COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..260511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..1327) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647570.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene pheA CDS complement(1409..2065) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rnt CDS complement(2127..2534) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene gloA CDS 2617..3408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3470..4405) product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene htrB CDS 4533..5960 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene hldE CDS 6039..6407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 6882..9833 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene rne CDS 10013..13492 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene dnaE CDS complement(13538..14002) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032823702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 14242..16116 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(16179..18854) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene gyrA CDS complement(18972..19451) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene folK CDS complement(19451..20956) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene pcnB CDS complement(21022..21471) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene dksA CDS 21765..24053 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 24138..25904 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene msbA CDS 25923..26903 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene lpxK CDS 26900..27100 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 27102..27860 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene kdsB CDS 27885..28544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 28544..30373 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene uvrC CDS 30650..31906 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050845826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene sstT CDS complement(31992..32261) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rpsO CDS complement(32451..33872) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(34005..35201) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(35375..36823) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene tldD CDS complement(36968..38443) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rng CDS 38581..40098 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene putP CDS complement(40225..42831) product TonB-dependent zinc piracy receptor TdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene tdfH CDS 43225..44463 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(44557..45825) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(45918..47210) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene dcuC CDS complement(47222..47926) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene pepE CDS complement(48099..48758) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(48820..50286) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene guaB CDS 50418..51182 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene birA CDS complement(51208..51672) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rimI CDS complement(51675..52100) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene holD CDS 52353..53348 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rsmC CDS 53437..54057 product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(54110..54880) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(54967..55458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(55745..57784) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene prlC CDS complement(57868..58728) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene pdxY CDS complement(58874..59827) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene accA CDS complement(59929..60699) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 60774..61433 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene seqA CDS 61439..62884 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene menE CDS 62877..66188 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene mscK CDS 66197..69493 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene mscK CDS 69511..70593 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene aroC CDS 70716..71585 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene mepA CDS 71597..72361 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 72361..73314 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene lpxM CDS 73396..73938 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene apt CDS 73966..75966 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene dnaX CDS complement(75998..77977) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rnb CDS complement(78055..78837) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 79100..79309 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 tRNA complement(79433..79509) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(79631..80581) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene hemH CDS complement(80592..81014) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(81019..84105) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 84634..85677 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ompA CDS 85832..86413 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 86429..86872 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 86865..87656 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123956445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 87722..88048 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene grxD CDS 88172..88939 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 88975..90807 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112119346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene glmS CDS 90951..92222 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(92261..93616) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693728.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(93626..94015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(94016..94561) product competence protein ComC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene comC CDS complement(94558..95109) product competence protein ComB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene comB CDS complement(95087..96028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 96166..98769 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118806713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 98828..99673 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693720.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 99768..101123 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene gorA CDS 101196..102665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 102739..103854 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112089645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene mltA CDS 103854..104618 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162627419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene tcdA CDS 104702..105682 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene znuA CDS 105832..106119 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene hfq CDS 106134..107507 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene hflX CDS complement(107488..108792) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene tilS CDS 108834..109235 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(109192..109830) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(109827..110471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(110468..111079) product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene cbiM CDS complement(111088..111570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(111570..112250) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 112357..112764 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(112761..113099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(113200..114066) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene tesB CDS 114283..116307 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene uvrB CDS complement(116352..117572) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene fabB CDS 117750..119777 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene mnmC CDS complement(119800..120387) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146104764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene grpE CDS 120571..121395 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 121483..123159 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene recN CDS complement(123208..123753) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene yjgA CDS 123855..125210 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene pmbA CDS 125476..126015 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene hpt CDS complement(126077..127459) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(127558..128409) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(128475..129803) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene gudD CDS complement(129852..131189) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 131555..132325 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene garL CDS 132444..133331 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene garR CDS 133497..134630 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 134646..135797 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene cdaR CDS 136054..137028 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 137098..137607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 137618..139102 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(139179..140600) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene lpdA CDS complement(140696..142594) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene aceF CDS complement(142647..145310) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene aceE CDS complement(145580..146947) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 147207..147779 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene lptC CDS 147763..148278 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene lptA CDS 148290..149015 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene lptB CDS 149021..149596 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ptsN CDS 149577..150434 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene rapZ CDS 150556..151839 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(151885..153240) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(153251..153523) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(153602..156199) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene acnB CDS complement(156378..157394) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(157420..158217) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(158217..159203) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(159311..159736) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001516948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 159964..162348 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 162474..163715 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene mtr CDS 163731..164480 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 164715..165107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(165110..165256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(165332..166135) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 166335..168017 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 168014..169459 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 169572..170171 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 170305..171315 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 171305..172126 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650376.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 172317..173705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 173718..176570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 176580..177569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 177609..179108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 179198..180100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 180180..181499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 181509..182501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 182831..184237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 184242..187202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 187212..188225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 188743..189636 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene hisG CDS 189772..190017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 190031..190531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 190535..191821 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene hisD CDS 191823..192287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 192321..193259 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rhuM CDS 193346..193504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 193517..194572 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene hisC CDS complement(194556..194888) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 195014..196105 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene hisB CDS 196256..197101 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 197210..197581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 197615..198574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 198667..199260 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene hisH CDS 199397..200245 product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 200285..201031 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene hisA CDS 201013..201786 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene hisF CDS 201973..202398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 202364..203005 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene hisIE CDS complement(203065..204354) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene brnQ CDS complement(204373..206265) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 tRNA complement(206394..206469) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(206518..206593) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(206672..206747) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 206911..208350 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene gltX tRNA 208440..208515 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 209606..209938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 210163..210927 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 210927..211814 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 211808..213784 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene fhuB CDS 213934..215967 product TonB-dependent siderophore receptor FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060780470.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene fhuA CDS 216384..217322 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 217403..218344 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 218475..219992 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 220045..221001 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 221085..221945 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 222107..223030 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 223056..224219 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 224229..225128 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(225324..226274) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(226346..227236) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene ispE CDS complement(227240..227863) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene lolB CDS complement(227957..228214) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene yfaE CDS complement(228282..229412) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene nrdB CDS complement(229488..231758) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene nrdA CDS 231957..234530 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene glnD CDS complement(234820..235932) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 236124..236903 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 236963..238570 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 238647..240002 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 240013..240465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(240548..241588) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(241588..242982) product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene hmrM CDS 243040..243654 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ribE CDS complement(243667..244521) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(244639..245112) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene argR CDS complement(245183..246109) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene dusC CDS complement(246100..246708) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(246708..247589) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene djlA CDS complement(247659..248060) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(248203..248466) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 248609..249511 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(249556..251088) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 251311..251721 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 251805..252641 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene purU CDS 252758..253315 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene pgsA tRNA 253431..253506 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 253513..253599 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(253808..254455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 254412..254570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(254927..255280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 255595..255954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 256023..256430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 256495..256857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 257004..258515 product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 258529..259629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 259642..260325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 sequence02 source 1..167775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..3488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(3488..4837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(4858..6915) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029858416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(7568..9103) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene ilvA CDS complement(9178..9729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(9772..11472) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene proS CDS complement(11650..12834) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene tuf CDS complement(12900..15002) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene fusA CDS complement(15117..15587) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene rpsG CDS complement(15729..16103) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene rpsL CDS complement(16317..16592) product DsrH/TusB family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(16594..16956) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene tusC CDS complement(16953..17333) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene tusD CDS complement(17330..17995) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(18072..18806) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene fkpA CDS 18874..19095 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(19134..19679) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(19757..20602) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene rpoH CDS complement(20874..21563) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(21768..23132) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(23232..24470) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(24653..25126) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 25452..26051 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 26086..28104 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene hyfB CDS 28115..29089 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 29100..30545 product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 30556..31194 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene hyfE CDS 31199..32731 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 32749..34479 product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene hyfG CDS 34502..35074 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene hyfH CDS 35086..35862 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 35872..36273 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 36266..36724 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene hycI CDS 36859..39012 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816737.1 transl_table 11 codon_start 1 transl_except (pos:37276..37278,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_02580 gene fdhF CDS complement(39054..39395) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene hypA CDS 39533..40336 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene hypB CDS 40340..41452 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene hypD CDS 41462..42475 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene hypE CDS complement(42479..43093) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene rsmD CDS 43191..44468 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene ftsY CDS 44508..45164 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene ftsE CDS 45173..46093 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene ftsX CDS 46132..47013 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene rarD CDS complement(47048..47542) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(47558..48307) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(48380..49111) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929751.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(49104..50129) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(50137..50844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(51002..52852) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene btuB CDS complement(52901..53815) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene metF CDS 54026..57712 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene metH CDS complement(58059..58232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 58366..59553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 60250..60942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 61068..62834 product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 62838..63578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 63578..64894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 64891..65622 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(65638..66861) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 67105..67365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(67415..68074) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(68107..68550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 68673..69563 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 69674..70957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(71002..71805) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(71949..73472) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(73469..74464) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(74472..75941) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(76121..78469) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(78550..79125) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 79284..80252 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 80261..82990 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rbbA CDS 82991..84109 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 84114..85505 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(85553..86341) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(86356..87180) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(87193..88344) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene glf CDS complement(88378..89880) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(89902..90843) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(90849..91361) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene def CDS 91618..92565 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002277661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene lacD CDS 92575..93852 product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene gatZ CDS 93842..94291 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene gatA CDS 94306..94590 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene gatB CDS 94595..95953 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 96010..97053 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene gatD CDS 97108..97893 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(97985..99115) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene recA CDS 99757..101646 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene mnmG CDS 101646..102278 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rsmG CDS 102531..102908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 102927..103727 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene atpB CDS 103872..104126 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene atpE CDS 104206..104676 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene atpF CDS 104687..105220 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene atpH CDS 105233..106774 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene atpA CDS 106796..107662 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene atpG CDS 107683..109056 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene atpD CDS 109100..109528 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(109719..110564) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene modD CDS complement(110583..111182) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(111184..111981) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005568139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(111956..112693) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene modA CDS complement(112826..114145) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 114245..115036 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(115242..116663) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(116689..117690) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(117823..118692) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 118829..119908 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(120022..120477) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 120589..121209 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(121245..121865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 note possible pseudo, frameshifted CDS complement(121856..122149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 note possible pseudo, frameshifted CDS 122272..122826 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 122892..123179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 123195..123941 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(124011..124430) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene cadR CDS 124477..125094 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(125295..127427) product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(128180..130867) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 130866..131033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 131014..131625 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene yihA CDS complement(131600..132370) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene menH CDS complement(132389..134818) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene gyrB CDS complement(134981..136093) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene asd CDS 136332..136838 product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(136895..137920) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene glpX CDS 138106..138345 product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene zapB CDS 138414..139292 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ilvY CDS 139390..141969 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040035576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene mutS CDS complement(142061..142705) product DNA transformation protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene tfoX CDS 142914..144452 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(144449..144760) product DUF5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 144817..145677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 145783..146517 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene rsmE CDS 146518..147108 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 147108..147533 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene ruvX CDS complement(147570..149174) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(149276..149911) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(150025..150666) product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(150917..151369) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene rpiB CDS 152264..153256 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 153286..153846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 153843..155123 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 155451..156473 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 156477..157481 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 157483..158115 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene dhaL CDS 158178..159440 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 159451..160371 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 160400..161236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 161253..162206 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 162233..162670 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rpiB CDS 162706..163683 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 163719..164195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 164195..165487 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 165498..166172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 166186..166986 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 166992..167162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 sequence03 source 1..164148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1990 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 2093..2497 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(2639..3529) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 3647..4084 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(4096..5148) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(5236..5736) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(5791..6639) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(6653..7456) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(7467..8444) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene manX CDS complement(8656..10506) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene typA CDS complement(10731..11597) product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene cntI CDS 11688..13106 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene glnA CDS 13243..15006 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 14999..16657 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene cydC CDS complement(16984..17616) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene pdxH CDS complement(17684..18961) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene thrC CDS complement(19015..19959) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene thrB CDS complement(19959..22418) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene thrA CDS complement(22790..24088) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 24214..25257 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 25346..26500 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene tgt CDS 26504..27016 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 27031..27270 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005634417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 27318..27464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 27468..27686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(27767..28483) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene fadR CDS 28639..30171 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene nhaB CDS 30191..30727 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene dsbB CDS 30806..31528 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(31608..32237) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(32335..34812) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 34985..35917 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene hemC CDS 35934..36695 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene hemD CDS 36720..38135 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 38150..39454 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 39687..40670 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 40723..41766 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 41791..43293 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 43316..44278 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 44281..45141 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 45158..46018 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(46086..46670) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene nfuA CDS 46812..47612 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 47691..48971 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(48980..49423) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 49556..50635 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene queA CDS complement(50691..51626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(51665..52510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(52584..53501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(53523..55364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(55365..57182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(57182..59056) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(59136..61202) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(61213..63126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(63154..65271) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(65475..66314) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694380.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rsmI CDS 66395..68113 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 68119..68478 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 68482..69063 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 69110..69694 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene dolP CDS 69775..70803 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene tsaD CDS 70803..72764 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 72870..73217 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene secG tRNA 73232..73317 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 73369..73860 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 73863..75065 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 75065..75448 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(75445..79110) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(79120..79452) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(79449..80165) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene azlC CDS complement(80260..81411) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene fucO CDS complement(81488..82774) product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(82812..83462) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene fucA CDS complement(83487..83921) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene fucU CDS complement(83915..85333) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694547.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene fucK CDS complement(85395..87161) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene fucI CDS complement(87386..88138) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(88264..89193) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(89407..91719) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene pflB CDS complement(91808..92656) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene focA CDS 92932..93282 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene hinT CDS 93284..93637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 93650..94711 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene nagZ CDS 94711..95892 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rlmC CDS complement(95946..97262) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene argA CDS complement(97385..97855) product surface-adhesin protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(97951..98613) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rluA CDS complement(98681..99586) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene fdhE CDS complement(99588..100265) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(100278..101183) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene fdxH CDS complement(101185..104256) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:103669..103671,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_04720 gene fdnG CDS 104408..105265 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene fdhD CDS 105394..106488 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene glpQ CDS complement(106552..108066) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene glpK CDS 108424..109164 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 109415..110860 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene glpT CDS 111122..112816 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene glpA CDS 112806..114092 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694609.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene glpB CDS 114089..115363 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene glpC CDS complement(115414..117219) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 117385..119043 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(119105..120403) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(120414..120959) product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(120990..121772) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116972861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(121827..122804) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(122804..123442) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene tmk CDS complement(123453..124487) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene mltG CDS 124665..126518 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(126555..127595) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(127615..127953) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene glnB CDS complement(127956..128534) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene mog CDS complement(128660..130117) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene nagE CDS complement(130474..130734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, internal stop codon CDS complement(130734..131108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(131077..132177) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(132189..133616) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064529112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(133616..134500) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(134537..135877) product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene citS CDS complement(136046..137119) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(137142..137798) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 tRNA complement(138509..138585) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(138824..140197) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene yegQ CDS complement(140307..141722) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene cpxA CDS complement(141782..142498) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene cpxR CDS complement(142634..142963) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(143071..143739) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 tRNA 143955..144044 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(144168..145343) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene cgtA CDS complement(145395..146312) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(146322..147239) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(147309..147566) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539872.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rpmA CDS complement(147586..147897) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626416.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rplU CDS 148140..149114 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene ispB CDS 149138..149860 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 150029..152302 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene gshAB CDS 152418..153515 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 153512..153976 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene ybeY CDS 153976..155859 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(155840..156685) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene cpdA CDS complement(156722..157345) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene nudF CDS complement(157473..158204) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 158471..159463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(159525..160205) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene artM CDS complement(160205..160876) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene artQ CDS complement(160882..161607) product lysine/arginine/ornithine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(161622..162350) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene artP CDS complement(162490..163074) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene lpcA CDS complement(163156..163560) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene vapC CDS complement(163564..163797) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene vapB sequence04 source 1..134260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1516) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene glmU CDS complement(1533..2501) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene rfaC CDS complement(2591..3628) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene waaF CDS complement(3712..4641) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rfaD CDS 4768..6363 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 6353..7084 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(7115..7774) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene crp CDS complement(7793..8011) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(8053..8691) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene slmA CDS complement(8701..9156) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene dut CDS complement(9143..10354) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene coaBC CDS 10482..11213 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene radC CDS 11410..11646 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rpmB CDS 11658..11828 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rpmG CDS complement(11960..13294) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene argG CDS complement(13384..14214) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(14286..16421) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene fadJ CDS complement(16436..17743) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene fadI CDS 17888..18370 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene smpB CDS complement(18429..19196) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(19218..19934) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(19918..20691) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 21002..22348 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene gdhA CDS 22552..23949 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(24005..24886) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene prmA CDS complement(24887..26332) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene panF CDS complement(26332..26571) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(26584..27063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(27127..28473) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene accC CDS complement(28571..29032) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene accB CDS complement(29205..29657) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene aroQ CDS complement(29812..30576) product DNA-binding transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(30601..30960) product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene gutM CDS complement(31020..31682) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene fsa CDS complement(31732..32511) product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene srlD CDS complement(32522..32887) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene srlB CDS complement(32898..33893) product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(33921..34466) product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(34703..35443) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene deoR CDS complement(35460..36134) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene deoC CDS 36293..37213 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene rbsK CDS 37225..38514 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene fucP CDS 38525..39541 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(40072..40842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(40852..41292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(41411..41962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(42159..42587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(42597..45443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(45536..45889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(45927..46211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(46316..46705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(46708..47181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(47339..47728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(47730..48011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(48183..48593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(48593..49045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(49410..49778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(49778..50248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(50405..50752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(50754..51035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(51206..51595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(51598..52338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(52470..52838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(52840..54204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(54197..55960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(55972..58029) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(58666..59421) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(59557..60924) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene purB CDS complement(60946..61572) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene hflD CDS complement(61659..62378) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 62459..63502 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(63536..64174) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(64184..65125) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(65135..66616) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(66748..68205) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(68219..69631) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene uxaC CDS 69851..70840 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 70878..71396 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 71396..72712 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 72810..73604 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene exuR CDS complement(73725..75017) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(75014..75505) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(75562..76545) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(76720..77724) product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene lgoD CDS 77883..78794 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(78856..79497) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(79507..80430) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(80440..81843) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene uxaC CDS complement(81845..82690) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(82773..83762) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 84004..84495 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 84508..85809 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 85828..88188 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 88208..88957 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 88979..90166 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene uxuA CDS complement(90268..90681) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(90683..90958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(91056..92330) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(92333..92800) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(92862..93848) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(93873..94901) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 95063..95818 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 95845..96306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 note possible pseudo, internal stop codon CDS 96337..97032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, internal stop codon CDS complement(97171..97332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(97333..98013) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(98022..99626) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(99626..100699) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene uxuA CDS complement(100710..101729) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(101741..103021) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(103035..103544) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(103560..104567) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(104912..106216) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(106230..106709) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(106770..107756) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(107788..108627) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene kduI CDS complement(109170..110258) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene recF CDS complement(110262..111362) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene dnaN CDS complement(111373..112728) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene dnaA CDS complement(112903..114357) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene gnd CDS complement(114417..115109) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(115219..115611) product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(115656..116354) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132500362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pgl CDS complement(116363..117865) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene zwf CDS complement(117963..118772) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene cysQ CDS complement(118897..120933) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 tRNA 121179..121268 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 121279..121355 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 121432..121508 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 121747..122085 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 122119..123414 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(123437..123817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 123932..124540 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 124544..125068 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(125074..125973) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene murQ CDS complement(125986..127104) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 127335..127838 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene luxS CDS 127868..129049 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene purT CDS complement(129084..129896) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene mutM CDS 130378..131049 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene mutH CDS 131101..131823 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 131930..132085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 132092..134107 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rep sequence05 source 1..119477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1236 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 1497..5723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(6187..6774) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(6819..7889) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(8222..11176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(11742..12413) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 12886..13053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 note possible pseudo, internal stop codon CDS complement(13112..13279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(13367..14296) product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(14293..15252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(15764..16984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(17043..20936) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene purL CDS 21115..22629 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene mltF CDS 22782..23888 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene proB CDS complement(24044..25051) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene trpS CDS complement(25061..25732) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(25759..26442) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rpe CDS 26598..26924 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene glpE CDS 27176..28405 product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene pucG CDS complement(28566..29921) product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(29923..31296) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene allB CDS complement(31380..32270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 32538..33941 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene allB CDS 33960..35300 product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(35355..36203) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 36302..37087 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene allE CDS 37108..38157 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene allD CDS 38221..41232 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 41250..42182 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene arcC CDS 42194..43798 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 43808..44008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 44021..45256 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 45351..45773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 46121..46573 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(46598..47035) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 47177..48616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 48656..49174 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 49176..49808 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 50120..50836 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 50839..51582 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 51595..52251 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene tenA CDS 52273..53226 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 53245..54189 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 54199..55422 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(55481..56737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(56796..58046) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene lysA CDS complement(58171..58806) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene lexA CDS 59058..61481 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene plsB CDS complement(61594..62346) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(62360..63538) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 63741..66023 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene hypF CDS complement(66005..66577) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene mobA CDS 66645..66911 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 66943..67542 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 67601..67930 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 68020..69120 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene trmA CDS 69117..69872 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 69998..71473 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ilvC CDS 71531..71980 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene recX CDS complement(71973..74165) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene priA CDS 74406..74723 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene metJ CDS 74832..77063 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 77073..77426 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 77423..77752 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(77799..80120) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(80179..81519) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rsmB CDS complement(81519..82475) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene fmt CDS complement(82492..83052) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene gmhB CDS 83294..84328 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene metN CDS 84321..85010 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 85034..85825 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(85958..87412) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 87550..88014 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene gpt CDS 88096..88908 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693731.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene nudC CDS 88901..89983 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene hemE CDS 89993..90583 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 90741..91013 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(91068..91634) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(91765..92553) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 92775..93773 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene yiaK CDS 93864..94334 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 94337..94819 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 94816..96093 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 96174..97160 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 97396..98883 product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene lyxK CDS 98899..99759 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 99753..100448 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene araD CDS 100469..101140 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(101181..101939) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 102143..103051 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 103051..104301 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 104313..104945 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 104948..105730 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 105768..106712 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 106724..108196 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 108256..109605 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 109637..110323 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115248746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 110381..111115 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene glpF CDS complement(111431..111655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 111926..112951 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene murB CDS 112961..113272 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 113400..114611 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 114631..115050 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rbsD CDS 115077..116579 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene rbsA CDS 116576..117544 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rbsC CDS 117564..118442 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rbsB CDS 118502..119419 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rbsK sequence06 source 1..112473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..3849) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mfd CDS complement(3853..4326) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(4326..4592) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(4902..5975) product anion-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(6230..7303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(7547..8614) product anion-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(8866..9936) product anion-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 10334..10942 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rppH CDS 10957..11748 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 11804..12613 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene lgt CDS 12623..13474 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 13649..13972 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene trxA CDS complement(14030..14890) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(14987..17647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 17779..18744 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene cmoB CDS 18801..19673 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene asd CDS 19685..20317 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002886687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene fklB CDS complement(20418..21182) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(21213..21647) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 21843..22610 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene tpiA CDS 22915..24249 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 24509..26125 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648384.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene pckA CDS complement(26278..27003) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene cmoA CDS complement(27026..27535) product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 27743..29509 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene aspS CDS 29596..30696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 30701..31180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 31150..31584 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene nudB CDS 31587..32327 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649034.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 32354..32788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 32841..33413 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene ruvC CDS 33515..34129 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ruvA CDS 34156..35160 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene ruvB CDS complement(35176..36066) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(36090..37292) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 37524..38501 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191773063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(38527..39408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 39538..40545 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 40855..41463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 41466..42404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 42515..44164 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 44296..44622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(44692..45942) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(46120..46872) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(47014..47721) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(47699..48223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(48317..48766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(48953..49831) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(49930..50538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 note possible pseudo, internal stop codon CDS complement(50542..50814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 note possible pseudo, internal stop codon CDS 50968..52113 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 52116..52685 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 52823..53401 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 53605..53862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 53856..55145 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 55251..56366 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 56602..57495 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 58138..59058 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 59061..59321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 59554..60273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(60360..60797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, frameshifted CDS 61423..61854 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 61926..62600 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 62650..63108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 63119..63907 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene hpaI CDS 63983..65098 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 65132..65755 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 65958..67115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 67224..67427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 67424..67660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 67670..67870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(68004..68852) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 68969..69907 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 70035..70877 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 71116..72051 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(72131..73735) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 74096..75019 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 75130..75567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 75638..76732 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 tRNA complement(77104..77177) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(77204..77290) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(77297..77372) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 77580..78689 product methionine biosynthesis PLP-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 78839..79474 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 tRNA 79604..79680 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 79685..79769 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 79800..79874 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 79920..79994 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 80004..80093 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 80268..80792 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene yceD CDS 80815..80985 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rpmF CDS 81008..82036 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene plsX CDS 82062..83012 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 83038..83976 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene fabD CDS 84004..84732 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene fabG CDS 84934..85164 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene acpP CDS 85369..86718 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 86844..88121 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene waaA CDS 88130..88603 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene coaD CDS complement(88652..90190) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene lnt CDS complement(90194..91093) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene corC CDS complement(91213..92019) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene suhB CDS complement(92240..95122) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene valS CDS complement(95300..97870) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112130572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene clpB CDS 98045..99136 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(99164..99868) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene lpxH CDS 99980..100705 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 100714..102117 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene ftsP CDS 102508..104205 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene dld CDS 104387..105397 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 106106..107473 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 107473..108528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 108763..109011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(109172..110332) product DUF6396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(110332..111627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 misc_feature complement(111790..>112473) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269338.1:DUF6396 domain-containing protein locus_tag LOCUS_08830 sequence07 source 1..112198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..1134) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene miaA CDS complement(1143..3026) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene mutL CDS complement(3036..4244) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(4250..4720) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene tsaE CDS 4903..5976 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene dhaK CDS 5978..6607 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene dhaL CDS 6611..7012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(7078..7731) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene ompW CDS 8010..8816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 8826..9377 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 9380..9874 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene yciA CDS 9871..10170 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(10232..11611) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene ffh CDS 11878..14208 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 14345..17035 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(17084..17554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(17644..18198) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ampD CDS 18347..18787 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 18802..20220 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 20230..21459 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 21456..22187 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 22207..22815 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene coaE CDS 22817..23041 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene yacG CDS 23052..23330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(23353..23850) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115308544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(23922..24245) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene raiA CDS complement(24471..25847) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 26380..26907 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene aroK CDS 26935..28029 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene aroB CDS 28050..28898 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(29049..29363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 29456..29767 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene secM CDS 29866..32568 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene secA CDS 32637..33056 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene mutT CDS complement(33098..34051) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(34099..35454) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(35593..36309) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene deoD CDS complement(36319..37551) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene deoB CDS complement(37642..38907) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 39047..39679 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(39676..39978) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 40050..40475 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 40534..41118 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene pth CDS 41209..42300 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene ychF CDS 42626..43294 product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 43284..44660 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene qseC CDS complement(44703..46559) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene ftsH CDS complement(46633..47262) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rlmE CDS 47435..47884 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene nrdR CDS 47887..49038 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene ribD CDS 49035..50096 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene degS CDS 50099..50698 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene yfbR CDS 50713..52056 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(52092..53606) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene der tRNA complement(53738..53814) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(53839..53915) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(54012..54776) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene dnaQ CDS 54828..55292 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene rnhA CDS complement(55333..56688) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene lysC CDS 56894..57604 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(57638..57994) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(58051..58746) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(58756..59823) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(59859..60533) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(60546..62261) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene recJ CDS complement(62307..62990) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene dsbC CDS 63183..64226 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene prfB CDS 64398..65900 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050838325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene lysS CDS complement(65945..68944) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065246942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(68985..69503) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene hutZ CDS complement(69529..70023) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene hutX CDS 70314..70985 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene queC CDS 71003..72922 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(72995..73645) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene thiE CDS complement(73645..74460) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene thiD CDS complement(74453..75253) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene thiM CDS 75508..75855 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 75871..77004 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene dapE CDS 77006..77704 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 77935..78933 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 78962..79438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 79441..80712 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 80709..81719 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 81760..82707 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 82723..83697 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ghrB CDS 83883..86012 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139988996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene pnp CDS 86112..87053 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene nlpI CDS 87149..88987 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(89041..90234) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene metC CDS 90363..90965 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(91138..92415) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene murA CDS complement(92437..92694) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(92721..93071) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(93071..93712) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene mlaC CDS complement(93752..94270) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene mlaD CDS complement(94295..95077) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene mlaE CDS complement(95074..95868) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene mlaF CDS 96167..97102 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene mdh CDS 97225..97554 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 97584..98204 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene recR CDS complement(98352..99605) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(99612..100226) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(100308..101570) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(101599..102279) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 102483..103559 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 103569..104945 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene radA CDS 104954..105838 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 105924..106400 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene lrp CDS 106402..109263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 109286..109906 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene lolA CDS 109934..111274 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 repeat_region 111402..111696 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaactcacgcacccgtgaaaggtgcgag sequence08 source 1..107411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1040..2326) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene pepP CDS 2643..3479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 4239..5090 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 5153..6535 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 6532..6705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(6783..7421) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene sodA CDS complement(7545..9806) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 9926..10618 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene rsuA CDS 10629..10859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(10906..11379) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene nanQ CDS complement(11423..13426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 13674..14567 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene xerD CDS 14591..15184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(15225..15767) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene rfbC CDS complement(15784..16659) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rfbD CDS complement(16659..17531) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene rfbA CDS complement(17538..18389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(18570..19634) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene rffG CDS complement(19701..21119) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene wbaP CDS complement(21145..22071) product glycosyltransferase family 52 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(22105..23202) product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(23203..24102) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(24099..24842) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(24918..25916) product N-acetyllactosaminide alpha-2,3-sialyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene lst CDS complement(25903..27120) product lipooligosaccharide flippase LsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene lsgA CDS complement(27311..28462) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene neuC CDS complement(28462..29724) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(29737..30783) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene neuB CDS complement(30776..31420) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(31438..32577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 33030..33248 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene infA CDS 33334..33999 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 34011..35267 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene proA CDS 35260..35856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 36200..37663 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005690769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene nrfA CDS 37751..38407 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene nrfB CDS 38407..39084 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene nrfC CDS 39084..40043 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene nrfD CDS 40132..42066 product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene nrfE CDS 42056..42583 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 42573..43058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 43058..43879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 43876..45069 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(45058..45627) product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(45624..46196) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(46180..47109) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(47111..47656) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(47716..49008) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 49213..49506 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(49575..50540) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene pfkA CDS complement(50673..51572) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene fieF CDS complement(51588..52172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(52176..52952) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene yaaA CDS complement(52982..53656) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene ung CDS 53967..54350 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene grcA CDS complement(54440..55333) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene dapA CDS 55452..55922 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene bcp CDS complement(55970..56353) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene rplQ CDS complement(56400..57389) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rpoA CDS complement(57423..58043) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene rpsD CDS complement(58073..58462) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene rpsK CDS complement(58479..58835) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene rpsM CDS complement(59124..60449) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene secY CDS complement(60454..60888) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rplO CDS complement(60893..61072) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene rpmD CDS complement(61079..61579) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene rpsE CDS complement(61595..61948) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rplR CDS complement(61962..62495) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rplF CDS complement(62510..62902) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene rpsH CDS complement(62938..63243) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene rpsN CDS complement(63256..63795) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene rplE CDS complement(63813..64133) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rplX CDS complement(64148..64519) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005548786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene rplN CDS complement(64803..65057) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene rpsQ CDS complement(65057..65248) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene rpmC CDS complement(65248..65658) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rplP CDS complement(65672..66385) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene rpsC CDS complement(66402..66734) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene rplV CDS complement(66745..67020) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539416.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene rpsS CDS complement(67046..67867) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene rplB CDS complement(67887..68186) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene rplW CDS complement(68183..68785) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rplD CDS complement(68801..69433) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene rplC CDS complement(69448..69759) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene rpsJ CDS complement(70005..70808) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene mazG CDS complement(71396..72757) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210050.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 72950..73753 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene bacA CDS complement(73800..75050) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(75054..75722) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(75737..76201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(76201..77931) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 78235..78486 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 78512..80323 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene oadA CDS 80336..81640 product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444842.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 81712..82116 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene arsC CDS complement(82259..83224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(83278..84258) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene dusA CDS complement(84251..85627) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(85736..86365) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 86427..88352 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(88375..89889) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene ppx CDS complement(89903..91993) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene ppk1 CDS complement(92231..94360) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene nrdD CDS 94772..95302 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene hslV CDS 95324..96676 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene hslU CDS complement(96720..97448) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015145.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene nadE CDS complement(97469..98587) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(98707..100590) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene recQ CDS complement(100590..100901) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene cyaY CDS 101020..101139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(101173..102069) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene galU CDS complement(102145..103509) product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050098652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene cpsG CDS complement(103546..103773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(103927..106467) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene alaS CDS complement(106746..107174) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene uspA sequence09 source 1..101448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..2123) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029858416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(2252..2410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(2579..2851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(2904..4193) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene serS CDS complement(4276..5043) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(5062..5991) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 6065..6757 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene can CDS complement(7013..7873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(8102..9508) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(9508..10305) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(10305..11258) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(11264..12817) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(13094..14062) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(14332..15624) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(16765..17121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(17299..17511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(17710..19557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(19584..19754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(19820..20251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(20336..20536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(20539..20742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(21141..21410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(21912..22343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(22362..23165) product antA/AntB antirepressor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(23162..23446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(23462..23920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(23920..24234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(24318..24587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(24600..24803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(24988..25539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(25722..26294) product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(26620..27885) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 tmRNA complement(28137..28503) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(28613..29521) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(29528..30544) product zinc transporter permease subunit ZevB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene zevB CDS complement(30535..31188) product zinc transporter binding subunit ZevA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene zevA CDS 31469..33139 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ettA CDS 33205..34533 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(34618..34971) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene rplT CDS complement(35029..35226) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rpmI CDS complement(35473..35886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(36234..36893) product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(36905..37249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(37259..37930) product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(38067..39998) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene thrS CDS complement(40329..44345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 44695..45555 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211846.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(45615..45824) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene cspD CDS complement(46024..46824) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene xthA CDS 46951..48678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 48828..49943 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025298411.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 50116..52587 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109063995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene torA CDS 52831..54033 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 54098..56236 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene pta CDS 56647..58551 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 58581..59102 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 59173..60543 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 60554..61879 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 61869..62999 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 63157..65793 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene ppc CDS complement(65857..67878) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(68022..68825) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(68822..69574) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(69571..70560) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(70562..71590) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(71740..74205) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(74229..75665) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene glgA CDS complement(75800..77113) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene glgC CDS complement(77216..79249) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene glgX CDS complement(79373..81841) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694003.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene glgB CDS complement(82057..82515) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene moaE CDS complement(82527..82775) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene moaD CDS complement(82779..83252) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene moaC CDS complement(83265..84275) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene moaA CDS 84661..86214 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene trpE CDS 86225..86806 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 86857..87858 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene trpD CDS 87866..89278 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene trpCF CDS 89410..90606 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene trpB CDS 90606..91412 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene trpA CDS complement(91485..92129) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene adk CDS complement(92251..93486) product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(93615..94631) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene galE CDS complement(94708..95688) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene cra CDS complement(95839..96330) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene ilvN CDS complement(96323..98047) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005671546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(98388..98849) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(98855..99454) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 99541..101280 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene argS sequence10 source 1..94893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(494..1465) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene secF CDS complement(1478..3325) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene secD CDS complement(3353..3646) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene yajC CDS complement(3785..4465) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(4455..4766) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene lsrG CDS complement(4823..5701) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene lsrF CDS complement(5727..6743) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene lsrB CDS complement(6805..7803) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene lsrD CDS complement(7815..8810) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene lsrC CDS complement(8823..10331) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene lsrA CDS 10587..11555 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene lsrR CDS 11594..13165 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113145.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene lsrK CDS complement(13229..14215) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene epmA CDS complement(14219..15157) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(15162..15797) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 16504..18303 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene frdA CDS 18296..19063 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005639269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 19074..19466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 19477..19821 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene frdD CDS 20009..21136 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene carA CDS 21217..21786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 21793..22338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 22453..23181 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 23190..23732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 23745..26939 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene carB CDS 27125..30088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 30075..31055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 31215..32195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 32170..32439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 32426..33412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 33589..34989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 34997..37966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 37976..38950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 39082..40056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 40197..41150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 41280..42260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(42321..43337) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene hemB CDS complement(43430..44185) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene tatC CDS complement(44204..44749) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene tatB CDS complement(44753..44977) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene tatA CDS complement(45135..46778) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene groL CDS complement(46842..47132) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(47223..47732) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene fxsA CDS 47926..49341 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene aspA CDS complement(49403..51673) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene metE CDS complement(51818..53986) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene yccS CDS complement(54039..54497) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050848554.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene mgsA CDS complement(54565..55218) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 55349..55636 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene yccX CDS complement(55725..56420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(56413..57132) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene modB CDS complement(57254..58060) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694110.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 58175..59149 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene rluD CDS 59152..59892 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene pgeF CDS complement(59893..60027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 note possible pseudo, frameshifted CDS complement(60165..61136) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(61129..62112) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene dppD CDS complement(62121..63029) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(63049..64053) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(64159..65757) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 66040..67071 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene purM CDS 67071..67712 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene purN CDS 67847..68383 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene pyrR CDS 68453..69406 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 69479..70345 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rsmA CDS 70355..71176 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene apaH CDS 71464..72417 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene corA CDS complement(72528..72956) product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene mrgA CDS 73187..73846 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(73896..75008) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene apbC CDS 75184..77241 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene metG CDS complement(77293..77997) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene cobB CDS complement(78010..78978) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene rluC CDS complement(78978..81809) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene uvrA CDS 81970..82455 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(82653..85244) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene tssH CDS complement(85370..86359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(86356..87360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(87357..88358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(88401..89411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(89408..90418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(90421..93318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(93321..93827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(94015..94812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 sequence11 source 1..86444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..1034 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1255..1752 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene rsxA CDS 1752..2360 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene rsxB CDS 2371..4662 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene rsxC assembly_gap 4327..4334 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4664..5443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 5456..6511 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene rsxD CDS 6524..7138 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene rsxG CDS 7147..7872 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 7878..8513 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene nth CDS 8522..9901 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 10052..11653 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene purH CDS 11809..13095 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene purD CDS 13435..14697 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 14690..14974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 15000..16016 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene bioB CDS complement(16090..17142) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene fbpC CDS complement(17208..19181) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(19348..20388) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 20540..21184 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene udk CDS 21195..21779 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene dcd CDS 21789..22829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(22865..26761) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene hrpA CDS complement(26787..27233) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 27346..28275 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 28377..28664 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene ybfE CDS 28666..29190 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene fldA CDS 29291..29725 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene fur CDS complement(29792..30871) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 31060..31356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(31439..32836) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pntB CDS complement(32847..34385) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene pntA CDS 34608..35321 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene sfsA CDS 35568..35792 product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 35842..36450 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(36528..39410) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene glnE CDS complement(39416..40033) product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(40035..40976) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(40986..41849) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 41959..42672 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rph CDS 42685..43326 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene pyrE CDS 43372..44049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(44092..44433) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(44471..45241) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene trmB CDS 45395..46732 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene pepB CDS 46732..47151 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ndk CDS complement(47213..47548) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(47853..49157) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 49382..50332 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene cysK CDS complement(50387..51985) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene tyrR CDS 52249..53310 product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene yedE CDS complement(53358..54542) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene manA CDS 54709..56001 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 56072..57259 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene tyrS CDS 57315..58238 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 58382..59839 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(59888..60802) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene nagK CDS complement(60918..62063) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(62078..63133) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(63146..64366) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(64499..65482) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(65501..66235) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 66299..66958 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene ribA tRNA complement(67007..67082) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(67112..67187) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(67217..67292) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(67321..67396) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(67579..68037) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene pal CDS complement(68051..69346) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene tolB CDS complement(69387..70562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(70581..71003) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene tolR CDS complement(71079..71762) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene tolQ CDS complement(71798..72211) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene ybgC CDS 72548..73864 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 73998..74630 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(74640..75662) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene hcr CDS complement(75744..77396) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene hcp CDS complement(77769..78971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(78983..79618) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650349.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(79628..80116) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(80122..81108) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene thiL CDS complement(81139..81570) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene nusB CDS complement(81572..82045) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene ribE CDS complement(82184..83053) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene sucD CDS complement(83065..84225) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene sucC rRNA complement(84383..84483) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence12 source 1..85336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..980 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene araC CDS 1109..2710 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 2720..4207 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene araA CDS complement(4307..6061) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(6074..6295) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 6414..7436 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene yejK CDS 7542..7958 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene bamE CDS 8011..9459 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene modF CDS 9512..10441 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 10452..10898 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 10898..11515 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(11552..11995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(12059..13468) product opacity-associated protein OapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene oapA CDS complement(13554..14612) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene epmB CDS 14612..15178 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene efp CDS 15333..17735 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene lon CDS 17857..19716 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059358191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 19963..20700 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rpsB CDS 20842..21687 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene tsf CDS 21754..22470 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene pyrH CDS 22583..24103 product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene lidL CDS 24200..24757 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene frr CDS 24861..26057 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693175.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene ispC CDS 26123..26842 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene uppS CDS 26852..27730 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 27739..29073 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene rseP CDS 29098..31497 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene bamA CDS 31588..32280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 32309..33337 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene lpxD CDS 33377..33832 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035660215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene fabZ CDS 33872..34660 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene lpxA CDS 34725..35927 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene lpxB CDS 35920..36507 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene rnhB CDS complement(36509..37072) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 37224..37808 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(37861..38109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 38246..39049 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(39136..40515) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene cysS CDS 40617..41126 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 41186..41986 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(42019..43977) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 44103..44291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 44317..45585 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 45778..46224 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 46241..46744 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630575.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene secB CDS 46811..47827 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene gpsA CDS 47829..48647 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene cysE CDS 48702..49049 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(49091..49579) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene mreD CDS complement(49579..50649) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene mreC CDS complement(50709..51761) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(51971..52975) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene gap CDS 53318..53533 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rpsU CDS 53671..55422 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dnaG CDS 55498..57384 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rpoD CDS complement(57456..57920) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene sixA CDS complement(58037..59464) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene miaB CDS 59788..60246 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene mraZ CDS 60367..61335 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene rsmH CDS 61335..61652 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ftsL CDS 61670..63499 product peptidoglycan synthase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 63522..64994 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene murE CDS 64998..66380 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene murF CDS 66374..67459 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene mraY CDS 67487..68788 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene murD CDS 68812..69999 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene ftsW CDS 70044..71099 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene murG CDS 71112..72548 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene murC CDS 72592..73515 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 73515..74291 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 74341..75612 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693456.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene ftsA CDS 75694..77031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 77055..77972 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene lpxC CDS 78160..78651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(78653..79135) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene folA CDS complement(79132..79767) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene fabR CDS complement(79776..80681) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene oxyR CDS 80857..81588 product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(81653..82039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(82113..82730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(82727..83767) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(83736..85112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 sequence13 source 1..66665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..1994) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene ilvD CDS complement(2030..2254) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ilvM CDS complement(2254..3906) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ilvG CDS 4088..4906 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 4920..5294 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene crcB CDS complement(5318..5719) product DUF2251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(5810..7111) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene eno CDS complement(7523..9151) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene pyrG CDS 9417..11414 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(11483..11983) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(11994..13703) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene narQ CDS 13924..14481 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene napF CDS 14474..14743 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 14776..17298 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene napA CDS 17367..18119 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene napG CDS 18119..18982 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene napH CDS 18985..19440 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 19446..20042 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene napC CDS 20175..20450 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene ftsB CDS 20464..21153 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene ispD CDS 21164..21640 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene ispF CDS 21646..22674 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene truD CDS 22743..23483 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene surE CDS 23506..24081 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 24090..24269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 24295..25473 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene nlpD CDS 25644..25970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 26142..26786 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 26797..28830 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 28899..29456 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 29526..31904 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene lptD CDS complement(32034..32591) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 32716..33030 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 33280..33864 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(33896..34315) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 34494..35222 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 35219..35998 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 35991..36245 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 36255..36509 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 36515..37063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180320626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 37066..38784 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 38781..39503 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 39503..40417 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 40419..40847 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 40856..41446 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 41436..43772 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 43769..45016 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 45042..45497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 45513..46715 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 46700..47179 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 47218..47646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 47664..48392 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene fabG CDS 48386..49612 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(49659..51248) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(51354..52736) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(52733..53233) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene mobB CDS complement(53233..54099) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 54211..54759 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 54763..55314 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 55320..56132 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene aroE CDS 56432..56575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 56603..58180 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 58208..66496 product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 sequence14 source 1..66615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..1578) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1690..3624) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(3640..4806) product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(4946..5494) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(5494..6429) product KpsF/GutQ family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012054716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(6980..9352) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene mrcB CDS complement(9955..10074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(10331..10462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(10746..10865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 12028..13107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 13191..13940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 13942..14211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(14270..15196) product glycosyltransferase family 52 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(15220..16329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(16342..18024) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(18039..18425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(18537..18878) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene erpA CDS 19017..19823 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene map CDS complement(19874..21082) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666410.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(21249..22109) product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene tehB CDS 22384..22812 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rplM CDS 22830..23222 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rpsI CDS 23516..24346 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene folP CDS 24372..25706 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene glmM CDS complement(25745..26464) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 26490..27197 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene gloB CDS 27201..28394 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 28689..29999 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene hemA CDS complement(30004..30450) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene matP CDS 30586..32367 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 32468..32998 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene fabA CDS 33164..34174 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(34211..34819) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 35025..35312 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene rplY CDS 35426..36214 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene truA CDS 36401..38317 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene dnaK CDS 38395..39012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 39045..40181 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene dnaJ CDS 40426..43233 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene sucA CDS 43318..44553 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene odhB CDS 44585..45676 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene nirK CDS complement(45722..47482) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 47584..47925 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(47975..50230) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene parC CDS complement(50249..50869) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(51077..52975) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene parE CDS complement(53265..53969) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(53966..54823) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 54920..56242 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 56352..57569 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene bioA CDS 57562..58725 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene bioF CDS 58722..59366 product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 59375..60151 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene bioC CDS 60153..60797 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene bioD CDS 60863..61783 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene accD CDS 61793..63091 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene folC CDS 63099..63413 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 63415..64167 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene truC CDS 64286..65113 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene dapD CDS 65259..65801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 65884..66324 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 sequence15 source 1..59566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1215) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene sohB CDS complement(1247..3853) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene topA CDS 4046..4939 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(4946..5233) product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene hybG CDS complement(5248..5784) product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene hybE CDS complement(5777..6244) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(6257..7963) product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene hybC CDS complement(7960..9189) product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene hybB CDS complement(9182..10177) product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene hybA CDS complement(10230..11381) product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene hybO CDS 11584..11907 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(11973..13409) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene pyk CDS 13663..14070 product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 14228..15628 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694316.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(15831..16973) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene nagA CDS complement(16990..17793) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene nagB CDS complement(17850..18728) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene nanA CDS complement(18750..19622) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(19653..20534) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(20596..21282) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 21530..22513 product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene siaP CDS 22579..24426 product sialic acid TRAP transporter substrate-binding protein SiaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene siaT CDS 24527..25675 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 25748..26812 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(27013..28470) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(28645..29442) product transferrin-binding protein-like solute binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(29588..32572) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(33116..33940) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene iolB CDS 34200..35708 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 35781..36914 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 36959..37795 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(37899..39806) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene iolC CDS complement(39872..41293) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene xylE CDS 41716..42612 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(42810..43652) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene rhaS CDS complement(43746..44000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 note possible pseudo, internal stop codon CDS complement(44052..44765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, internal stop codon CDS complement(44798..45631) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(46185..47195) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene iolG CDS complement(47198..48094) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene iolE CDS complement(48185..50125) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene iolD CDS 50152..50388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 50408..51460 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene ansB CDS 51649..52509 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 52679..53698 product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene iolG CDS 53737..54681 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 54941..56200 product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene xylE note possible pseudo, frameshifted CDS 56172..56351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 56512..56688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 56957..59218 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 sequence16 source 1..53867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 575..1171 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rdgB CDS 1173..2318 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693701.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene hemW CDS 2454..3113 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene rpiA CDS 3154..4386 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene serA CDS complement(4451..4867) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene tnpA CDS 4912..6096 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(6170..6490) product DUF5339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 6962..8530 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 8545..9681 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene cydB CDS 10596..10820 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 11192..11425 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 11487..11672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 11693..12121 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 12241..13047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 13047..14462 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 14459..14959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 14972..16090 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 16105..17388 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 17385..18269 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 18266..19120 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 19110..19886 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162526983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 19910..20473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 20436..21047 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene tadF CDS 21069..22634 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 22882..24276 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene fumC CDS complement(24349..25176) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(25176..26030) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(26042..26935) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(26935..27819) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 28533..29564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(29621..30418) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene kdgR CDS 30650..31405 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene kduD CDS 31452..32093 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 32153..33103 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 33105..33743 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 33754..34080 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 34144..36369 product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 36598..38334 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 38411..39574 product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(39714..42824) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(42847..44031) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(44071..44646) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(44835..49037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(49233..50447) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694022.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 50609..51901 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061720832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 51915..53624 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene menD sequence17 source 1..50502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2873..4048) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene setB CDS 4134..4574 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene yfbV CDS 4648..5139 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 5163..6674 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene purF CDS 6753..8132 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(8179..9627) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene dacB CDS 9791..10267 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene greA CDS 10282..10578 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene yhbY CDS 10807..12375 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 12459..13538 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene dinB CDS complement(13524..13913) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene cueR CDS 14003..14401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 note possible pseudo, frameshifted CDS 14401..16713 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene copA CDS 16778..17776 product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene yclN CDS 17769..18728 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene yclO CDS 18719..19480 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 19517..20431 product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene yclQ CDS 20681..21010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 21045..21515 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(21633..22541) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(22852..24579) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene cydC CDS complement(24579..26309) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene cydD CDS complement(26514..27467) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene trxB CDS complement(27534..28379) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(28501..29850) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(29875..30639) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene idnO CDS complement(30659..31693) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene idnD CDS 31932..32453 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(32512..33510) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene gntR CDS 33840..34679 product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q4QNZ0 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene selD CDS 34683..35108 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene queD CDS 35108..35716 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(35911..38568) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(38540..39802) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 40026..40670 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene proQ CDS 40717..42750 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene prc CDS 42757..44172 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 44286..44846 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 44907..45539 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(45606..46640) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 47093..47986 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 47996..48394 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 48406..49497 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene rlmM CDS 49565..50377 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene dapB sequence18 source 1..45458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..1012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1028..1513) product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1577..1858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(2275..2424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 2453..4375 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 4388..5089 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene tsaB CDS 5121..5675 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 5739..7421 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene fadD CDS 7441..8607 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene rnd CDS 8676..9758 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032803489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene prfA CDS 9823..10347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 10360..12018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 12022..12813 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 12826..13680 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene kdsA CDS 13752..14693 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 14860..15927 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 15932..16636 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene lolD CDS 16650..17888 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene lolE CDS 18023..19114 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165590136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene aroG CDS complement(19236..20015) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(20061..20963) product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene yihV CDS 21117..22001 product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene yihU CDS 22028..22897 product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene yihT CDS 22958..24973 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 25013..26254 product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene yihS CDS 26327..27382 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 27411..28148 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 28322..28837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 28849..30138 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 30164..31216 product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene siaP CDS complement(31353..32999) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene pgi CDS complement(33032..34111) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene alr CDS complement(34135..35544) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 35742..36614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 36716..38134 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene sbcB CDS 38902..39387 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene ftnA CDS 39415..39912 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene ftnA CDS 40066..40620 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(40650..40832) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 40943..41947 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 42124..42363 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene xseB CDS 42364..43260 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene ispA CDS 43286..45151 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene dxs sequence19 source 1..45254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..780) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1047..1502) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1597..2499 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 2749..3894 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 3915..4469 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene pilW CDS 4567..5541 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 5560..6663 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene ispG CDS 6685..7965 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene hisS CDS 7978..8586 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 8651..10105 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(10314..11699) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene mnmE CDS complement(11809..12150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(12233..13855) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene yidC CDS complement(13879..14130) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene yidD CDS complement(14085..14420) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene rnpA CDS complement(14474..14608) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rpmH CDS complement(15018..16772) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(16846..17073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(17476..17745) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene yedF CDS complement(17778..18995) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene yedE CDS complement(19249..22704) product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(22880..23692) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene rhaS CDS 23924..25381 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene rhaB CDS 25394..26644 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602491.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene rhaA CDS 26662..27480 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179743.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene rhaD CDS 27562..28596 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene rhaT CDS 28632..28946 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209101.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene rhaM CDS 29124..29693 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene yihI CDS 29709..30143 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 30164..31540 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene hemN CDS 31555..32016 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(32245..33618) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693177.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene argH CDS complement(33736..34509) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene argB CDS complement(34509..35516) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene argC CDS 35639..38026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 38056..39201 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene argE CDS 39309..40985 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 41017..41316 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene trpR CDS 41300..42028 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene mtgA CDS 42105..42851 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(42888..43640) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 43805..45157 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene pcaB sequence20 source 1..42577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..766) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(818..1159) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1359..2450 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene serC CDS 2496..3596 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene hisC CDS 3671..4984 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene aroA CDS 5070..5927 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene folD CDS complement(6065..6940) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene malM CDS complement(7020..8285) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(8406..9524) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene malK CDS 9908..11092 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene malE CDS 11156..12733 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene malF CDS 12746..13636 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene malG CDS 13696..15735 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(15769..18474) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene malT CDS 18636..21026 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene malP CDS 21129..23150 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene malQ CDS complement(23205..24128) product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene dsdC CDS 24306..25643 product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032644228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene dsdX CDS 25656..26984 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(27027..27590) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene satP CDS 27759..28442 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene recO CDS 28445..29758 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene rlmD CDS complement(29820..30218) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene mscL CDS complement(30305..31681) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene trkA CDS 31787..32239 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene mioC CDS complement(32301..32672) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(32757..33416) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene hxpB CDS complement(33556..34173) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(34212..35609) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(35666..36943) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene phoR CDS complement(36946..37635) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene phoB CDS complement(37692..38468) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene pstB CDS complement(38482..39333) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene pstA CDS complement(39330..40283) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene pstC CDS complement(40449..41489) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene pstS CDS 41681..42148 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene nrdG sequence21 source 1..41324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(331..406) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(432..507) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(616..1164) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene orn CDS 1240..2289 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene rsgA CDS 2543..2800 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 2884..4611 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ptsI CDS 4671..5171 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene crr CDS 5349..6872 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 6937..7725 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(7880..8131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(8133..8519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(8596..9456) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(9468..10268) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(10280..11257) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene manX CDS 11479..13323 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(13379..14404) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene galM CDS complement(14398..15555) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene galK CDS complement(15573..16625) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene galT CDS 17039..18037 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663077.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 18237..19229 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene mglB CDS 19320..20837 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene mglA CDS 20855..21865 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene mglC CDS complement(21903..22394) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene tadA CDS complement(22470..22712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(22867..24750) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene htpG CDS 24940..26094 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene metK CDS 26245..26649 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 26726..27292 product opacity family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 27358..28503 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(28555..29922) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene mpl CDS 30079..31083 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene fbp CDS complement(31126..31881) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene modA CDS 32001..32777 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 32790..32993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(33054..35123) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene glyS CDS complement(35157..35420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(35422..36072) product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(36145..37050) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628151.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene glyQ CDS complement(37197..38939) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene dauA tRNA 39087..39176 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(39282..39641) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(39675..40016) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 40200..40982 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene pflA sequence22 source 1..38917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..684 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269338.1:DUF6396 domain-containing protein locus_tag LOCUS_18670 CDS 758..1915 product DUF6396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2095..2415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2676..5465) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene polA CDS 5619..6917 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene purA CDS complement(6967..7722) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene tsaA CDS 7757..8662 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649448.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene menA CDS 8724..9221 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene rraA CDS 9508..10317 product lipoprotein e(P4) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene hel CDS 10322..10708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 note possible pseudo, internal stop codon CDS complement(10943..11704) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(11764..13068) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 13648..13848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(13962..14822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 14929..15945 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 16137..16412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 note possible pseudo, internal stop codon, frameshifted CDS 16442..16606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(16960..17658) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(17658..19070) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(19072..19803) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102115.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(19959..21545) product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080316864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(21909..24500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(24709..24930) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(24973..25530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 25811..26827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 26838..27995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 27995..29449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 29455..30975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(31695..31916) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(31959..33011) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(33218..34018) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(34325..35020) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene araD CDS 35252..36253 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene araF CDS 36292..37794 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene araG CDS 37813..38781 product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene araH sequence23 source 1..38434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1136..2083) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene fruK CDS complement(2086..3222) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene fruB CDS complement(3367..3993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686915.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(4012..4311) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene yggU CDS complement(4311..4865) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(4937..5455) product MltR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(5471..6616) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(6680..8560) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 tRNA complement(8837..8931) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(9013..9882) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 9978..11354 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene selA CDS 11351..13207 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene selB CDS complement(13261..14223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 14381..15220 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(15262..16524) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(16621..17700) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene fbaA CDS complement(17798..18961) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene pgk CDS complement(19139..19852) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 19953..20213 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(20411..21454) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 21627..22949 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693739.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene pssA CDS complement(23009..24133) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(24229..24828) product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 25257..26597 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 26600..27832 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 27825..28592 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 28592..29218 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene nqrD CDS 29220..29816 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631374.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene nqrE CDS 29829..31058 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648666.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene nqrF CDS 31117..32160 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 32176..32403 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene nqrM CDS 32486..33640 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100066294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene mnmA CDS 33594..33749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(33786..34490) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 34570..35964 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene srmB CDS 35983..36540 product DUF5358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 36895..37887 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene dusB CDS 37881..38180 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene fis sequence24 source 1..35595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(437..925) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(912..1586) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1599..2270) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene minC CDS 2362..2640 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2701..3294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(3341..4066) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693917.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene moeB CDS complement(4070..5293) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene moeA CDS complement(5409..5684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 5842..6498 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene folE CDS 6577..8025 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene thiI CDS 8120..9298 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene nhaA CDS complement(9357..10286) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene yvcK CDS 10422..11810 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 12010..13092 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223847752.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(13141..14220) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene purK CDS complement(14236..14733) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene purE CDS 14932..17535 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene pepN CDS 17545..18564 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene pyrD CDS 18577..19395 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 19553..20176 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 20217..21284 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene rluB CDS 21355..22338 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene cysB CDS complement(22412..22987) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene msrQ CDS complement(22995..23963) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050115893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene msrP CDS complement(24002..24265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 24406..24978 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 24991..25164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(25223..26626) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene asnS CDS 26809..28029 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 28113..28853 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene bioD CDS complement(28900..30261) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene ppnN CDS complement(30302..31141) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene queF CDS 31392..32354 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 32429..35038 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 35048..35470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 sequence25 source 1..34962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2827 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086495.1:VCBS domain-containing protein locus_tag LOCUS_19750 CDS complement(2885..3976) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(4022..4675) product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(4784..5095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 5298..6056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(6105..7520) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693645.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(7520..7876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(7970..8206) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene pspB CDS 8295..9998 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 9995..10960 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 10950..11837 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 11849..12907 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 12909..13718 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 14151..14789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(14908..15612) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050488755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(15728..16027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(16038..16607) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136345632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(16786..17793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(17876..18628) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 18830..19720 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(19755..21017) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene rho CDS 21247..22512 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene rhlB CDS 22621..22932 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rsfS CDS 22980..23450 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene rlmH CDS 23463..25493 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene mrdA CDS 25490..26602 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene rodA CDS 26615..27457 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668014.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 27479..28660 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 28672..29304 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 29585..29896 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene ybeD CDS 30166..30834 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene lipB CDS 30850..31812 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene lipA CDS complement(31885..33726) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(33825..34649) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence26 source 1..34794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1423) product DUF2827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(1533..2207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2131..2871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 3892..4131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(4530..5975) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene xylB CDS complement(6100..7419) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene xylA CDS 7643..8827 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 8831..10234 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696045.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene nhaC CDS complement(10326..10691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(10717..11157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(11242..12987) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(13018..13554) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 13954..14952 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene xylF CDS 15015..16529 product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene xylG CDS 16533..17660 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene gguB CDS 17849..19015 product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011272388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 19052..19366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(19419..20837) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(20858..22342) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(22357..23289) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(23282..24112) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(24166..25200) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(25218..26756) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(26762..27337) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(27408..28346) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(28485..29438) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(29562..30206) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652350.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene ribB CDS 30634..31887 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene nadR CDS 31894..32586 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(32649..33446) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(33448..33837) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene exbD CDS complement(33853..34323) product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene exbB sequence27 source 1..34603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 85..2057 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaactcacagctacctgtgggtagctgc CDS complement(2247..2540) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene cas2 CDS complement(2543..3061) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(3072..4085) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene cas1c CDS complement(4139..4735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075873274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(4744..6213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(6240..6914) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene cas4 CDS complement(6914..7777) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene cas7c CDS complement(7787..9565) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene cas8c CDS complement(9562..10239) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene cas5c CDS complement(10453..13992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(14042..16294) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 16714..19296 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene leuS CDS 19362..19844 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene lptE CDS 19851..20876 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene holA CDS complement(20926..21939) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 22079..23275 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 23288..24622 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene xseA CDS complement(24748..25428) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(25545..26006) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(26074..27891) product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 28291..29382 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene ulaG CDS 29472..30227 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene ulaR CDS 30300..31160 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 31157..31873 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene araD CDS 31951..32769 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 32893..33141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 sequence28 source 1..33111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(889..1071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(1061..1387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(1577..1897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(1899..2234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(2238..2624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2754..3125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(3128..4543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(4731..5282) product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(5283..5645) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(5665..7548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(7856..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(8470..8724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(8968..9573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(9542..12070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(12112..12615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(12617..15085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(15149..15415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(15415..15576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(15569..15787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(15798..16016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(16080..16298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(16285..16521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(16597..16977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(16952..17224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(17196..17411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(17442..17654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(17655..17843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(17942..18178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(18180..18314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(18318..18464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(18690..19025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(19398..19754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(19754..26614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(26638..26868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(27053..27370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(27419..27739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(28006..28356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(28358..28723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(28723..29022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(29015..29389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(29389..31344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(31463..31657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(31762..32025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(31991..32209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(32213..32476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(32509..32787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 sequence29 source 1..33015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..1229) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(1361..2128) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene potC CDS complement(2128..2985) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene potB CDS complement(2969..4090) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962024.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene potA CDS 4278..5549 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene pepT CDS 5559..6281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 tRNA 6511..6587 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 6697..7152 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rimP CDS 7176..8666 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene nusA CDS 8682..11162 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene infB CDS 11376..11774 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene rbfA CDS 11778..12701 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene truB CDS complement(12744..14912) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097266.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene rlmKL CDS 15291..16193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 16224..24344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 25471..26340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 26359..30099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 30800..31456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 sequence30 source 1..30980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..905) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(909..1553) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(1570..3033) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene cls CDS 3075..3305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 3441..4430 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene pheS CDS 4470..6860 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene pheT CDS 6865..7164 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 7273..7764 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(7837..8916) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene lptG CDS complement(8919..10025) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene lptF CDS 10112..11608 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(11801..12724) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene uspE CDS complement(12839..13612) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene fnr CDS 13991..16615 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 16731..19520 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(19605..24098) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene mukB CDS complement(24098..24829) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene mukE CDS complement(24845..26170) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene mukF CDS 26346..27284 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene ttcA tRNA 27516..27602 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(28024..28100) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 28291..28917 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene sspA CDS 28933..29385 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 29583..30773 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 sequence31 source 1..30784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..1007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(1136..1792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(1801..3399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(3832..4071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(4402..4890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(4859..5764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(5766..8219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(8324..8839) product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene hcp1 CDS complement(9010..9690) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 9842..10654 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 10654..11127 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene trmL CDS complement(11168..12076) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657841.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene era CDS complement(12073..12750) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene rnc CDS complement(12754..13038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(13083..14036) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene lepB CDS complement(14049..15845) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene lepA CDS complement(15912..16724) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 16815..17225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 17230..17532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 17538..18008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(18420..18572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(18609..18812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(19141..24606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(24622..25521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(26318..29236) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene rapA CDS 29430..30146 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene pnuC tRNA 30232..30308 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 30344..30420 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence32 source 1..30151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..455) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015701999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(621..1565) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene ispH CDS complement(1562..2062) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene lspA CDS complement(2128..4932) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene ileS CDS complement(4950..5882) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene ribF CDS complement(5938..7512) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene murJ CDS 7745..8008 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene rpsT CDS complement(8067..8714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 8809..9675 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene serB CDS 9711..10202 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 10263..10445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(10502..11425) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693419.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene ccmI CDS complement(11425..11937) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(11942..12478) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(12485..14437) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(14437..14961) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene ccmE CDS complement(14958..15170) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene ccmD CDS complement(15206..15937) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(16078..16743) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005637214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene ccmB CDS complement(16740..17375) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene ccmA CDS 17889..19445 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene leuA CDS 19447..20526 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene leuB CDS 20772..22181 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene leuC CDS 22192..22794 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene leuD CDS complement(23332..23523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 24137..24454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 24423..25412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 25475..25606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217434.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(25763..27283) product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(27309..27596) product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(27593..28348) product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(28351..29181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(29190..29510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 sequence33 source 1..29669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1642..1648 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7902..9599) product filamentous hemagglutinin transporter protein FhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene fhaC CDS complement(9937..10593) product GrxB family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(10606..12552) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene recD CDS complement(12562..16224) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene recB CDS complement(16278..16634) product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene ychN CDS complement(16662..17969) product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene adeP CDS complement(17994..18959) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(19020..19238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 19429..19902 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631703.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene ybaK CDS complement(19962..21086) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene tyrA CDS complement(21096..22151) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene aroF CDS complement(22243..24105) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene sppA CDS 24196..24750 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(24815..26467) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene glnS CDS complement(26592..27095) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667389.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene smrB CDS 27193..28152 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene prmB tRNA 28524..28599 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 repeat_region 29150..29444 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcgcacctttcacgggtgcgtgagttgaaac sequence34 source 1..29279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(1046..9655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 10028..10414 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(10474..11022) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene nudE CDS 11111..11521 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene hslR CDS 11528..15142 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694581.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 15153..16697 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696218.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene ppx CDS complement(16731..19001) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene uvrD CDS complement(19005..21005) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 21341..22840 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 22865..23845 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 23856..24785 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(24825..25541) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209516.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 25650..26564 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene mak CDS 26615..27298 product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 27311..28195 product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 28182..29159 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 sequence35 source 1..25510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..953) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene pyrF CDS complement(976..2157) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene lapB CDS complement(2157..2453) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2607..2891) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene ihfB CDS complement(2969..4618) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene rpsA CDS complement(4723..5397) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042611231.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene cmk CDS 5565..6008 product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene kbp CDS complement(6173..8584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 9004..10302 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene tig CDS 10417..11001 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene clpP CDS 11016..12254 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene clpX CDS 12366..13946 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene prfC CDS 14112..14819 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene arcA CDS complement(14958..16289) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene rimO CDS complement(16432..17055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(17127..17843) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(17827..18249) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene rraB CDS complement(18399..21464) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(21491..22654) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694357.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(22651..23469) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene proC CDS 23530..24438 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene rdgC CDS complement(24499..24888) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 tRNA complement(25071..25146) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(25166..25242) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 rRNA complement(25260..25368) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence36 source 1..24668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1286) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 1463..2089 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene upp CDS 2100..3329 product NCS2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 3370..4062 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene hda CDS 4145..4993 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 5032..5466 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene dtd CDS 5567..6784 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene gltS CDS complement(6889..7779) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665936.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(7854..8816) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene coaA tRNA 8998..9073 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 9101..9176 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 9200..9284 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 9325..9399 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 9404..9479 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 9585..10769 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene tuf CDS 10944..11372 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene secE CDS 11374..11925 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene nusG CDS 12068..12496 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene rplK CDS 12500..13183 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene rplA CDS 13487..13978 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene rplJ CDS 14030..14395 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rplL CDS 14652..18680 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene rpoB CDS 18805..23055 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene rpoC CDS 23168..24598 product IS1182-like element ISYen4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 sequence37 source 1..22733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 1173..1442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 1481..1984 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene tssB CDS 2005..3489 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108140.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene tssC CDS 3503..3919 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene tssE CDS 3922..5679 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene tssF CDS 5643..6641 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene tssG CDS 6643..7458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 7475..8155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 8159..9505 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene tssK CDS 9502..10338 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene icmH CDS 10346..11728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 11721..12368 product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033927781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene vasI CDS 12370..13773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 13782..17453 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene tssM CDS 17634..18959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 18952..20544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 20581..21003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 21006..22220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 sequence38 source 1..22650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..720) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene rpmE CDS complement(900..1250) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene rplS CDS complement(1278..2030) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene trmD CDS complement(2082..2609) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene rimM CDS complement(2643..2891) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene rpsP CDS 3223..3600 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene rpsF CDS 3602..3913 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene priB CDS 3925..4152 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005598105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene rpsR CDS 4172..4621 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene rplI CDS 4844..7285 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 7296..7913 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene dmsB CDS 7915..8715 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 8760..9359 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene dmsD CDS 9582..11969 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene rnr CDS 12045..12788 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655733.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene rlmB CDS 12847..13704 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene menB CDS 13729..14232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 14248..15240 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene menC CDS complement(15322..16005) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225017.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 16159..17382 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693155.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene envC CDS 17382..18239 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 18307..20142 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429522.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 20157..21029 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene hslO CDS complement(21098..22498) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 sequence39 source 1..20950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1422..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2990..3814) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene dapF CDS complement(4083..4682) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene plsY CDS 5219..6637 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene tnaA CDS 6724..7959 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 8092..8448 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656206.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene folB CDS complement(8568..9299) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211474.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene yigB CDS complement(9309..10193) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene xerC CDS complement(10193..11020) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693426.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene cysZ CDS 11185..12327 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693425.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene zipA CDS 12390..14399 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene ligA CDS complement(14444..15292) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995557.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(15477..16340) product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206472.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(16324..17088) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(17103..17771) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(17773..18432) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 18683..19927 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668135.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene hflK CDS 19931..20818 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene hflC sequence40 source 1..19921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 130..2163 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaactcacagctacccgtaggtagctgg CDS complement(2354..2647) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene cas2 CDS complement(2714..3871) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene cas1c CDS complement(3953..4621) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(4696..5373) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691017.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene cas4 CDS complement(5374..6213) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene cas7c CDS complement(6237..8282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(8279..9010) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene cas5c CDS complement(9021..11462) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(11691..15053) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 15487..16971 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157776019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(17058..17924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(18072..18941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 sequence41 source 1..19323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1019) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene murI CDS complement(1088..1843) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2041..3030) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(3053..4549) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(4559..5035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(5167..6327) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(6348..7325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(7414..8292) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene dapA CDS complement(8313..9314) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene pdxA CDS complement(9328..10008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(10174..12255) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene recG CDS complement(12248..14365) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene spoT CDS complement(14418..14699) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene rpoZ CDS complement(14773..15390) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693898.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene gmk CDS complement(15500..17029) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene mepM CDS 17228..18028 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene znuC CDS 18028..18813 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene znuB sequence42 source 1..18463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(469..545) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(568..643) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(669..745) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(885..1691) product lipooligosaccharide biosynthesis galactosyltransferase LsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995797.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene lsgF CDS complement(1691..2578) product lipooligosaccharide biosynthesis N-acetyl-glucosamine transferase LsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694185.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene lsgE CDS complement(2571..3758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(3758..4540) product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene lsgD CDS complement(4633..5841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(5831..6799) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 6840..7628 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(7817..8980) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694200.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene wecA CDS 9059..10342 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479079.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene hemL CDS complement(10660..11343) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(11356..11778) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694471.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 11935..12675 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene trmJ CDS 12741..13229 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659892.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene iscR CDS 13286..14500 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 14594..14977 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene iscU CDS 15008..15370 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene iscA CDS 15373..15891 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene hscB CDS 15912..17762 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene hscA CDS 17783..18124 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene fdx CDS 18126..18320 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene iscX sequence43 source 1..15129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..1038) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 1206..1565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(1633..2514) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2640..3743 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 3885..4235 product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 4329..4904 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 4961..5314 product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307336.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(5963..6814) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(6969..7841) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705820.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 7988..8638 product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 8654..8884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 9019..9894 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 9891..10175 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 10502..11356 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 11437..13314 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 13367..14209 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 14539..14754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 sequence44 source 1..14629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 98..734 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagctacctacgggtagctgtgagttgaaac CDS complement(746..2302) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694085.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(2304..2654) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693637.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 2758..4308 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene guaA CDS 4376..4996 product DUF1919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694305.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 5209..5727 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 5720..6415 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693287.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 6427..7113 product DUF2572 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869091.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 7094..7399 product DUF5374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995601.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 7498..10827 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693290.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene recC CDS complement(10859..11326) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(11328..12092) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 12280..13455 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694422.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(13521..14390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 sequence45 source 1..11193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..1105 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene tal CDS complement(1180..1974) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2219..3043) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(3261..5486) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(5695..6369) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(6515..7504) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene asnA CDS 7676..8146 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene asnC CDS complement(8225..10834) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene adhE sequence46 source 1..9946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..1847) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693140.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 2129..3265 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene dprA tRNA complement(3308..3383) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(3388..3463) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(3600..4670) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene mltC CDS complement(4683..4955) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(4948..6081) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693157.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene mutY CDS complement(6318..6908) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 7062..8276 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 8286..9113 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815345.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 9220..9486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 sequence47 source 1..8527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(284..1528) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(1534..3672) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(3726..4991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 misc_feature complement(5399..>8527) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:Ig-like domain-containing protein locus_tag LOCUS_24460 sequence48 source 1..8013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..903) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene hemG CDS complement(920..2386) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2398..3042) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(3120..3245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 3302..3541 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene tusA CDS 3541..4017 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene greB CDS complement(4018..4449) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670174.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(4459..5427) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694646.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene rseB CDS complement(5509..6087) product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(6140..6715) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rpoE CDS complement(6843..7100) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694645.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(7255..7932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 sequence49 source 1..7943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..3155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 3159..4022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 4116..5459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 5463..6329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 6411..7310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 sequence50 source 1..5896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(331..1095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(1095..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(1315..2142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2139..3593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(3967..4368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(4352..5278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 sequence51 source 1..5189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(1210..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(1634..2332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2551..2688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(2963..3283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(3286..3561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(3824..4690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 misc_feature complement(4683..>5189) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000053614.1:type VI secretion system tip protein TssI/VgrG locus_tag LOCUS_24770 sequence52 source 1..3629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 594..1970 product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 2074..3288 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693687.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 sequence53 source 1..2998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(517..1092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(1246..1770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 sequence54 source 1..2319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001075998.1:glycoside hydrolase family 19 protein locus_tag LOCUS_24820 CDS 909..1751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 1990..2229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 sequence55 source 1..1811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 825..1619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 sequence56 source 1..1312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence57 source 1..1213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence58 source 1..1183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence59 source 1..1124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence60 source 1..1102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(701..1045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 sequence61 source 1..1097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(812..887) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 sequence62 source 1..1069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@