COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..196510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..1151 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1331..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2078..3010) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3159..4226 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4520..5341 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5334..6170 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 6319..6804 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 6801..7733 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 7660..8574 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene murQ CDS 8564..9583 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9793..10578 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10842..11957 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11947..12879 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12876..13691 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13688..15061 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 15156..15587 product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene arsC CDS 15621..16319 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(16402..16959) product phospholipase A2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 17495..17791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 17959..18669 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18781..19341 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19374..20810 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 21295..23502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 23934..29267 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 29532..29744 product DUF3923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 29959..30114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 30406..31035 product NUDIX hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 31246..31569 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 31939..32145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(32142..33497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33605..34201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(34198..35394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 35890..36390 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(36609..37676) product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(37694..38899) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 39346..40065 product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 40080..41405 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 41402..42376 product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 42402..43304 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(43428..44009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(44232..45305) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(45307..46125) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(46297..46857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(46927..47583) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rpe CDS complement(47613..48488) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(48485..49246) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(49265..49741) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(49753..50184) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(50241..51332) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 51551..52312 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102216.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 52442..54829 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 55560..55856 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 56065..56772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 56741..56905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 57891..58730 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 58821..60785 product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 60797..62236 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 62190..62588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(63045..63311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(63360..67949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(68359..69180) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 69511..70311 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 70339..72207 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139041878.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 72209..72718 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 72731..73288 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 73337..74452 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 74478..74861 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 74865..75536 product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 76067..77905 product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 77913..78269 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 78406..78765 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 78778..79146 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 79148..79927 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 79940..80629 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 80665..81786 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 81783..82883 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 82898..83662 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(83801..84196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 84378..84872 product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 84869..85699 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 85689..86510 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 86573..86992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 87030..88082 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 88079..89506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 89518..90975 product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 90988..92610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 92905..94389 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 94367..94780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 94786..95265 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674985.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 95300..96637 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 96661..96963 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96963..97826 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 97857..98549 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 98546..99067 product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(99384..99641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 99925..100215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 100410..100625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(100778..102208) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(102383..102742) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(102756..103076) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 103301..104014 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(104157..104879) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 105422..106798 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 106839..108155 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(108602..109687) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 109849..110343 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 110343..111158 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 111155..111985 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 112151..112918 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(113019..113966) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114272..115096) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene kduD CDS complement(115130..115975) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene kduI CDS 116358..116849 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 116863..117666 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 117659..118516 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 118677..119441 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene yidA CDS 119453..120001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 note possible pseudo, frameshifted CDS 120285..122387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 122501..122920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 122935..124500 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 124497..125630 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 125675..127471 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 127568..128125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 128276..129295 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(129314..129997) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(130264..131034) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 131383..132072 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rpiA CDS 132627..132779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 note possible pseudo, frameshifted CDS 132776..133804 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 133817..134317 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 134463..135272 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 135262..136077 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 136164..136634 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 136634..136984 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 136920..138851 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 138854..139852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 139868..142150 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 142332..142457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(143046..144731) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 144995..145168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(145193..145999) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(146490..146750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(147191..147460) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 147847..148065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 148083..149201 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 149313..149873 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 150024..151493 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 151514..152977 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(153247..153492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 note possible pseudo, frameshifted CDS complement(153494..154369) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 note possible pseudo, frameshifted CDS complement(154561..155583) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(155555..155737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 155706..157070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 157152..158642 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rhaB CDS 158645..158959 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rhaM CDS 159024..160304 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 160334..161224 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene rhaD CDS complement(161640..162422) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 162633..163112 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 163135..163455 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 163552..165135 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 165128..165364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 165361..166089 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(166571..167305) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 167716..168846 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene celB CDS 168870..171509 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene mngB CDS 171509..172801 product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 172798..173694 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 173694..175115 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 175134..175448 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 175491..175829 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 175847..177037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 177587..179632 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 179672..180298 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene eda CDS 180315..180779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 180795..181082 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 181138..182514 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 182560..183705 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene dgoD CDS 183739..184338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 185160..185387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 185688..185864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(185972..186199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(186262..186900) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(187068..187427) product Gar-IM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 187915..189702 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 189722..190975 product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 190976..191251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 191253..192596 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 192612..193049 product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(193380..194186) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 194382..195137 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 195223..195390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 misc_feature complement(195615..>196510) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_220738881.1:DUF1542 domain-containing protein locus_tag LOCUS_01930 sequence002 source 1..24282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6832..7659) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(7634..8440) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(8446..9360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 9579..10841 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 10923..11660 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(11824..12045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(12042..12794) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 12920..13849 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene pfkB CDS 13853..15838 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 16577..17050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(17399..18097) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(18145..18354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 18841..20034 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene recA CDS complement(20294..21499) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 21764..22666 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(22672..23154) product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 23250..24062 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 sequence003 source 1..171831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..359 product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080468098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(614..2002) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 2142..2888 product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 2910..3530 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 3792..4823 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(4999..5556) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 tRNA 5767..5841 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 6102..6644 product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(6745..7110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(7150..8292) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene queG CDS complement(8526..9314) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(9453..9845) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 10154..10600 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 10781..11395 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 11425..12345 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674822.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(12471..12641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 12766..13254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(13251..13493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(13680..14699) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene add CDS 14805..16109 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 16054..16230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 16342..17766 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 17763..18776 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene cydB CDS 18773..20515 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene cydD CDS 20496..22223 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene cydC CDS 22478..26563 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene cas9 CDS 26782..27687 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene cas1 CDS 27665..27970 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene cas2 CDS 27967..28647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 repeat_region 28668..30089 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaggtagatgtcagatcaatcagttcaagagc CDS complement(30288..31055) product IS5-like element ISLpl3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154022001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 31168..31593 product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 31775..33463 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 33463..35082 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(35227..35823) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 35970..36959 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, frameshifted CDS 36943..37161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 37489..40278 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 40490..41056 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 41107..42525 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 42743..44077 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674807.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 44329..44535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(44498..45703) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 45848..46225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 46212..46514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(46731..47699) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 47777..48691 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 48737..49807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 50599..52503 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene asnB CDS complement(52573..52731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(53004..53975) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(53991..55874) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 56127..56720 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 57250..57648 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(57772..58476) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 58895..60058 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 60098..61090 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 61106..62149 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 62314..62664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012491852.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 62675..64246 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(64339..65685) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(65682..66881) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 66991..68502 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene thrC CDS 68468..69373 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene thrB CDS 69453..69818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 70075..71334 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 71383..71844 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 71962..72693 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571118.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene sfsA CDS 73048..74271 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 74264..75115 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 75127..76032 product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 76201..77961 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene spxB CDS 78224..79165 product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(79254..79664) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 79899..80600 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 80692..81768 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 81758..82855 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(82921..83961) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(84221..84427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 84584..85273 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 85442..85906 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 86103..86687 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 87215..88129 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(88510..88734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 88709..88954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 89117..89530 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003603033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 89651..89842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 90135..90632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 90656..91021 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 91115..92311 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 92353..93321 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 93735..94172 product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 94243..94695 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 94711..95670 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 95739..95978 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 96002..96991 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 97018..97941 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 97938..98666 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene fabG CDS 98689..99909 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene fabF CDS 99915..100361 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene accB CDS 100410..100850 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene fabZ CDS 100888..102270 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003603026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 102252..103070 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene accD CDS 103249..104022 product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene accA CDS 104120..105301 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 105811..107289 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 107489..108490 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 108562..109245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 109238..109957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(110083..111804) product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(111785..112027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(111999..112997) product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(113095..113400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 113732..116464 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(116676..117860) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 118140..118946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 119150..123898 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 124086..124880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 124847..125137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 125191..125589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(125709..126524) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 126672..127376 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 127431..127709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 127974..128153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 128841..129653 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(130419..131033) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 131644..131931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 131864..132433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 132696..133301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 133342..135921 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(136184..136927) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene yaaA CDS complement(136986..139208) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 139493..140920 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 140917..141081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 141139..141549 product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674745.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 141671..142003 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(142312..142878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 143495..144277 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 144274..145758 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674742.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 145751..146458 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 146703..147266 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene efp CDS 147554..148987 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 149418..151040 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 151186..152109 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 152109..153107 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 153119..154171 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566704.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 154173..155153 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 155497..156135 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 156448..156759 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 157066..157290 product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 157317..158000 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 158115..158615 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(158788..159510) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 159785..160768 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene rfbB CDS 161201..162115 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 162130..162876 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 162962..164080 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene glf CDS 164154..165548 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 165624..166985 product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 167386..168084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 168123..169271 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 169274..170365 product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene waaB CDS 170467..171264 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 sequence004 source 1..46258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 406..762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 752..1018 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 1360..2886 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 3070..3378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 3398..3757 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 3778..5100 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 5126..7063 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 7056..8495 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 8673..10769 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 10770..11081 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 11232..12518 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 12533..12955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 12978..13838 product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 13860..14492 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 14482..14778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 14784..15293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 16257..16487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 16969..17829 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 17860..18855 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(18993..20795) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene spxB CDS 21190..21507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 21856..22173 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 22183..22506 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 22526..23020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 23041..24405 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene celB CDS 24452..25888 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 26059..26796 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 27099..27941 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 28051..28611 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 28613..30313 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 30310..31134 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 31154..32737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 32767..32955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 32975..33310 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 33303..34694 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 34714..35004 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 35008..36327 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 36383..38260 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(38393..39877) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(39879..41156) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 41303..42199 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(42369..42980) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 43256..43729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 43722..44012 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 44037..45296 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 45342..46241 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene dapA sequence005 source 1..53009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..828) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene pgsA CDS complement(825..1724) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(1811..2539) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(2536..3831) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(3828..5090) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(5099..7408) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(7512..7919) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(7937..8446) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene trmL CDS complement(8783..9382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 note possible pseudo, frameshifted CDS 9691..10638 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 10821..11810 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032674946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 12047..12316 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rpsN CDS complement(12404..12778) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 12986..14026 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 14384..15202 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 15223..15858 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 16076..17137 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(17254..18156) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(18156..18953) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(18955..19632) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 19799..20392 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 20462..21097 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(21727..22782) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(22919..24262) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(24295..24561) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564140.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 24764..26092 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(26218..27423) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(27526..27999) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 tRNA 28141..28227 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 28372..28872 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 28869..29693 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(29846..30607) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(30561..32204) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(32811..35222) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene leuS CDS complement(35297..35437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 35589..36263 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(36343..37068) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(37065..38543) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 38663..39142 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(39307..40152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 note possible pseudo, frameshifted CDS complement(40119..40799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 note possible pseudo, frameshifted CDS complement(43576..44760) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene metK CDS 44941..45588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(45870..46772) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(46879..47034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(47065..48123) product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(48123..49157) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(49209..51710) product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(52000..52266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 tRNA complement(52668..52759) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(52766..52840) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 rRNA complement(52850..52961) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence006 source 1..50918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 695..1432 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 1484..2308 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 2310..2954 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 2970..3632 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 3879..4814 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 5079..6479 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 6669..7541 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rfbA CDS 7553..8125 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene rfbC CDS 8128..9153 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene rfbB CDS 9222..10064 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rfbD CDS 10504..10929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 11313..12320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 12633..13202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 note possible pseudo, internal stop codon, frameshifted CDS 13319..13621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 note possible pseudo, internal stop codon, frameshifted CDS complement(13834..15099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 15333..15515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 15652..16635 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(16756..18051) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene hflX CDS complement(18245..19126) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(19416..21092) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 21393..22154 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 22166..23974 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 24351..25244 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rhaD CDS complement(25341..26006) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 26168..27127 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene hemH CDS 27124..28476 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(28543..29448) product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(29581..31410) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 31467..31679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 31763..34054 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene helD CDS 34060..34536 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 34759..36168 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(36276..36566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(36603..36947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 37140..38066 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene coaA CDS 38247..39800 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene guaA CDS complement(39965..41128) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(41235..41600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(41656..42234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(42265..42705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(42724..43158) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 43294..43536 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 43533..43712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(43709..43948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 44051..44194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 44252..44758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 44764..44973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 44986..45114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 45126..45353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 45346..45771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 45783..46646 product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 46570..47427 product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021732641.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 47443..48399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 48412..48897 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene ssb CDS 48913..49362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 49365..49748 product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905958.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 49767..50222 product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 50243..50707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 50719..50904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 sequence007 source 1..90581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 489..2672 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene nrdD CDS complement(2778..3386) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(3583..3867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(4157..5026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 note possible pseudo, frameshifted CDS 5127..5357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(5907..6131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(6175..6378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(6564..6860) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(6960..7169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(8701..9681) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(9791..10858) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 11018..11269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(11517..12602) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 12727..13287 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 13399..14400 product D-2-hydroxyisocaproate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 14455..14649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(14772..15122) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 15319..16776 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 16905..17228 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573038.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 17394..17690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(17817..18392) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 18934..20862 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674002.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 21219..21989 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 22076..23170 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 23565..25016 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 25157..26149 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(26543..26872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 27031..28377 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 28612..29802 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(29958..30779) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 30995..31624 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 31641..31937 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(32038..33486) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(33639..33854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(33835..33981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 34209..36590 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 36919..38538 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 38645..39112 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 39267..40400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(40542..42392) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 42537..43898 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 43909..44541 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 44719..46032 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 46167..47009 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 47009..47383 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(47466..47672) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 48008..48313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 48449..48916 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 49207..49449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 49446..49640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(49745..50707) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 50937..51341 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 51709..51966 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 51980..52519 product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene amaP CDS 52618..52815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 52824..53240 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 53276..53725 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 54033..54719 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 54719..55633 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 55648..56295 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene pcp CDS 56453..57073 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(57196..57870) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(58056..58436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 58705..59436 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene rsmG CDS 59440..60267 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene noc CDS 60277..61044 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 61034..61906 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 61933..62124 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 62233..63255 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ychF CDS 63311..64105 product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 65009..66496 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene guaB CDS complement(66571..67260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 67454..68140 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 68144..69334 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 69331..70641 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 70727..71194 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene greA CDS 71273..72826 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 72833..73585 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562967.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 73741..74601 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(74925..75728) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 76179..77666 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 77745..79220 product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene iolA CDS 79257..80072 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene iolB CDS 80107..81081 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene iolC CDS 81084..83045 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene iolD CDS 83073..84113 product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene iolG CDS 84148..85203 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 85205..86101 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene iolE CDS 86132..87004 product 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene iolJ CDS 87092..87481 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 87620..88489 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 88495..89358 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(89489..90331) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 sequence008 source 1..28957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(2615..2734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(3046..3642) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(4015..4230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 4160..5869 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 5862..7673 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(7794..7952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 8313..8582 product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 8705..9523 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 9747..11117 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(11238..11927) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(11932..12993) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(12998..13504) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(13757..14521) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(14532..14684) product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(14685..15224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 15595..15828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(15892..16746) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714088.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(16891..18927) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene ygjK CDS complement(18996..19205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(19310..20767) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(20870..22351) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(22385..25363) product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene ebgA CDS complement(25934..28006) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922676.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(28087..28722) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 sequence009 source 1..74886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 620..1069 product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 1192..1536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 1902..2687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(2772..3911) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(4006..4815) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(4891..5604) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(5807..5980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(6228..6428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(6998..7702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 7972..8880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(9046..10419) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene brnQ CDS 11423..12091 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 12200..13225 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 13206..13679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 13676..15682 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(16008..16727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, frameshifted CDS 16963..17190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(17191..18909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(18896..19690) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(19910..20458) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(20658..20792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 note possible pseudo, frameshifted CDS complement(20804..21481) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 note possible pseudo, frameshifted CDS complement(21648..22520) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene metF CDS complement(22498..24783) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene metE CDS complement(25222..25431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 25742..27460 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 27464..29245 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 29406..30632 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 30918..31634 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene treR CDS 31685..33346 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene treC CDS 33350..35362 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 35629..36921 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene sstT CDS 37245..38723 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(38815..39753) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 40260..41600 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031263459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene gdhA CDS 42140..42634 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 42637..43440 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene agaW CDS 43433..44260 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 44468..44668 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(44908..45339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(45509..45949) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(46059..47546) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene abc-f CDS complement(47874..48497) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(48615..49460) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(49613..51004) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 51228..53405 product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(53760..55742) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(55972..56754) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(56835..57476) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(57611..57937) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 58124..58336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(58460..59371) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(59713..61029) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(61538..62479) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 62725..63396 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 63497..65140 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041168847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 65535..67211 product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 67208..67789 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(67947..68528) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(69160..69345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 sequence010 source 1..65986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(886..1833) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(1855..2472) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(2715..3680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(3851..4408) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(4416..4766) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 4897..5832 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(5869..6753) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 7007..8674 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 8679..9665 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(9717..10214) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene tpx CDS 10479..10988 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(11022..11996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 12112..12303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 12318..13694 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(13760..15574) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene pepF CDS 15710..16060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(16165..16608) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene ndk CDS complement(16697..19045) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574093.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 19212..19547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 note possible pseudo, internal stop codon CDS 19560..20135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 note possible pseudo, internal stop codon CDS 20188..20535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 20692..21216 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 21241..22395 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 22477..23148 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(23235..23693) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 23816..24748 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(24767..25240) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene nrdI CDS complement(25494..26318) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 26534..27331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 27397..28242 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(28437..28898) product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 29460..30593 product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 30705..31178 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(31283..31879) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 31969..32565 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene ruvA CDS 32645..33676 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene ruvB CDS 33711..34781 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene queA CDS 35630..36772 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene tgt CDS 36842..37267 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene yajC CDS 37541..40147 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene adhE CDS 40307..40951 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 40981..42468 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene zwf CDS 42835..43941 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene dinB CDS 44058..45371 product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 45378..46334 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 46340..47686 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 47691..48626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 48966..51611 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene alaS CDS 51770..51904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 52010..52270 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 52270..52704 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene ruvX CDS 52755..53075 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 53231..53476 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 53489..54022 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 54088..56448 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 56515..56826 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene trxA CDS 57343..57492 product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 57510..59030 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene dltA CDS 59030..60247 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene dltB CDS 60315..60560 product D-alanine--poly(phosphoribitol) ligase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene dltC CDS 60557..61828 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene dltD CDS complement(61968..62459) product DUF2507 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 62715..64172 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene racE CDS 64169..64687 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(64766..65497) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 sequence011 source 1..23324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 1408..2844 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 2879..3745 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 3852..4886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 5010..5354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 5428..6147 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 6144..6941 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(7022..7870) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(7867..8739) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(8745..10544) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene pepF CDS 10673..11767 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(11930..13309) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene brnQ CDS 13269..13430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 13568..13741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(14183..14866) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 15416..16174 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 16257..17039 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 17058..17819 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 17901..18233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(18320..18919) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene lepB CDS complement(18992..19927) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 20342..21889 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(22033..22779) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 sequence012 source 1..55499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..424 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010493173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 461..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 918..2210 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 2215..3732 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 3656..4465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 4605..5147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 5161..6078 product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 6146..7024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 7024..7383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 7380..7676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 7669..8043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 8040..8405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 8408..9058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 9122..9553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 9628..9861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 9861..12839 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 12843..13661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 13674..15776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 15745..19830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 19843..20241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 20210..20419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 20412..20858 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 20868..22052 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(22260..23453) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(23457..23705) product DUF3173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(24075..24332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(24353..24751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(24931..27204) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(27279..28565) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene eno CDS 28870..29268 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 29262..29612 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 29794..30363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 30524..31366 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 31377..32033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 32043..32417 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 32549..32962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(33024..33947) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(33944..34480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(34487..35482) product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(35479..37572) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(37559..40024) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(40008..40400) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005427021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(40462..40959) product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(40963..41184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(41283..42017) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(42148..42474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(42464..43654) product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene mobT CDS 44077..46776 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(46883..47158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(47148..48536) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(48533..48820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(48840..49088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(49123..49413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(49373..49636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(49711..50082) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(50100..50423) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(50466..50708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(50710..54519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 sequence013 source 1..61004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662286.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(545..1351) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(1376..1927) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 2109..2810 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 2820..5393 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 5595..6851 product cell wall hydrolase P40 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(7167..8279) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(8276..9370) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010710139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(9951..10133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(10428..10622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003600287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(10770..11789) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene cydB CDS complement(11782..13260) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 13622..14128 product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene yraA CDS complement(14214..14450) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rpsR CDS complement(14540..15133) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ssb CDS complement(15163..15459) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rpsF CDS complement(15586..16017) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene ssb CDS 16174..16350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(17063..17527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(17635..20259) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene gyrA CDS complement(20325..22286) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene gyrB CDS complement(22329..23447) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene recF CDS complement(23444..23656) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene yaaA CDS complement(24054..25193) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene dnaN CDS complement(25367..26716) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene dnaA CDS 27473..27613 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene rpmH CDS 28025..28381 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rnpA CDS 28384..29247 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene yidC CDS 29265..30032 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 30406..31794 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene mnmE CDS 31834..33735 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene mnmG CDS 34089..34853 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 34855..35331 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(35412..36497) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 37191..38030 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 38063..38845 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 38897..40066 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(40163..41356) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(41343..42032) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(42025..43092) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(43542..44717) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(45027..45203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(45214..45474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(45840..46625) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(46838..47548) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene nagB CDS 47934..49754 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 49766..51847 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 51852..52295 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 52299..53453 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568386.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 53572..54525 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(54641..55570) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 55771..56691 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 56923..57594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 tRNA 57801..57876 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 58241..58489 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 58505..58645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(59126..59419) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 misc_feature complement(59475..>61004) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137615044.1:phage major capsid protein locus_tag LOCUS_09060 sequence014 source 1..127167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..992) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene plsY CDS 1304..3316 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene parE CDS 3323..5764 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003590703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene parC CDS 6018..8279 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene pflB CDS 8418..9269 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene pflA CDS 9391..10359 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 10388..11320 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 12352..13476 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene xerS CDS 13573..13926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(14207..16039) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(16036..16806) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(16900..17448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 note possible pseudo, frameshifted CDS complement(17523..17858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 note possible pseudo, frameshifted CDS complement(17851..18552) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 18644..19846 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(19979..20614) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(20861..21658) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060683812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(21802..22893) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene hisC CDS complement(22973..23305) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene hisE CDS complement(23312..23635) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene hisI CDS complement(23632..24390) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene hisF CDS complement(24359..25108) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene hisA CDS complement(25086..25712) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene hisH CDS complement(25712..26296) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene hisB CDS complement(26338..27618) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene hisD CDS complement(27620..28249) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene hisG CDS complement(28246..29394) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 29455..29655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(29951..31048) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene hisC CDS complement(31346..31906) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(32061..32927) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 33208..33387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 33522..35222 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 35236..35547 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(35684..36076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 note possible pseudo, frameshifted CDS complement(36175..36822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted CDS complement(37307..37948) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene pyrE CDS complement(38042..38659) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene pyrF note possible pseudo, frameshifted CDS complement(38656..39525) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(39580..42762) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene carB CDS complement(42765..43847) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(43844..45118) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(45127..46068) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(46055..47362) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(47366..47914) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene pyrR CDS complement(48269..49189) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(49186..49653) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene lspA CDS complement(49762..51435) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(51448..51852) product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 51877..52269 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(52401..53003) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 53302..54771 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene cls CDS complement(54939..55265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(55376..56827) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 57146..57376 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene nrdH CDS 57446..59617 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene nrdE CDS 59671..60651 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene nrdF CDS complement(60805..61707) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(61937..63841) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 64538..65551 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(65792..67297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(67291..68256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(69701..69928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(70062..70997) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(71001..72152) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(73103..73501) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene gpsB CDS complement(73557..74132) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 74199..74825 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene recU CDS 74818..77139 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(77321..77785) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(77782..78435) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(78503..79123) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(79177..80475) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene asnS CDS complement(80506..81681) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(81734..82225) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(82417..85197) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(85241..88951) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene addA CDS complement(88948..92487) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 92611..93546 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene mvk CDS 93554..94558 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene mvaD CDS 94524..95558 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene fni CDS complement(95643..96974) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(96961..97914) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(98120..98863) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(98966..99313) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(99349..99537) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(99657..100451) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(100438..101148) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(101298..102548) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene rpoD CDS complement(102562..104331) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene dnaG CDS complement(104526..106595) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene glyS CDS complement(106597..107493) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene glyQ CDS complement(108076..108387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(108499..109314) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene recO CDS complement(109314..110216) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene era CDS complement(110213..110602) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(110605..111003) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(110987..111445) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene ybeY CDS complement(111450..112436) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(112783..113226) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(113245..113421) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rpsU CDS 113703..114533 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(114530..115417) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(115531..116451) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(116592..117035) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene msrB CDS complement(117130..118935) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene aspS CDS complement(118937..120220) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene hisS CDS 120894..121352 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 121371..122051 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 122193..123515 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(123600..124226) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674532.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(124226..124672) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene dtd CDS complement(124787..127012) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 sequence015 source 1..20338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..2041) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene lysS CDS complement(2190..3191) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene dusB CDS complement(3254..4138) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674924.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene hslO CDS 4304..4555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(4650..6782) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ftsH CDS complement(6844..7389) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene hpt CDS complement(7389..8696) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene tilS CDS complement(8797..9282) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(9491..9892) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(9985..10248) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(10253..11827) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(11901..15428) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene mfd CDS complement(15502..16059) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene pth CDS 16560..17540 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 17852..19222 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 19438..20103 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene cbpA sequence016 source 1..32543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 376..1335 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1484..2287) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(2289..3260) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(3291..4259) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(4751..5707) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003659939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(6156..8543) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(9356..10009) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 10185..11021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 11014..12075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 12126..12941 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene thiD CDS complement(13058..13690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(14328..14852) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(14929..15108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(15105..15773) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(15770..16561) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(16675..17793) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene mutY CDS complement(18347..18823) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(19305..19448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(19607..19927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(19946..20269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(20356..23481) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(23478..24602) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 24667..25293 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 25753..26514 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 26659..27087 product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene lacA CDS 27133..27651 product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene lacB CDS 27710..28711 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 28917..29855 product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene lacC CDS 29876..30556 product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 30639..31664 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 sequence017 source 1..5996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 532..1266 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1352..2104 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 2404..3747 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 3818..4948 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 sequence018 source 1..43345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..916) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene clpP CDS complement(1034..1489) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1793..2740) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene whiA CDS complement(2745..3773) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene yvcK CDS complement(3770..4657) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rapZ CDS complement(4797..5336) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(5819..8707) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene uvrA CDS complement(8903..10918) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene uvrB CDS complement(11091..11738) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(11946..13673) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(13915..14862) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene trxB CDS complement(14928..15983) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(15994..16821) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene lgt CDS complement(16823..17782) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene hprK CDS complement(18011..18346) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(18349..18609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(18622..20112) product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene liaX CDS complement(20278..20955) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene phoU CDS complement(20966..21730) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene pstB CDS complement(21740..22558) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene pstB CDS complement(22643..23527) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene pstA CDS complement(23524..24447) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pstC CDS complement(24592..25458) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(25549..27216) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(27209..27916) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(27913..29022) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(29552..30439) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene ftsX CDS complement(30429..31115) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ftsE CDS complement(31193..32191) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096772597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene prfB CDS complement(32401..34764) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene secA CDS complement(35031..35588) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene raiA CDS complement(35713..36231) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(36389..37651) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 37679..38332 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(38479..40050) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003657913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rny CDS complement(40198..40389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(40517..41560) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene recA CDS complement(41610..42851) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 sequence019 source 1..80288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 893..1342 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene tnpA CDS complement(1800..4013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 4715..5329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 5379..5558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(5778..6425) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(6429..8546) product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 8974..9543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 9670..9984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 10743..10991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(11302..12333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 12628..13038 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 13035..13382 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(13454..13603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(13945..14586) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(14866..15795) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 16204..16473 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene rpsN CDS 16819..17562 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 17559..18452 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 18449..19390 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(19552..19884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(20023..20652) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(20776..20976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 21110..22639 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 22711..24045 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(24435..24800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580900.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(25090..27807) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 28372..29979 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 30299..31081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 31228..32604 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 32641..32958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(32963..34108) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(34143..34874) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 35089..36042 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(36235..36411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 36712..37050 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 37229..38668 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 38724..39167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 39459..40157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 note possible pseudo, frameshifted CDS 40085..40288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 note possible pseudo, frameshifted CDS complement(41011..41766) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 42635..42811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 42839..43030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(43389..43574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 43680..43865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 45398..45595 product ComC/BlpC family leader-containing pheromone/bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 45623..45781 product bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013246049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(46275..46457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 46369..46785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 46796..47035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 47056..47262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 47271..47474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 47759..47935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 48201..48485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(48668..49474) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(49476..50237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(50594..50836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 51005..51151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 51460..53652 product peptide cleavage/export ABC transporter ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene comA CDS 53665..55044 product bacteriocin secretion accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 55159..56514 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(56726..56863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(56817..57377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 note possible pseudo, internal stop codon CDS complement(57405..57674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 note possible pseudo, internal stop codon CDS complement(58252..58455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 58704..58991 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(59012..59815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(59846..60628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(60625..60957) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(61086..61733) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(61976..62647) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(62895..63950) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 64116..65315 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 65461..66018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 66215..66757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 67035..67874 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene proB CDS 67954..69210 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(69332..70477) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 71233..71487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 71695..71901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 72004..72261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 72309..72665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 72876..73991 product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(74151..74435) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(74507..75613) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 75775..76446 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 76635..77192 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 77353..79983 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene ppdK sequence020 source 1..62276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..2093) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(2106..2864) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566323.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(3168..3512) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(3791..4108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(4286..4552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(4645..5331) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 note possible pseudo, frameshifted CDS complement(5328..5501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(5498..6088) product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(6308..6700) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene rpsI CDS complement(6714..7160) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene rplM CDS complement(7347..8714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(8720..10765) product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(11028..11627) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 11708..12769 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 12771..13481 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 13605..13826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 14380..15141 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(15315..16058) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene truA CDS complement(16075..16872) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(16865..17731) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(17707..18543) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 18724..19773 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 19766..21991 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(22189..22863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(23515..23895) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rplQ CDS complement(23919..24857) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(24932..25321) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rpsK CDS complement(25342..25707) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rpsM CDS complement(25885..26103) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene infA CDS complement(26247..26903) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(27063..28388) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene secY CDS complement(28388..28828) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rplO CDS complement(28861..29046) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene rpmD CDS complement(29058..29561) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rpsE CDS complement(29584..29943) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene rplR CDS complement(29981..30511) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rplF CDS complement(30542..30940) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rpsH CDS complement(31166..31708) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rplE CDS complement(31733..32044) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rplX CDS complement(32074..32442) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rplN CDS complement(32474..32737) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rpsQ CDS complement(32758..32952) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rpmC CDS complement(32942..33376) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rplP CDS complement(33380..34042) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rpsC CDS complement(34056..34409) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene rplV CDS complement(34427..34708) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene rpsS CDS complement(34748..35584) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene rplB CDS complement(35613..35915) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene rplW CDS complement(35915..36538) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene rplD CDS complement(36561..37193) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene rplC CDS complement(37219..37527) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene rpsJ CDS 37912..38349 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene psiE CDS 38597..38896 product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 38909..39838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 40415..41020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(43080..43643) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene ahpC CDS complement(43796..44878) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(45000..45848) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(46044..48146) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene fusA CDS complement(48236..48706) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpsG CDS complement(48838..49254) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene rpsL CDS 49651..50148 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013246085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(50445..54122) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rpoC CDS complement(54135..57737) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(58111..60618) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(60657..61124) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 tRNA complement(61250..61323) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(61328..61399) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(61452..61525) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(61535..61622) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(61633..61704) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(61773..61858) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(61872..61946) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(61947..62021) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 rRNA complement(62032..62143) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence021 source 1..104439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 repeat_region 1040..2201 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcagtctacgtgactgcgtgaattgaaat CDS complement(2517..3146) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene gstA CDS complement(3196..3480) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015379645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(3626..3943) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(3945..4361) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 4584..5576 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(5545..5874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(6107..6877) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(6870..7802) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 7962..8636 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674421.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 8651..9550 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 9690..11327 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(11392..12204) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(12487..13218) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(13297..14028) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene pnuC CDS complement(14257..15192) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(15225..16061) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene msrA CDS complement(16217..16903) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(16988..17857) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene sdaAA CDS complement(17905..18570) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene sdaAB CDS complement(18548..18697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(18735..19352) product DUF1054 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 19469..19915 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565031.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(20036..21997) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 22172..23467 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 23911..24189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 24250..24750 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(24922..25788) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(26163..27131) product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(27207..27587) product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(27922..28104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(28357..29793) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene sufB CDS complement(29786..30232) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(30219..31415) product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(31408..32439) product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(32432..33199) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene sufC CDS complement(33367..34020) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(34062..35114) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(35129..35962) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(36624..37445) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 38007..39131 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(39251..39550) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(39561..40766) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(40860..41081) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(41074..41379) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene yidD CDS complement(41388..41558) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(41569..42558) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(42623..42859) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(43161..43592) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(43607..45073) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene atpD CDS complement(45229..46152) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(46164..47693) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene atpA CDS complement(47717..48262) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene atpH CDS complement(48249..48737) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene atpF CDS complement(48772..48984) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564959.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene atpE CDS complement(49007..49717) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene atpB CDS complement(50016..50645) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene upp CDS complement(50686..51918) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(52094..53116) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(53198..54028) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene prmC CDS complement(54021..55100) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene prfA CDS complement(55256..55846) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 55974..57326 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(57432..58445) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594243.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(58481..59347) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594241.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 59725..60483 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(60608..62494) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(62494..64224) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(64284..64943) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(65148..65867) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564921.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 66014..66349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 tRNA complement(66702..66772) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 66899..68329 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 68585..69778 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(69861..69998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 tRNA complement(70265..70338) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(70500..70967) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(71065..71982) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 72465..73628 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 73757..74518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 74518..75369 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 75646..75933 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(76110..77450) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(77646..78503) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(78664..79269) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674405.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 79644..81902 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 81978..82724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 82734..83303 product branched-chain amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(83415..84710) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene purB CDS complement(84823..85932) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(85953..87281) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(87290..87868) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(88059..88694) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(88702..89187) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(89499..89699) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(89864..90829) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 90948..91586 product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 91747..92676 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003590398.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(92747..94399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 94753..97413 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674398.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 97833..98663 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 98706..100553 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 100569..102020 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 102552..102950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 103143..103511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 sequence022 source 1..40899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4566..6137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(6237..7292) product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(7292..8254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(8235..10055) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 10311..11423 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene glf CDS complement(11535..12383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(12373..13821) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene gtfA CDS complement(13880..14641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(14663..16231) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene asp2 CDS complement(16218..17807) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene asp1 CDS complement(17819..19057) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene secY CDS complement(19109..21442) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene secA2 CDS 21513..21701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(21716..22732) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 23125..24240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 24329..25441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 25477..26571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(27138..28058) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene galU CDS complement(28215..29288) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 29863..30072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 30093..30326 product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(30509..31555) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(31744..32568) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene map CDS 32770..33231 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(33312..34307) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(34444..35820) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(36174..36782) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(37091..38878) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene recQ CDS complement(38992..39714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 tRNA complement(39993..40066) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(40172..40594) product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 sequence023 source 1..137135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 457..1488 product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene cas1c CDS 1497..1787 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene cas2 CDS 1807..1929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 2079..2807 product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene cas5c CDS 2804..4693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 4683..5573 product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene cas7c CDS 5632..8028 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 repeat_region 8340..9507 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcagtccacgtgactgcgtgaattgaaat CDS complement(9812..10558) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(10555..11460) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(11602..12210) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(12207..13325) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(13315..14079) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565089.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(14076..14966) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 15165..16661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 16673..17692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 17689..20811 product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 20848..21660 product DUF2399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 21725..22366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 22485..24665 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 24849..25598 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 25591..26895 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 27071..27391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 27621..27989 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 27961..28800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 28751..28930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(28953..29564) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rpsD CDS complement(29740..30222) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 30399..32102 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene ezrA CDS 32487..33644 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 33662..34879 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene thiI CDS 35173..35841 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 36231..38873 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 39143..40429 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 40426..41070 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 41202..41870 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene radC CDS 42007..43008 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 43095..43955 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene mreC CDS 43959..44489 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mreD CDS 44504..45160 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 45161..45964 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene minD CDS 46575..47231 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 47244..47882 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 47879..48691 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 48965..50398 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene cls CDS 50885..51217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 51393..51824 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene mraZ CDS 51827..52768 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rsmH CDS 52781..53146 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene ftsL CDS 53143..55290 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 55305..56270 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene mraY CDS 56299..57678 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene murD CDS 57679..58770 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene murG CDS 58770..59630 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 59743..61092 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ftsA CDS 61117..62379 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ftsZ CDS 62397..62855 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 62868..63155 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 63162..63941 product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 64100..64885 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 65132..67918 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene ileS CDS 67931..68152 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570139.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(68280..69032) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 69037..69207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 69361..70581 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 note possible pseudo, frameshifted CDS 70566..70796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 note possible pseudo, frameshifted CDS complement(70915..72108) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(72114..72776) product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 73005..73556 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 73543..73803 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 73871..74581 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 74595..75758 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 75941..76282 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 76482..78752 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 78944..80077 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene mnmA CDS 80356..81018 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 81061..81729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 81716..84181 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674456.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 84188..85405 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 85691..86494 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(86893..87843) product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 87997..89145 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 89195..90169 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 90176..91225 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101258.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene citC CDS 91215..91505 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene citD CDS 91505..92419 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene citE CDS 92409..93947 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene citF CDS 93954..94499 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene citX CDS complement(94609..95559) product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(95727..97409) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(97414..97626) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 98381..98614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 99014..99568 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene def CDS 100053..100868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 101130..102242 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene pdhA CDS 102245..103222 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 103240..103821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, frameshifted CDS 103934..104881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, frameshifted CDS 104884..106287 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene lpdA CDS 106596..107489 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 107479..107760 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 107763..108542 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 108810..110654 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene typA CDS 110953..112125 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 112118..115555 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 115573..115920 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 115907..116473 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene rsmD CDS 116466..116969 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene coaD CDS 117013..118035 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020751561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 118129..118788 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 118785..120989 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 120976..122025 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene holA CDS complement(122183..122437) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene rpsT CDS 122685..122954 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene rpsO CDS 123386..124075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 124385..126067 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 126151..127056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 127274..128464 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene tuf CDS complement(129368..130093) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(130099..130473) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(130536..130919) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 131068..132804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 132990..134330 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene tig CDS 134493..135743 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene clpX CDS 135941..136543 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene yihA CDS 136540..136830 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 sequence024 source 1..65586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..2047 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene uvrC CDS complement(2157..4127) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(4137..5051) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene pfkB CDS complement(5048..5233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 note possible pseudo, frameshifted CDS complement(5230..5787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 note possible pseudo, frameshifted CDS 6035..7321 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene obgE CDS 7377..9365 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 9561..10520 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rnz CDS 10635..11417 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 11431..11757 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 11871..14477 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene clpB CDS 14658..14849 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565316.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene rpmF CDS 15189..15743 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 15740..17293 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 17384..18244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(18429..18623) product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 18719..22015 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene dnaE CDS 22127..23086 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene pfkA CDS 23146..24912 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene pyk CDS 25277..25738 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 25792..26676 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 26678..27559 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene xerD CDS 27626..28012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 27987..28712 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565341.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 28712..29323 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene scpB CDS 29313..30059 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 30350..30928 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(31097..31354) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 31437..32417 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 32404..33813 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 33873..34523 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565353.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 34589..35254 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene cmk CDS 35343..36656 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rpsA CDS 36799..38106 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene der CDS 38340..38615 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 39045..40313 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565365.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(40323..41201) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 41619..42815 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 42941..43396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 43492..45384 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003590674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 45412..46362 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 46469..46960 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(47101..47742) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 47936..48778 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 49144..49989 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 49995..50636 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 50661..51179 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245714.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene msrA CDS 51182..51424 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 51453..52511 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 note possible pseudo, frameshifted CDS 52469..52834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 note possible pseudo, frameshifted CDS 52926..53261 product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547349.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(53355..53966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(54021..54227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 54852..55709 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene ylqF CDS 55693..56448 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 56493..57308 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene dprA CDS 57559..59643 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene topA CDS 59918..61243 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674495.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene trmFO CDS 61447..62343 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene xerC CDS 62462..62986 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene hslV CDS 63025..64434 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene hslU CDS 64474..65352 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 sequence025 source 1..68060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4722..6095) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(6285..6974) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene rplA CDS complement(7073..7498) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene rplK CDS complement(7784..10354) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene mgtA CDS 10838..12313 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(12669..13205) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(13232..13720) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(13768..14160) product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(14185..16431) product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene nrdJ CDS complement(16624..17067) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(17146..17991) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580738.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(18001..18555) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene nusG CDS complement(18658..18828) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567177.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene secE CDS complement(19127..20086) product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(20083..21021) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(21076..22146) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(22363..23274) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 23562..25460 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 25648..26094 product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 26091..26654 product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 26896..27144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 note possible pseudo, frameshifted CDS 27069..28076 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, frameshifted CDS 28253..29230 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(29662..29853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(29868..30125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 31248..32078 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 32355..32852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(33119..33991) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(33984..35225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(35218..36330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(36527..37210) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(37210..38043) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 note possible pseudo, frameshifted CDS complement(38040..38264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 note possible pseudo, frameshifted CDS 38458..38712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 38714..39133 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(39221..40684) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 40850..41515 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228211.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 41752..41922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(42562..43101) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576196.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(43104..43886) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene rlmB CDS complement(43855..44286) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(44283..45644) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003659543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene cysS CDS complement(46261..46521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(46568..47962) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(48138..49631) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene gltX CDS complement(49780..50607) product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(50812..51999) product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(52344..53120) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(53146..54024) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 54304..55200 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(55296..56411) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(56436..57632) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene radA CDS complement(57820..58359) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 58623..58913 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 59285..60604 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 60734..62080 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 62392..63492 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 63492..64685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 64700..65578 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 65739..67793 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 sequence026 source 1..42434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 814..984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1097..1810) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1803..2519) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(2506..2886) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566227.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 3084..3914 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(4018..5046) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(5175..5912) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 6090..6284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(6531..7163) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(7160..8776) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(8763..9680) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(10017..10772) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(10902..11363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(11368..11748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 note possible pseudo, frameshifted CDS complement(11751..12092) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(12322..12828) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 12877..13434 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 13511..13768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 14052..15401 product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 15746..16078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 16083..16475 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 16502..17626 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 17681..17824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 17826..18830 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene citC CDS 18820..19125 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene citD CDS 19113..19991 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 19991..21523 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene citF CDS 21516..22064 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene citX CDS 22057..23460 product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 23589..24284 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 24277..25128 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene citG CDS complement(25199..25597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 25817..26380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(26468..27277) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 27415..28275 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(28387..28536) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene rpmG CDS complement(28600..29178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674612.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(29421..30452) product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 30839..31363 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 31483..32031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 32394..34070 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene alsS CDS 34138..34848 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene budA CDS 35247..36707 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(36857..38386) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566131.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 38631..40208 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 40694..41977 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene serS sequence027 source 1..26265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 383..868 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(924..1829) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1884..2768) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 3218..3646 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 3661..4170 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 4315..4836 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(4983..6086) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 6408..7409 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ccpA CDS complement(7533..10286) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 10607..11290 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(11303..12049) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(12194..13597) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene pepV CDS complement(13751..15091) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 15219..15533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 15736..16803 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593697.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 16800..17327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 note possible pseudo, frameshifted CDS 17297..17536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 note possible pseudo, frameshifted CDS 17538..18140 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 18241..19617 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 19683..20309 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 20318..21094 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 21095..21715 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(21809..22462) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(22549..23052) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566812.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(23095..24081) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 24377..24961 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 25049..25408 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 sequence028 source 1..40425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(721..1449) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1449..2402) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594607.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene prmA CDS complement(2468..2962) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(2959..3504) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 3669..3917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(4070..4456) product DUF1093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(4852..5055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(5055..5498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 tRNA complement(5703..5790) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(7164..7958) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(8060..8377) product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(8394..8894) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene ybaK CDS complement(8982..9509) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(9506..11800) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene recJ CDS 12101..12472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 12662..13138 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 13144..13365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(13517..15355) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene lepA CDS complement(15665..16834) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene dnaJ CDS complement(16948..18819) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene dnaK CDS complement(18849..19442) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene grpE CDS complement(19510..20556) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene hrcA CDS complement(20713..21858) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene hemW CDS complement(21860..22804) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene ribF CDS complement(22809..23717) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene truB CDS complement(23771..24409) product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(24680..25033) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene rbfA CDS complement(25237..28020) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene infB CDS complement(28041..28340) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(28343..28636) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(28648..29859) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565788.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene nusA CDS complement(29876..30355) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rimP CDS complement(30608..34942) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(35072..36802) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(36826..38067) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rseP CDS complement(38084..38872) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(38908..39660) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(40249..40425) product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080468098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 sequence029 source 1..74607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1797) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1794..2525) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(2542..2937) product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 tmRNA 3052..3412 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3831..6125) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(6359..7231) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(7228..8184) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(8185..9024) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(9021..9785) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(10181..11542) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(11831..12289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(12998..14011) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(14118..14432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(14429..14899) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564408.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(14859..15197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(15140..15454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(15577..15897) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(15900..16856) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(16853..17728) product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(17853..18584) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(18655..19143) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 19217..21022 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(21161..22972) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene glmS CDS complement(23537..24901) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene glmM CDS complement(24930..26021) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(26018..26875) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene cdaA CDS 27090..27827 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 27817..28959 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674350.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 28991..29635 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 29764..32577 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(32733..32924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(33232..34305) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674347.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(34289..35122) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(35112..35936) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(36033..37121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(37135..37674) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(37944..40055) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(40089..40991) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene murB CDS 41349..42107 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 42119..42661 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(42865..44124) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(44117..45013) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(45208..45672) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene tsaE CDS complement(45669..46646) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene pta CDS complement(46835..47524) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564334.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 47643..48536 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 48588..49094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(49201..49773) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 50073..51134 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674342.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 51124..52017 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 52033..52854 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 52864..54180 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 54441..55682 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(55729..55917) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(55924..56208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(56429..56722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(56923..57585) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene pgmB CDS complement(57578..59839) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674340.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(59887..61632) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(62144..62617) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene smpB CDS complement(62678..65047) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene rnr CDS complement(65049..65783) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(66024..66260) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene secG CDS complement(66359..67939) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(68074..69378) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene eno CDS complement(69427..70182) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene tpiA CDS complement(70261..71451) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564267.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(71631..72653) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene gap CDS complement(72690..73727) product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 tRNA 74332..74405 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence030 source 1..54516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..1413) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1418..1597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1563..3266) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101791.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(3263..3733) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(3850..4272) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(4269..4454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(4459..4794) product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(5139..6734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(6738..7550) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(7534..7719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(7719..8009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(8058..8249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(8233..8367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(8360..8755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(8823..9098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 9255..9974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 10126..11283 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 11653..12003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 12064..12993 product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 13206..13604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016385607.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 13843..14700 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 15165..15443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 note possible pseudo, internal stop codon, frameshifted CDS 15543..16136 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 16277..17671 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(17885..18994) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(19526..21685) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013246152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(21678..22670) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(22675..23610) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 23851..24474 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(24581..25129) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 25336..26796 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 27075..28529 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 28526..29266 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568275.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(29427..30314) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(30446..30853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 note possible pseudo, frameshifted CDS complement(30817..31221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 note possible pseudo, frameshifted CDS complement(31251..32774) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(32767..33237) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(33463..33786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 33938..34276 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 34348..35061 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 35262..36533 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 36560..36814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(36968..37714) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(37833..39425) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 40742..41014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 40983..41405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(41584..42603) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 42704..43975 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101066.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 44209..45186 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568240.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 45212..46030 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 46048..46959 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 47260..47625 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(47756..48685) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(48772..49962) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(50044..51465) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(51709..52332) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(52654..53142) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(53142..53606) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 53866..54426 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 sequence031 source 1..10844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(619..1098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1221..1649) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1683..2507) product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene agaD CDS complement(2494..3300) product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene agaC CDS complement(3331..3825) product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene agaB CDS complement(4550..5560) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(5593..6588) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(6631..8088) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(8085..9080) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene galE CDS complement(9146..10312) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674227.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 sequence032 source 1..9857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..624) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563820.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 792..950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 tRNA complement(1070..1142) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(1167..1241) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1347..2357) product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674257.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2392..2712) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2886..3191) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 3344..3643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(3673..4698) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674258.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 5085..5447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(5538..6017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(6010..7179) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 7659..7853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 7980..8606 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene lexA CDS complement(8919..9368) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene tnpA sequence033 source 1..18604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..655) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(704..1945) product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003589794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene lacG CDS complement(1989..2129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 note possible pseudo, frameshifted CDS complement(2156..3880) product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(3893..4768) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 5294..6019 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 6249..7766 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene glpK CDS 7818..9671 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene glpO CDS 9686..10393 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(10577..11938) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene celB CDS complement(11991..12518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(12493..12852) product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(12859..14847) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(14929..15243) product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(15302..16735) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 misc_feature complement(17343..>18604) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164691239.1:SpaA isopeptide-forming pilin-related protein locus_tag LOCUS_19190 sequence034 source 1..40494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 561..788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 1067..1876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1966..2412) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2668..3945) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(4131..4610) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rlmH CDS 4757..5857 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 5894..6877 product pectin utilization transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene kdgR CDS 7151..7912 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 7905..8156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 8169..9446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 9596..10570 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 10570..11196 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 11193..11735 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene hxlB CDS 12151..12990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(13371..13886) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 14014..14193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 14207..14956 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 note possible pseudo, frameshifted CDS 14969..15745 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 15970..17151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 17353..18135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(18290..18445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(18664..20490) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(20907..21350) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(21623..22027) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(22621..23952) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(24288..25124) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(25175..25972) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(26124..27527) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene yycH CDS complement(27517..29427) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene walK CDS complement(29443..30156) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene yycF CDS 30490..31164 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 31259..32707 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 32731..33951 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 33944..35335 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene argH CDS complement(35589..36695) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(36713..37132) product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(37172..38533) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(38692..39402) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 39519..39848 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 39845..40174 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 sequence035 source 1..7338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1114..1395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 1448..1780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(1887..2207) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2569..2850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2847..3254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(3276..4211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 4479..4802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(4829..5329) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(5322..5861) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675026.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(5938..6687) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 sequence036 source 1..34043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 466..1134 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(1233..2126) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2282..3049 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 3358..5511 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 6200..6601 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674733.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 6918..8849 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 8984..9814 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043926054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(10476..10880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(10902..11057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 11197..11574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(11780..12811) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 13281..15314 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene glgB CDS 15685..16827 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003659327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 16824..17993 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene glgD CDS 17986..19431 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene glgA CDS 19581..21998 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 22306..24084 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(24285..25214) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 25365..25721 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 25868..26812 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566598.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 27150..28421 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene tyrS CDS 28721..29926 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 30134..30541 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 30660..31262 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 31555..32007 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674721.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 32270..32728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566574.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 32749..33738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 sequence037 source 1..33242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..213 product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080468098.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 689..2269 product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2512..2694) product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2865..4007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 4092..4874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 5013..7442 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 7708..8391 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(8750..9124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 9183..9455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 9628..9909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 10027..10527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(10740..11069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 11955..14273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 note possible pseudo, internal stop codon CDS 14793..15353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 15372..16112 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 16109..17443 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(17549..18304) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 18523..19365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 19497..20411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 note possible pseudo, frameshifted CDS 20381..21061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 note possible pseudo, frameshifted CDS 21192..21590 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 22013..23617 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 23610..25271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 25443..25706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 26714..26845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(27500..27667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 28095..28307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 note possible pseudo, frameshifted CDS 28822..28992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(29359..29538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 29638..31032 product IS5-like element ISLca2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(31088..31375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 sequence038 source 1..11496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 535..1452 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene gnd CDS 1472..3040 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene gntK CDS 3205..4557 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 5214..6362 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 note possible pseudo, frameshifted CDS 6407..7219 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573146.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 7222..7917 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 7952..8839 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 8881..9654 product TcdA/TcdB catalytic glycosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 sequence039 source 1..17427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..902 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013245429.1:serine hydrolase domain-containing protein locus_tag LOCUS_20370 CDS complement(996..2729) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 3168..4049 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene fba CDS 4329..4601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(4688..5263) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(5253..5894) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(5965..7128) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(7208..7501) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 7691..9103 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 9520..9948 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 10140..11159 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563420.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene dhaK CDS 11146..11727 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene dhaL CDS 11786..12154 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene dhaM CDS 12245..12811 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 12900..13028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563412.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 13041..14735 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 15004..15981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(16064..17080) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674109.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 sequence040 source 1..8117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 448..1620 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(1756..2775) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564081.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2788..3816) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(3819..5027) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569394.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 6811..7353 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 sequence041 source 1..4280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(426..878) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 1177..2376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2866..3543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 3814..3975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 note possible pseudo, internal stop codon, frameshifted sequence042 source 1..4811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..855 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(899..1105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 1426..1860 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 1883..2386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2529..2864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2842..4149) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 sequence043 source 1..5461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 1424..1678 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2080..3201 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 3291..3506 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 3503..4432 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 4429..5190 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 sequence044 source 1..4370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 298..573 product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564087.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 1061..3157 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 3385..3846 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 sequence045 source 1..247623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..944) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene frr CDS complement(944..1663) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene pyrH CDS complement(1894..2775) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene tsf CDS complement(2860..3648) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rpsB CDS complement(3786..4070) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(4060..4803) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 4877..5527 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 5768..7162 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 7203..7985 product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(8070..9878) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(9868..11625) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(11819..12040) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(12101..12346) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(12378..12554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(13076..13423) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene rplS CDS complement(13623..14411) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene trmD CDS complement(14401..14919) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene rimM CDS complement(15096..15497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(15808..16062) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(16075..16350) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene rpsP CDS complement(16446..17882) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674546.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene ffh CDS complement(17895..18239) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 18481..18672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 18776..19090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(19303..20298) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene ftsY CDS complement(20298..23852) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660728.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene smc CDS complement(23872..24567) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575305.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rnc CDS complement(24659..26452) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(26656..27567) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(27584..28546) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(28546..29499) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(29502..30524) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564728.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(30927..31169) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564726.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene acpP CDS complement(31223..32248) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene plsX CDS complement(32272..34311) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564722.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene recG CDS complement(34421..36097) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660710.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(36158..36520) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(36743..36928) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564715.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene rpmB CDS complement(37084..37752) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(37749..38399) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564711.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene rpe CDS complement(38684..39409) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rsgA note possible pseudo, frameshifted CDS complement(39340..39588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 note possible pseudo, frameshifted CDS complement(39585..41573) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene pknB CDS complement(41570..42313) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(42323..43663) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene rsmB CDS complement(43650..44606) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene fmt CDS complement(44658..47075) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene priA CDS complement(47080..48279) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene coaBC CDS complement(48498..48746) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene rpoZ CDS complement(48807..49433) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene gmk CDS complement(49500..50183) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 50307..50609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(51015..52712) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene recN CDS complement(52717..53169) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(53272..54102) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564679.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(54102..54950) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(54947..55174) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(55167..56516) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene xseA CDS complement(56509..57360) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene folD CDS complement(57486..57905) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene nusB CDS complement(57895..58350) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(58371..58934) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene efp CDS complement(59022..60089) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(60164..60454) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene rpmA CDS complement(60473..60823) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(60835..61146) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene rplU CDS complement(61421..61852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(61870..61992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 tRNA 62168..62242 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(62487..64880) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(65124..66464) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene glnA CDS complement(66483..66845) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 67152..69242 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(69340..70602) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(70586..71545) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene miaA CDS 71614..71793 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(71864..72271) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(72294..73256) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(73249..73503) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(73500..74189) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(74380..76506) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 76652..79234 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(79333..79632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(79613..80278) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(80271..81335) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(81332..82036) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564600.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene liaF CDS complement(82264..82797) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene greA CDS complement(82801..83439) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene udk CDS complement(83672..84823) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene mltG CDS complement(85002..87413) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene pheT CDS complement(87415..88461) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene pheS CDS complement(88842..89228) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003602575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(89459..89962) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(90046..90807) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 91053..91334 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 91393..92379 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene yidC CDS complement(92542..94128) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(94128..94814) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(94880..95050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(95202..96620) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene gndA CDS complement(96889..97437) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(97495..98640) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(98688..99425) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(99422..99781) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene rsfS CDS complement(99785..100384) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene yqeK CDS complement(100377..101027) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(101036..101347) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene yhbY CDS complement(101432..102556) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene yqeH CDS complement(102537..103073) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 103315..104214 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 104207..105175 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 105191..105625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 note possible pseudo, frameshifted CDS 105585..105833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 note possible pseudo, frameshifted CDS 105839..106807 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565862.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 106885..107448 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(107642..107998) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene rplT CDS complement(108033..108233) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene rpmI CDS complement(108311..108775) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024109467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene infC CDS complement(109023..109718) product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(109711..110100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(110255..112228) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene thrS CDS complement(112691..113647) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene dnaI CDS complement(113647..114999) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(115069..115536) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene nrdR CDS complement(115591..116193) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene coaE CDS complement(116190..117038) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene mutM CDS complement(117050..119695) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene polA CDS complement(119869..120579) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(120684..120950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(120983..121951) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(122096..122440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(122491..123282) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(123317..126883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(127232..128749) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(129020..130345) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565897.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene murC CDS complement(130342..132708) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(132864..133505) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565901.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(133520..133837) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565903.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 133996..134376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(134330..134968) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene trmB CDS complement(135091..135864) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(136072..137286) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(137283..138014) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 138112..138546 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 138543..138902 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 139049..139954 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(140053..141021) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(141213..141560) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(141583..143625) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 143737..144567 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(144669..145124) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565933.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(145174..146856) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene argS tRNA complement(147077..147147) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 147315..147701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565937.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 147714..147896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 148026..148967 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 148964..150781 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(150908..151591) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579619.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(152284..152682) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene spxA CDS complement(152934..153671) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 153740..154246 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(154413..156488) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(156472..157242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 157409..158083 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 158093..159172 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594860.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(159302..159880) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576044.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene nrdG CDS complement(160093..162294) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(162284..162727) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(162938..164182) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene purD CDS complement(164447..165970) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene purH CDS complement(165971..166540) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene purN CDS complement(166537..167547) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene purM CDS complement(167544..168998) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene purF CDS complement(168974..171190) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene purL CDS complement(171177..171863) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594882.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene purQ CDS complement(171860..172120) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene purS CDS complement(172113..172838) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(172835..173950) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene purK CDS complement(173947..174432) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene purE CDS complement(174790..175395) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene thiT CDS complement(175702..177126) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(177390..179114) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene ptsP CDS complement(179114..179380) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(179522..179713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674598.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 180063..182162 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658650.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 182324..182617 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(182747..184321) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(184388..185746) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(185820..186998) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 187075..187509 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(187621..188139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(188165..188701) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(188775..189572) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene recX CDS 189645..191165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(191177..191557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 191634..193001 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene rlmD CDS 193087..193566 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(193637..195391) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene spxB CDS complement(195638..196840) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594933.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(196824..198104) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(198114..199295) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 199733..200032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(200029..200859) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(201034..201597) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 201711..202529 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594938.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(202614..203756) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(203802..204407) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 tRNA 204619..204707 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 204809..205273 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594941.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(205266..205718) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(205970..206722) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(206715..207614) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(207611..208606) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene trpX CDS complement(209300..209737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(209803..212466) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(212716..213882) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(213992..214819) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene nadE CDS complement(214819..216015) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(216017..217480) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566087.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(217681..218382) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(218407..219552) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575514.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene nagA CDS complement(219662..220459) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene proC CDS complement(220462..222438) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(222846..228359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 228669..230159 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674982.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 tRNA complement(230325..230408) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(230503..231336) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674606.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(231383..232849) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(233216..235534) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591104.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(235745..236119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(236170..236592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 237167..238597 product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene melB CDS complement(238752..239069) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(239228..240886) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674608.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(241318..241479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(241476..242561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(242634..242969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 note possible pseudo, frameshifted CDS complement(243192..243950) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 244089..244289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 tRNA complement(244461..244535) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(244538..244611) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 244809..245447 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 245487..245975 product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(246040..246561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 tRNA complement(246830..246903) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 rRNA complement(246914..247025) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence046 source 1..3893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..500 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 513..977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 989..1174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 1171..1704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 1694..2068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2065..2301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2298..2705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 3213..3641 product DUF1492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 sequence047 source 1..3545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 499..693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 tRNA complement(950..1035) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1080..1150) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(1197..1268) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(1275..1348) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(1357..1428) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(1434..1516) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(1519..1593) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1639..1716) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1721..1796) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1806..1897) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1906..1979) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(1982..2071) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(2095..2170) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(2183..2253) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(2273..2345) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(2350..2425) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(2430..2505) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(2551..2627) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(2634..2709) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2735..2808) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2813..2888) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(2948..3019) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(3053..3127) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(3168..3242) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(3243..3317) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 rRNA complement(3328..3439) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 sequence048 source 1..2552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..1983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674127.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2160..2444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 sequence049 source 1..3391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..758 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674118.1:aldo/keto reductase locus_tag LOCUS_23300 CDS complement(767..1789) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 1909..2253 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563463.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2345..3094) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644715.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 sequence050 source 1..1398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 457..1155 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596235.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 sequence051 source 1..1144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..549 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674117.1:APC family permease locus_tag LOCUS_23360 CDS complement(869..1144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 sequence052 source 1..3355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(303..464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 892..2349 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674478.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2339..3085 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 sequence053 source 1..804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence054 source 1..1082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..749) product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563498.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 sequence055 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence056 source 1..109266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..700) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(720..968) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(1067..2206) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene alr CDS complement(2193..2567) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene acpS CDS complement(2809..4320) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(4664..6055) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(6412..7170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576482.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 7256..7897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571475.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(7909..8586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 8682..9110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(9466..9717) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(9814..11073) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(11555..13159) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(13324..14208) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(14391..15056) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene rpoE CDS complement(15108..15554) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567697.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 15697..16521 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 16662..18014 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(18026..18478) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 18550..19599 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 19690..20070 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571482.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene mscL CDS complement(20181..20606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(20703..21032) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(21223..22197) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(22295..23683) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene glmU CDS complement(23921..25093) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(25090..25938) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene purR CDS 26159..26809 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567726.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 26806..27567 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567728.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene fetB CDS complement(27667..28545) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(28597..29475) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene ispE CDS complement(29706..29957) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567734.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(30067..30963) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene rsmA CDS complement(30950..31519) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene rnmV CDS complement(31516..32295) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(32300..32794) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 33013..34011 product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 34291..35172 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 35329..36033 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 36020..36931 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 36985..38811 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 38798..40711 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(40773..42755) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene metG CDS complement(42858..43736) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(43881..44693) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(44686..45165) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(45264..46169) product L-2-hydroxyisocaproate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567764.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(46258..46854) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567766.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(46889..47581) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(47918..48847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674945.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 48988..49497 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(49751..51127) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(51154..52125) product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene yfdV CDS complement(52335..52613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(52648..53631) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(53724..54665) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene ppx CDS complement(54662..56827) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(56824..58410) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567781.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 58804..59628 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606086.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 59654..60160 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571512.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(60240..61595) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(61830..62690) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469034.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(62699..63307) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(63446..64462) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567794.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene trpS CDS complement(64783..66108) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674951.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(66114..67070) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(67070..68602) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 68756..71044 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene helD CDS 71279..72103 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(72128..73099) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(73258..73905) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576567.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 tRNA complement(74088..74160) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(74310..74954) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 75091..75507 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 75661..78189 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674953.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(78261..79265) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(79612..80424) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(80587..80931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 81139..81402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 81807..82484 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(82481..83182) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(83490..83819) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578579.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(83857..85161) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(85176..86129) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 86339..86695 product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564504.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(86953..87309) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564501.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(87440..88084) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 88513..88707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 88745..89668 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 89868..90740 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 90856..91311 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(91394..91648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 91772..92647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(92719..93534) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(93640..94845) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(95099..96460) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484116.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene rlmD CDS complement(96462..97496) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(97713..99143) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene gatB CDS complement(99145..100599) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene gatA CDS complement(100603..100899) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene gatC CDS complement(100952..102103) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(102116..104140) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene ligA CDS complement(104186..106438) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene pcrA CDS 106726..107511 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 107767..108711 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 108796..108966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 sequence057 source 1..370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 sequence058 source 1..876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence059 source 1..1019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(584..925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674672.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 sequence060 source 1..1760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..925) product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110876019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(1091..1636) product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 sequence061 source 1..56581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..1146) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(1133..2134) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2190..2399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 2302..3756 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 3753..4256 product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(4420..4968) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674830.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(4965..6920) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene mutL CDS complement(6925..9498) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene mutS CDS complement(9730..9879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(9930..11759) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591549.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(12157..12498) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(12734..14368) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene groL CDS complement(14404..14685) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene groES CDS 14843..15487 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 15570..16628 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(16724..17767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(17768..18655) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641901.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(18652..19020) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(19127..19780) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567066.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 19999..21951 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674834.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(22067..22393) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(22491..23513) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene tsaD CDS complement(23549..24082) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene rimI CDS complement(24066..24788) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene tsaB CDS complement(24943..25548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(25742..26260) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 27034..28008 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(28110..28853) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567089.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(29170..30030) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene rsmI CDS complement(30032..30370) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(30375..31352) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene holB CDS complement(31352..31681) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(31846..32370) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580656.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene tmk note possible pseudo, frameshifted CDS complement(32613..32876) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567100.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(32876..33475) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene recR CDS complement(33568..33876) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(33893..35593) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567107.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene dnaX CDS complement(35901..36416) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene tadA CDS complement(36695..37021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567111.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(37079..37675) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(37762..40371) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674838.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene mprF CDS 40676..41089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 41202..42137 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674839.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(42500..42868) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene rplL CDS complement(42910..43416) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567140.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene rplJ CDS 43738..44970 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567142.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(45087..45920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020967576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(45901..46431) product DUF3278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 46688..47908 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(48121..49677) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(49691..51208) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(51354..51545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(51673..53253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 54130..54675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 note possible pseudo, frameshifted CDS 54653..55255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 55320..55484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 55976..56218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 sequence062 source 1..95871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..728 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene tnpA CDS complement(886..1659) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673939.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(1920..2558) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2789..4165 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 4307..4918 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 5421..7031 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 7018..8859 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 8927..10369 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 10559..11194 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 11311..12021 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 12008..12337 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 12770..14581 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene uidA CDS 15221..15817 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(15945..16595) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(16675..17646) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(17671..19101) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene uxaC CDS complement(19101..20186) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene uxuA CDS complement(20191..21825) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(22025..23602) product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(23659..24954) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 25833..26525 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 26593..27612 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 27642..30161 product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638992.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 30213..31130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(31362..31565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 31669..31989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(32126..33508) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(34136..37432) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(37429..38031) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572929.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(38326..38952) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(39075..40220) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(40224..40607) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(40600..41982) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(41979..42731) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(43171..43833) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(43833..44762) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(44774..45403) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(45406..46653) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(47310..48593) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101909.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 48898..50754 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673964.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 50774..51001 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 51013..51594 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577285.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 51655..52311 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592583.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 52519..54213 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262784.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 54370..54894 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262785.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(55319..55459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(55484..55864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 56063..56518 product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(56628..57461) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 58076..59266 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(59409..59720) product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832602.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(59891..61720) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 61878..62459 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(62509..62835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(63950..64462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(64449..64994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(65210..65479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(65629..66396) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592624.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene dapB CDS complement(66393..67298) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572968.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene dapA CDS complement(67492..68643) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(68650..69354) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673976.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene dapD CDS complement(69364..70710) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene lysA CDS 71453..72832 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 72834..73841 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592633.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene dapF CDS 73847..74905 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 75377..75709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 75977..76261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 76550..76963 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572982.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 76956..77822 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673979.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 78938..80944 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673985.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 80979..81434 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562688.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene rplI CDS 82031..83416 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562690.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene dnaB CDS 83726..84889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673986.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(84981..86990) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(86992..87915) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene murQ CDS complement(87950..88993) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(89199..90068) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592665.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 90482..91774 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562710.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 92223..94076 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673988.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 94145..94489 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(94917..95366) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene tnpA sequence063 source 1..65639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 508..681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 817..2805 product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2939..3214 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125586694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(3272..3463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 3847..4317 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 4515..4907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(5502..6434) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene rbsK CDS complement(6658..7617) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(7686..8666) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(8650..10152) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(10333..10725) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene rbsD CDS complement(10753..11769) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568895.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(12175..13008) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674048.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene thiD CDS complement(13010..13639) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene thiE CDS complement(13636..14478) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(14653..15153) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563188.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene thiW CDS complement(15134..15826) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674045.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene tenA CDS complement(15889..16536) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245388.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(16541..17884) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674043.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(17888..18586) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(20018..21469) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 21762..23009 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene pepT CDS complement(23148..23429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(23496..24092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 24298..24465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(24586..25824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(26031..26894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(27124..27423) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(27420..27923) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861526.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 28227..29576 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 29658..30461 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(30599..30979) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(31121..31942) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(31929..32840) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(32853..33335) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(33596..35377) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(35478..36638) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene nagA CDS complement(36710..37891) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(37950..38666) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(39216..40187) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene manA CDS complement(40614..40811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(40808..40948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(41071..42789) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674041.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(43048..43698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(43992..45284) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 45625..48012 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592867.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 47990..48670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674040.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 48667..49503 product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 49636..51009 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592860.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(51171..52607) product cell wall hydrolase P75 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592858.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene msp1 CDS complement(52802..53518) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene deoD CDS complement(53545..54735) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(54737..55402) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene deoC CDS 55825..57141 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674035.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 57134..58036 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(58147..58863) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(58856..59641) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573329.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(59638..60591) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(60596..61474) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(61510..62703) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(63373..63831) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(63849..64625) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(64622..64942) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 rRNA complement(65248..65359) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence064 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence065 source 1..650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence066 source 1..808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 note possible pseudo, frameshifted CDS 304..804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 note possible pseudo, frameshifted sequence067 source 1..500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence068 source 1..1359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 49..1290 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 sequence069 source 1..517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence070 source 1..625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence071 source 1..735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(205..>735) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476585.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_26570 sequence072 source 1..503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence073 source 1..657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..614 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_125982402.1:DDE-type integrase/transposase/recombinase locus_tag LOCUS_26580 sequence074 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence075 source 1..727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 518..629 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 639..713 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 sequence076 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence077 source 1..794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence078 source 1..1133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence079 source 1..607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence080 source 1..11946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 356..904 product DUF1642 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 888..1097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 1444..1572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 1562..1768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 1768..1950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 1947..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 2351..2653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 2650..3207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 3276..3443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 3517..3942 product DUF1492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674659.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 4576..5724 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674656.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 5717..6046 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010493173.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 6043..6399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 6499..7308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 7504..7959 product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 7981..9693 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296487.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 9705..9896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 9901..11154 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 11126..11737 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905416.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 sequence081 source 1..4997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 127..456 product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577145.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 456..842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 842..1228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 1262..1870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 1933..2112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 2186..2599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 sequence082 source 1..3357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 386..1216 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 1477..2406 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577893.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene cysK tRNA 2893..2964 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(3092..3355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 sequence083 source 1..14513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2849..4786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 4792..7239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 7249..7572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674636.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 7726..8016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674634.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 8009..8455 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674633.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 8465..9754 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 10047..10496 product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 10619..10963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(11407..12576) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(12747..13424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(13486..14259) product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090697.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 sequence084 source 1..4832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 540..755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 780..944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 note possible pseudo, frameshifted CDS 976..1503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 1500..1676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(1638..1883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 1958..2314 product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003572199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 2314..2442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 2435..2587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 2589..2795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 2814..3299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3300..4007 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 4011..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 4586..4801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 sequence085 source 1..690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence086 source 1..922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 sequence087 source 1..1708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(493..738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 misc_feature complement(750..>1708) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905714.1:phage major capsid protein locus_tag LOCUS_27170 sequence088 source 1..5294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(180..3093) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA complement(3256..3330) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(3364..3437) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 rRNA complement(3527..5092) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 sequence089 source 1..1761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 note possible pseudo, frameshifted CDS complement(961..1686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 note possible pseudo, frameshifted sequence090 source 1..1732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..814) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125982402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(949..1626) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010012236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 sequence091 source 1..937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence092 source 1..1312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 19..648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 sequence093 source 1..6658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..1190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 note possible pseudo, frameshifted CDS complement(1245..2687) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577866.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(2653..2883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(3129..5663) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(5859..6044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 sequence094 source 1..1517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..1414 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020751524.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 sequence095 source 1..674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence096 source 1..570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence097 source 1..1305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(516..929) product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967809.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 sequence098 source 1..788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(56..>788) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674639.1:IS30 family transposase locus_tag LOCUS_27310 sequence099 source 1..1845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1458) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 sequence100 source 1..2051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..530) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene tnpA CDS 605..1855 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 sequence101 source 1..847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence102 source 1..972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 sequence103 source 1..486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence104 source 1..662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence105 source 1..954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(618..869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 sequence106 source 1..481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence107 source 1..791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence108 source 1..741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 sequence109 source 1..2111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..1565) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 1640..2089 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene tnpA sequence110 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence111 source 1..681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 sequence112 source 1..628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence113 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence114 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@