table 11 codon_start 1 locus_tag LOCUS_91770 CDS 68977..69405 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 transl_table 11 codon_start 1 locus_tag LOCUS_91780 CDS 69417..70703 product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726747.1 transl_table 11 codon_start 1 locus_tag LOCUS_91790 CDS 70713..71672 product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 transl_table 11 codon_start 1 locus_tag LOCUS_91800 CDS 72045..72443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91810 CDS complement(72448..73107) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 transl_table 11 codon_start 1 locus_tag LOCUS_91820 CDS complement(73104..73358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91830 CDS 73409..73720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91840 CDS complement(73902..74708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91850 CDS 74811..75935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91860 CDS 75952..76875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91870 CDS complement(76872..77108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91880 CDS complement(77126..78361) product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 transl_table 11 codon_start 1 locus_tag LOCUS_91890 CDS complement(78429..78653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91900 CDS complement(78781..79575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91910 CDS complement(79654..80043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91920 CDS 80138..80320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91930 CDS 80357..80965 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_91940 CDS complement(80955..81896) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 transl_table 11 codon_start 1 locus_tag LOCUS_91950 CDS 81980..82516 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222379.1 transl_table 11 codon_start 1 locus_tag LOCUS_91960 CDS complement(82655..82903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91970 CDS 82794..83741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_91980 CDS complement(83643..84725) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 transl_table 11 codon_start 1 locus_tag LOCUS_91990 CDS 84759..85166 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868971.1 transl_table 11 codon_start 1 locus_tag LOCUS_92000 CDS complement(85286..86740) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 transl_table 11 codon_start 1 locus_tag LOCUS_92010 CDS 86868..87098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92020 CDS complement(87103..87780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92030 CDS 87865..88275 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 transl_table 11 codon_start 1 locus_tag LOCUS_92040 CDS 88272..89180 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_92050 CDS 89229..89645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92060 CDS 89713..90525 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 transl_table 11 codon_start 1 locus_tag LOCUS_92070 CDS 90530..91507 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 transl_table 11 codon_start 1 locus_tag LOCUS_92080 CDS complement(91428..92726) product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 transl_table 11 codon_start 1 locus_tag LOCUS_92090 CDS 92836..93066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92100 CDS 93063..96836 product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184695823.1 transl_table 11 codon_start 1 locus_tag LOCUS_92110 gene fxsT CDS 96833..97867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229892.1 transl_table 11 codon_start 1 locus_tag LOCUS_92120 CDS 97888..98985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211351449.1 transl_table 11 codon_start 1 locus_tag LOCUS_92130 CDS complement(98991..101309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121008027.1 transl_table 11 codon_start 1 locus_tag LOCUS_92140 CDS complement(101306..102217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92150 CDS complement(102214..103029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92160 CDS 103565..104503 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327630.1 transl_table 11 codon_start 1 locus_tag LOCUS_92170 CDS 104500..105210 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 transl_table 11 codon_start 1 locus_tag LOCUS_92180 CDS 105210..108005 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113179.1 transl_table 11 codon_start 1 locus_tag LOCUS_92190 CDS 108005..108403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92200 CDS 108400..109899 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776504.1 transl_table 11 codon_start 1 locus_tag LOCUS_92210 CDS 109896..110435 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727234.1 transl_table 11 codon_start 1 locus_tag LOCUS_92220 CDS 110432..110704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92230 CDS 110701..111051 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031338.1 transl_table 11 codon_start 1 locus_tag LOCUS_92240 gene mnhG CDS 111057..111557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92250 CDS 111743..112801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92260 CDS complement(112813..113070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92270 CDS complement(113254..114213) product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 transl_table 11 codon_start 1 locus_tag LOCUS_92280 CDS complement(114236..115048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92290 CDS 115141..116337 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223233.1 transl_table 11 codon_start 1 locus_tag LOCUS_92300 CDS 116334..116528 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 transl_table 11 codon_start 1 locus_tag LOCUS_92310 CDS 117311..117943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92320 CDS 118073..118561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92330 CDS complement(118610..119155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92340 CDS complement(119248..119673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92350 CDS complement(119702..120289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92360 CDS 120993..121430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92370 CDS complement(121412..121891) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250228.1 transl_table 11 codon_start 1 locus_tag LOCUS_92380 CDS complement(121921..122835) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859408.1 transl_table 11 codon_start 1 locus_tag LOCUS_92390 CDS complement(122975..123451) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 transl_table 11 codon_start 1 locus_tag LOCUS_92400 CDS 123597..124331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92410 CDS complement(124446..124625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92420 CDS complement(124642..124980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92430 CDS 124892..126415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92440 CDS complement(126696..127178) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311273.1 transl_table 11 codon_start 1 locus_tag LOCUS_92450 CDS 127264..127893 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226698.1 transl_table 11 codon_start 1 locus_tag LOCUS_92460 CDS 128320..129081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92470 CDS 129511..132258 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484153.1 transl_table 11 codon_start 1 locus_tag LOCUS_92480 CDS complement(132284..132835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92490 CDS complement(132942..135524) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227451.1 transl_table 11 codon_start 1 locus_tag LOCUS_92500 CDS 135630..138347 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 transl_table 11 codon_start 1 locus_tag LOCUS_92510 CDS complement(138240..138590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92520 CDS complement(138663..139880) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_92530 CDS complement(139892..141112) product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225441.1 transl_table 11 codon_start 1 locus_tag LOCUS_92540 CDS complement(141171..142061) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466677.1 transl_table 11 codon_start 1 locus_tag LOCUS_92550 CDS 142262..142690 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 transl_table 11 codon_start 1 locus_tag LOCUS_92560 gene nsrR CDS 142712..143911 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 transl_table 11 codon_start 1 locus_tag LOCUS_92570 CDS 144015..145841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92580 CDS 145928..146305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92590 CDS complement(146358..147587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92600 CDS complement(148056..149738) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 transl_table 11 codon_start 1 locus_tag LOCUS_92610 CDS 149680..149886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92620 CDS 149896..150390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92630 CDS complement(150394..150948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92640 CDS 150850..151053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92650 CDS 151087..151398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92660 CDS 151515..151721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92670 CDS complement(151708..153042) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 transl_table 11 codon_start 1 locus_tag LOCUS_92680 CDS complement(153039..153713) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 transl_table 11 codon_start 1 locus_tag LOCUS_92690 CDS 153977..154942 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 transl_table 11 codon_start 1 locus_tag LOCUS_92700 CDS complement(154972..158505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92710 CDS 158687..159580 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 transl_table 11 codon_start 1 locus_tag LOCUS_92720 CDS 159659..160057 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 transl_table 11 codon_start 1 locus_tag LOCUS_92730 CDS complement(160141..161073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92740 CDS 161266..162096 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 transl_table 11 codon_start 1 locus_tag LOCUS_92750 CDS 162160..163155 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971634.1 transl_table 11 codon_start 1 locus_tag LOCUS_92760 gene gap CDS complement(163159..163335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92770 CDS complement(163435..164085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92780 CDS complement(164140..166020) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226314.1 transl_table 11 codon_start 1 locus_tag LOCUS_92790 gene fusA CDS complement(166346..167641) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978040.1 transl_table 11 codon_start 1 locus_tag LOCUS_92800 CDS complement(167638..168372) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978041.1 transl_table 11 codon_start 1 locus_tag LOCUS_92810 CDS 168437..169306 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 transl_table 11 codon_start 1 locus_tag LOCUS_92820 CDS 169508..170338 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234824717.1 transl_table 11 codon_start 1 locus_tag LOCUS_92830 CDS complement(170707..171960) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 transl_table 11 codon_start 1 locus_tag LOCUS_92840 CDS complement(172025..173518) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 transl_table 11 codon_start 1 locus_tag LOCUS_92850 CDS complement(173520..174017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92860 CDS complement(174014..175003) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 transl_table 11 codon_start 1 locus_tag LOCUS_92870 CDS 175170..178358 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229882.1 transl_table 11 codon_start 1 locus_tag LOCUS_92880 CDS complement(178372..178878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92890 CDS complement(178862..179686) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 transl_table 11 codon_start 1 locus_tag LOCUS_92900 note possible pseudo, frameshifted CDS 180122..180484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92910 CDS complement(180548..180808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92920 CDS complement(181062..181841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92930 CDS complement(182545..183372) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 transl_table 11 codon_start 1 locus_tag LOCUS_92940 CDS complement(183369..184355) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 transl_table 11 codon_start 1 locus_tag LOCUS_92950 CDS 184597..185421 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084069.1 transl_table 11 codon_start 1 locus_tag LOCUS_92960 CDS 185531..186517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92970 CDS complement(186564..187136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92980 CDS complement(187309..187935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_92990 CDS complement(187994..188167) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767547.1 transl_table 11 codon_start 1 locus_tag LOCUS_93000 CDS complement(188181..188519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93010 CDS complement(189274..190041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93020 CDS 190185..191042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93030 CDS complement(191048..191509) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 transl_table 11 codon_start 1 locus_tag LOCUS_93040 CDS complement(191514..192158) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 transl_table 11 codon_start 1 locus_tag LOCUS_93050 CDS complement(192289..192603) product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889650.1 transl_table 11 codon_start 1 locus_tag LOCUS_93060 CDS complement(192605..192961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93070 CDS complement(192958..193284) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 transl_table 11 codon_start 1 locus_tag LOCUS_93080 CDS 193420..194019 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 transl_table 11 codon_start 1 locus_tag LOCUS_93090 CDS complement(194066..194791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 transl_table 11 codon_start 1 locus_tag LOCUS_93100 CDS complement(194791..196038) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 transl_table 11 codon_start 1 locus_tag LOCUS_93110 CDS 196192..196653 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484516.1 transl_table 11 codon_start 1 locus_tag LOCUS_93120 CDS 196842..197633 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 transl_table 11 codon_start 1 locus_tag LOCUS_93130 CDS complement(197791..198576) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 transl_table 11 codon_start 1 locus_tag LOCUS_93140 CDS 198667..199575 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 transl_table 11 codon_start 1 locus_tag LOCUS_93150 CDS complement(199583..200788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93160 CDS complement(200821..203235) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_93170 CDS complement(203514..203987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93180 CDS complement(204109..206493) product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 transl_table 11 codon_start 1 locus_tag LOCUS_93190 CDS complement(206504..207667) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_93200 CDS complement(207669..208496) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139631769.1 transl_table 11 codon_start 1 locus_tag LOCUS_93210 CDS complement(208496..209446) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 transl_table 11 codon_start 1 locus_tag LOCUS_93220 CDS complement(209451..210716) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_93230 CDS 210860..211630 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225805.1 transl_table 11 codon_start 1 locus_tag LOCUS_93240 CDS complement(211653..212588) product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228730.1 transl_table 11 codon_start 1 locus_tag LOCUS_93250 CDS 212866..214173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93260 CDS 214318..215097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93270 CDS complement(215152..215448) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227689.1 transl_table 11 codon_start 1 locus_tag LOCUS_93280 CDS complement(215445..219413) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_93290 CDS complement(219530..220699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 transl_table 11 codon_start 1 locus_tag LOCUS_93300 CDS complement(220677..221495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93310 CDS complement(221492..222607) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187247289.1 transl_table 11 codon_start 1 locus_tag LOCUS_93320 CDS complement(222701..223579) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 transl_table 11 codon_start 1 locus_tag LOCUS_93330 CDS complement(223626..224486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93340 CDS 224814..226373 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_93350 CDS complement(226642..227268) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 transl_table 11 codon_start 1 locus_tag LOCUS_93360 CDS 227484..227777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93370 CDS complement(227812..229032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93380 CDS complement(229101..229985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93390 CDS complement(230051..231268) product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776244.1 transl_table 11 codon_start 1 locus_tag LOCUS_93400 CDS 231319..232188 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_93410 CDS 232201..232935 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026803.1 transl_table 11 codon_start 1 locus_tag LOCUS_93420 CDS complement(232925..233215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130510950.1 transl_table 11 codon_start 1 locus_tag LOCUS_93430 CDS 233240..233491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93440 CDS 233482..233835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93450 CDS complement(233858..234196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93460 CDS 234346..235653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 transl_table 11 codon_start 1 locus_tag LOCUS_93470 CDS complement(235660..236403) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947370.1 transl_table 11 codon_start 1 locus_tag LOCUS_93480 CDS 236285..236656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93490 CDS 236721..237449 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 transl_table 11 codon_start 1 locus_tag LOCUS_93500 CDS 237566..240490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93510 CDS complement(240498..240926) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972172.1 transl_table 11 codon_start 1 locus_tag LOCUS_93520 CDS 241010..242029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93530 CDS complement(242084..243319) product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 transl_table 11 codon_start 1 locus_tag LOCUS_93540 gene fdhA tRNA complement(242258..242353) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 CDS 243552..243794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93550 CDS 244005..244982 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 transl_table 11 codon_start 1 locus_tag LOCUS_93560 CDS 245020..246201 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 transl_table 11 codon_start 1 locus_tag LOCUS_93570 CDS 246198..247253 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 transl_table 11 codon_start 1 locus_tag LOCUS_93580 CDS 247250..248128 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 transl_table 11 codon_start 1 locus_tag LOCUS_93590 CDS 248125..248988 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 transl_table 11 codon_start 1 locus_tag LOCUS_93600 CDS 248985..250193 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 transl_table 11 codon_start 1 locus_tag LOCUS_93610 CDS 250203..250751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084748217.1 transl_table 11 codon_start 1 locus_tag LOCUS_93620 CDS 251030..254053 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226391.1 transl_table 11 codon_start 1 locus_tag LOCUS_93630 CDS 254294..256687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93640 CDS complement(256760..257953) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227447.1 transl_table 11 codon_start 1 locus_tag LOCUS_93650 CDS complement(258097..259491) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_93660 CDS complement(259546..260217) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_93670 CDS complement(260210..261487) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_93680 CDS 261378..261680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93690 CDS 261693..262034 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 transl_table 11 codon_start 1 locus_tag LOCUS_93700 CDS complement(262131..262949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93710 CDS complement(263099..263575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93720 CDS 263832..264191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93730 CDS 264395..265384 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537421.1 transl_table 11 codon_start 1 locus_tag LOCUS_93740 CDS 265381..266358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93750 CDS 266355..267122 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383246.1 transl_table 11 codon_start 1 locus_tag LOCUS_93760 CDS 267135..268076 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 transl_table 11 codon_start 1 locus_tag LOCUS_93770 CDS complement(268078..269589) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_93780 CDS complement(269610..271226) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 transl_table 11 codon_start 1 locus_tag LOCUS_93790 CDS 271383..272762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93800 CDS complement(272752..272985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93810 CDS 272999..273502 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225219.1 transl_table 11 codon_start 1 locus_tag LOCUS_93820 CDS complement(273671..274345) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640365.1 transl_table 11 codon_start 1 locus_tag LOCUS_93830 CDS complement(274458..276281) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 transl_table 11 codon_start 1 locus_tag LOCUS_93840 CDS complement(276342..278471) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_93850 CDS complement(278608..278880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93860 CDS 278774..279424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93870 CDS 279452..280192 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_93880 CDS 280350..282308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93890 CDS complement(282385..282648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93900 CDS complement(283038..283649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93910 CDS complement(283652..284458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93920 sequence120 source 1..924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence122 source 1..882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence123 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence124 source 1..876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..800) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 transl_table 11 codon_start 1 locus_tag LOCUS_93930 sequence125 source 1..794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence127 source 1..763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence128 source 1..759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence129 source 1..745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_93940