COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..763576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(316..391) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(495..683) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene yacG CDS complement(680..1837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1834..2436) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2460..2678) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene infA CDS complement(2864..3334) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3348..3824) product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(3843..5144) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene hisD CDS complement(5134..5805) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene hisG CDS complement(5805..6242) product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(6247..7512) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene murA CDS complement(7520..8074) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene dcd CDS 8202..9548 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene pabB CDS 9586..9909 product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212347691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 9909..10385 product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 10382..10516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 10568..10840 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 10840..11253 product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 11263..11832 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 11829..12632 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(12635..13087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(13179..13793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(13790..15655) product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene exaA CDS 15927..17132 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 17110..17748 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 17897..19417 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 19482..19880 product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 20113..21009 product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene pqqB CDS 21006..21731 product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene pqqC CDS 21728..22006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 22003..23088 product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene pqqE CDS complement(23208..24179) product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 24370..24813 product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene pedF CDS 24815..25702 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 25699..26466 product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 26463..27383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 27525..29291 product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 29438..30100 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(30121..30894) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 30999..31895 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(31889..32371) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene greB CDS complement(32376..32780) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(32898..33788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 33948..34466 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene def CDS 34499..35437 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene fmt CDS 35446..36204 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene truA CDS 36275..36727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 36808..37233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 37542..38048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(38052..39236) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene dapE CDS complement(39247..40071) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene dapD CDS complement(40130..40789) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 40954..42639 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 42636..43910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(43924..44871) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene argB CDS complement(44901..45572) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene yihA CDS complement(45569..47377) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene yidC CDS complement(47377..47649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(47646..48071) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rnpA CDS complement(48085..48219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 48400..49038 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene parA CDS 49035..50102 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(50109..51179) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene aroC CDS complement(51179..51952) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene fabI CDS 52178..52795 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene pdxH CDS 52810..53778 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 53796..54545 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(54551..55579) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene cobT CDS 55655..56428 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene cobS CDS 56421..57053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 57089..57997 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 58005..59756 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 59812..60750 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 60750..61337 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 61386..61865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 61932..62381 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 62546..63421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 63434..64069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 64169..65239 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ada CDS 65785..66855 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 66872..67171 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 67185..68618 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 68753..69814 product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 69906..72233 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(72334..74157) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene recQ CDS 74275..75120 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 75236..76576 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene rimO CDS 76658..77719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 77793..78032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(78039..78833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 79033..80517 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009208278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 80531..81736 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 81745..83031 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene glcF CDS 83163..84302 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(84299..85549) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(85557..86408) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 86326..86559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 86519..87520 product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(87498..89909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 89964..90257 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 90353..91702 product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 91755..92312 product global response regulator transcription factor ActR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene actR CDS complement(92382..93497) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(93628..95202) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(95221..96291) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 96447..97091 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 97149..99656 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(99660..100298) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(100306..100599) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(100601..101008) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(101031..101906) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rapZ CDS complement(101903..102355) product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(102387..104063) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(104066..104773) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(104825..106066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 106437..107123 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 107293..108900 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 108981..110201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 110277..111938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(111943..114027) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(114096..116906) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene polA CDS complement(116896..117078) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 tRNA 117206..117282 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(117368..117739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(117752..119365) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(119334..119744) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(119810..120190) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(120195..120515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(120518..121108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(121172..121558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(121571..123238) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(123225..124445) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(124573..124875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(124868..126208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 note possible pseudo, frameshifted CDS complement(126210..127448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(127445..127735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(127732..128097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(128104..128382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(128399..129106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(129249..129449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 129703..130191 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164650609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 130188..130469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(130591..131868) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 132324..134918 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 135295..136806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 136803..137333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 137330..138538 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene cas7e CDS 138543..139286 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene cas5e CDS 139283..140017 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 140030..140986 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene cas1e CDS 140980..141285 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027192065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene cas2e repeat_region 141321..142387 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcccccgcatacgcggggatggaccc repeat_region 142703..143035 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcccccgcatacgcggggatggaccc CDS complement(143449..144084) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 144192..145217 product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 145452..146546 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 146650..147783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 147855..149483 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 149502..150425 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 150612..151217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(151231..152100) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene hisN CDS complement(152190..152627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 152715..153671 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(153653..154414) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(154411..155337) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 155514..157019 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene glpD CDS 157019..157816 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(157827..158360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(158357..158932) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 159103..159477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 159474..160184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(160193..162718) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(162715..163371) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 163448..164074 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 164104..165144 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 165212..165655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 165734..166543 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 166594..167055 product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene phnB CDS complement(167059..167718) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(167865..169496) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(169582..170217) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(170237..171547) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 171747..173651 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(173662..174516) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(174513..174764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(174779..175183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 175331..176050 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 176047..177396 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969540.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 177478..179157 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 179293..180138 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(180193..180816) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(180949..182079) product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 182270..183181 product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104756978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(183195..184691) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(184752..185102) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(185244..187067) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene typA CDS complement(187260..188177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(188229..188639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(188665..191295) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 191379..192353 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(192358..193494) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(193491..194444) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 194613..195548 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(195847..196350) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(196347..197201) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 197125..197343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 tRNA 197508..197582 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(197645..198946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(198982..199476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 199655..200344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 200347..201234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(201184..201675) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 201848..203371 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 203368..204549 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(204552..205937) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 206108..209932 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene putA CDS 210027..210446 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(210462..211241) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(211349..211555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(211552..213576) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(213573..214031) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 214178..214471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 214482..215279 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene xth CDS 215361..217757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(217758..218201) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(218203..220776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(220808..222184) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(222188..224233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(224240..225157) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene hemC CDS 225224..226273 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene tsaD CDS complement(226280..226972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 227066..228103 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163719979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 228125..228862 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 228874..230112 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 230109..230873 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 230952..231356 product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(231384..234002) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene pepN CDS 234102..235034 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338197.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene thyA CDS 235058..235549 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 235793..237208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 237366..237986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(237971..238513) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(238642..238914) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 239050..239715 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 239712..241106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(241075..241317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 241429..242343 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(242345..243070) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184941.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(243067..243651) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(243659..244384) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 244488..245060 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 245084..245893 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(245880..246857) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(247040..248320) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(248324..249364) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene bioB CDS 249530..250678 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene bioF CDS 250675..251355 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene bioD CDS 251439..252119 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 252234..254150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(254154..257591) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 257709..258059 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 258228..259439 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 259436..260377 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene argF CDS 260499..261434 product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 261445..262023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(262036..262224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(262234..262437) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(262437..263000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(263083..264111) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(264134..264859) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene fabG CDS complement(264859..266109) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(266132..267340) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(267349..267768) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(267824..268102) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(268148..268420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 268301..269656 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 269777..270172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(270173..270394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 270514..271431 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543524.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(271445..272371) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 272578..273204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(273229..273801) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 273890..274957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(274976..275908) product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(275901..277013) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene hisC CDS complement(277051..277896) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(278012..278779) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 278842..279615 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene gloB CDS 279612..280229 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 280226..280663 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(280667..281164) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(281216..281842) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(281907..282773) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(282787..283509) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(283587..284762) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 285009..285647 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene phaR CDS complement(285670..286521) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene pdxY CDS 286668..287537 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 287542..288591 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 288794..289177 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene sdhC CDS 289188..289577 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene sdhD CDS 289586..291373 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene sdhA CDS 291407..292186 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 292324..292788 product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(292829..293761) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 293874..295514 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(295638..297017) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 297551..298468 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 298471..299937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 299934..300755 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 300752..301474 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 301476..301838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 301961..303079 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 303230..304411 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(304420..305085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(305219..305476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(305473..306549) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 306570..308363 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 308381..312544 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(312602..313111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(313245..314222) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(314215..315654) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(315732..316646) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(316643..319267) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(319390..322713) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(322807..323040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 323039..324484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 324481..325218 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 325203..326762 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(326767..328101) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hemN CDS 328284..328931 product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 329260..329457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(329569..330303) product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 330499..331794 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene ahcY tRNA complement(331890..331976) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 332335..332829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(332833..333318) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(333315..333815) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(333812..336343) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 336503..337300 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 337505..338185 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 338227..339270 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 339345..340400 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(340397..340795) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104285.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(340898..342184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(342356..343147) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(343149..343910) product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(343907..344830) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(344915..345259) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 345386..345838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 345869..346270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(346278..346487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 346673..347128 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(347083..347322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 347502..349289 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 349435..350580 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 350659..351864 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 351888..354065 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 354216..354560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(354561..355979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(356048..356941) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(356971..357630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(357701..358354) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(358392..359570) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 359788..360417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 360502..361143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 361308..363614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 363746..364573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 364777..365742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 365739..367040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 367033..368331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 368351..368887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 368911..369360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 369383..369565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 369668..369862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 369888..370139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 370297..370593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 370751..371215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(371324..373036) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(373207..374190) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 374282..375169 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(375170..375964) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 376090..377178 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(377233..378204) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 378298..379644 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 379646..379969 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(379973..382030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 382293..383570 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 383583..384887 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene preA CDS 385029..386276 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 386278..387078 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 387083..387988 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 387985..388938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 388952..389935 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 390011..391456 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene hydA CDS complement(391463..392086) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(392265..392867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 392976..394322 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(394357..395073) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 395251..396570 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene fliI CDS 396575..397021 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene fliJ CDS complement(397025..398164) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 398207..398992 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene modA CDS 398999..399688 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene modB CDS 399685..400752 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene modC CDS 400838..401275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 401272..402546 product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(402553..403008) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(403005..403400) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 403650..404825 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 404893..405720 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 405734..406426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(406401..406883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(406975..409029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 409147..409677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 409719..410051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 410087..410776 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(410801..411421) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(411584..411997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(412134..412520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 412429..413691 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 413708..415954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(415945..416595) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(416714..417010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 417136..417465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 tRNA complement(417506..417580) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(417752..418681) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(418726..419679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 tRNA 419956..420041 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 420158..420231 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 420483..421673 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene tuf tRNA 421699..421774 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 421945..422142 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene secE CDS 422146..422676 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene nusG CDS 422982..423410 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rplK CDS 423415..424110 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rplA CDS 424467..424991 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rplJ CDS 425037..425414 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene rplL CDS 425573..429688 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rpoB CDS 429781..433959 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rpoC CDS complement(434033..434563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(434536..435351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(435439..435819) product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene hpxZ CDS 436041..436733 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 436750..438327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 438516..438902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 439208..439402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 439399..440799 product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 440826..441251 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 441559..441930 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene rpsL CDS 441942..442412 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rpsG CDS 442425..444500 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene fusA CDS 444533..445723 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene tuf assembly_gap 445727..445824 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 445948..446256 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rpsJ CDS 446267..446962 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rplC CDS 446966..447583 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rplD CDS 447580..447873 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 447877..448707 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rplB CDS 448719..448997 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rpsS CDS 449002..449391 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rplV CDS 449395..450174 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rpsC CDS 450181..450600 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rplP CDS 450603..450809 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rpmC CDS 450843..451106 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rpsQ CDS 451131..451499 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rplN CDS 451499..451837 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rplX CDS 451830..452387 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rplE CDS 452398..452703 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rpsN CDS 452715..453113 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpsH CDS 453130..453663 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rplF CDS 453669..454028 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rplR CDS 454052..454606 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene rpsE CDS 454613..454795 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rpmD CDS 454833..455384 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rplO CDS 455541..456884 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene secY CDS 456881..457537 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 457725..458093 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rpsM CDS 458174..458563 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rpsK CDS 458716..459732 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 459778..460194 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene rplQ CDS 460280..461692 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 461705..463066 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 463063..463926 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 464026..465318 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene gabT CDS 465323..466777 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 466963..467265 product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 467378..467752 product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(467833..469851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(469946..471148) product capsule polysaccharide export outer membrane protein CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ctrA CDS complement(471213..472145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 note possible pseudo, frameshifted tRNA complement(472672..472748) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(472810..473760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(474130..474867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 475003..475677 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(475635..476312) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(476662..477321) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 477414..478163 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 478248..478619 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 478616..479881 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 479953..480417 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(480387..481799) product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(481801..482568) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(482568..483377) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(483389..484378) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167770862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(484525..485709) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene ssuD CDS complement(485855..485998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(486064..486651) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(486738..487679) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(487687..489177) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(489204..489992) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(489997..490851) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(490879..492009) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 492169..493002 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(493032..493190) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(493208..494263) product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 495018..495689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 496092..497798 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene leuA CDS complement(497845..498258) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 498342..499349 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene ftrA CDS 499480..499797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(499858..500628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(500665..501078) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(501100..502740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(502757..503167) product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 tRNA complement(503311..503385) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(503473..504009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 504130..505026 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 505088..505657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 505560..506882 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 506888..508120 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 508125..508688 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 508685..509905 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 509926..510312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 510315..510896 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 510893..511219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 511216..511491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 511481..511906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 511918..512322 product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 512366..512665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 512671..512859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 512942..513580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 513589..514218 product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 514215..515090 product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 tRNA complement(514979..515055) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 515068..515508 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 515511..519500 product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 519530..520711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 520708..521001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 521001..521315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 521312..521797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 521810..521992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 522133..522993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(522990..524048) product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene epmA CDS 524143..524712 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene efp CDS 525082..525414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 525477..525674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 525818..526972 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 526979..528163 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 528205..528951 product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 529037..531136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(531204..533162) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(533257..534354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(534370..535365) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(535417..535812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 535935..537107 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 537139..538296 product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 538298..539104 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 539136..540035 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 540032..540694 product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 540777..541136 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(541137..541958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 542125..542562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 542559..542975 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(542991..545225) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(545285..545788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 note possible pseudo, frameshifted CDS 546035..547231 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 547276..548337 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 548537..549415 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 549661..550662 product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 550665..553088 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 553250..554098 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 554249..556282 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 556303..557679 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 557736..558521 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 558529..559326 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 559341..560666 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 560677..562215 product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 562245..563111 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 563123..563917 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 563940..564881 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 564878..565963 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 565972..566721 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 566726..567886 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 567898..568926 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 568949..570100 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 570111..571010 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 571012..572136 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 572133..573320 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 573332..574114 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 574170..574472 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 574624..575550 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(575635..576786) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(576890..578116) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(578169..579182) product spirocyclase AveC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(579186..580043) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 580132..581058 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 581085..581573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 581765..583537 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 583565..584326 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 584334..585104 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 585244..586629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 assembly_gap 586150..586248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 586635..587642 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 587728..588555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 588548..589423 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 589424..589888 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 589963..591165 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 591319..592248 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 592334..593158 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(593270..593947) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 594016..595131 product triclosan efflux RND transporter adaptor protein TriB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene triB CDS 595146..598232 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(598210..599076) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(599095..599766) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(599859..600365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(600382..600888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 601178..601858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(601865..602317) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(602363..603646) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(603668..604549) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene accD note possible pseudo, internal stop codon, frameshifted CDS complement(604569..605405) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene trpA CDS complement(605402..606628) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene trpB CDS complement(606631..607278) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(607289..608407) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(608404..609345) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(609342..609686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(609708..610058) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene ihfB CDS complement(610087..610983) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene sppA CDS 611242..611388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(611609..612325) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene arsH CDS complement(612325..613380) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene arsB CDS complement(613390..613827) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene arsC CDS complement(613824..614363) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(614356..614721) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 614921..615112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(615213..616916) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rpsA CDS complement(617031..617690) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene cmk CDS complement(617704..619020) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene aroA CDS 619138..619638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 tRNA 619762..619837 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 619947..620447 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene gpt CDS complement(620419..621387) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 621386..622234 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 622277..623110 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051914638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(622999..623367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(623364..624965) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(625109..625312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 625336..628170 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 628236..628649 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(628653..629066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(629338..629976) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 630136..630678 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 630678..632210 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(632221..633177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(633189..634244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(634255..635022) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(635133..635522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 635475..635684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 636081..637982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 638074..638229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 638639..639493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 639490..640914 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 640911..642185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 642201..643574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 643597..644520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 644536..645459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 645459..646154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 646151..646492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(646562..646960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(646965..648638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 649022..650059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(650151..650735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 650814..651620 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 651975..652550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 652550..653347 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 653477..656923 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 657002..658186 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 658214..659263 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 tRNA 658948..659036 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 659361..660179 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(660205..662970) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(663127..665127) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(665150..665968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(665972..668239) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(668257..670392) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(670397..670831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(670843..672774) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(672994..673674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(673762..674562) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(674624..674812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 675195..676247 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 676237..676911 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 677208..678224 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene tauA CDS 678302..679048 product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 679045..679830 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(679814..680992) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(681065..681994) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(682343..683167) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(683172..684086) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 684563..687103 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(687141..688799) product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene atsA CDS 689258..691675 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 691684..692763 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 692792..693715 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 693727..694551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 note possible pseudo, frameshifted CDS 694548..695333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 note possible pseudo, frameshifted CDS 695346..696092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 696225..697040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 697078..697872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 697874..698305 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene tolR CDS complement(698316..699680) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(699693..700430) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218136709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(700440..701660) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 701832..702668 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(702650..704023) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(704023..704727) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(704727..706553) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(706570..707457) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(707513..708664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(708796..710115) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 710362..711501 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 711514..713154 product rhodanese homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 713164..714390 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 714522..715481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 715478..716290 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 716397..717464 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 717506..718573 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(718535..719482) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene gcvA CDS complement(719688..721295) product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(721292..723253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 723655..726018 product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene piuA CDS 726082..726765 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 726872..727999 product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene dhbC CDS 728009..728656 product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene entB CDS 728653..729393 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(729401..730528) product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene yiuA CDS complement(730543..731028) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 731058..731684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(731662..732471) product ferric enterobactin esterase PfeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene pfeE CDS 732697..734316 product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 734316..734549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 734546..738397 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(738370..739149) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(739152..740198) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 740361..741590 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 741602..742879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(742892..744391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 744709..746943 product TonB-dependent siderophore receptor PirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene pirA CDS complement(746927..748138) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 748249..748896 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 748983..750272 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 750262..750795 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(750804..752489) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(752784..753776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(753807..754124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(754139..754477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(754498..754758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(754815..756311) product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(756778..759522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 759903..761405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 761467..761748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 761745..762098 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 762121..762438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 762464..763471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 sequence02 source 1..650618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..1867) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 2144..5572 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(5584..6240) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 6497..7249 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 7242..7982 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 8061..9266 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 9307..10194 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 10197..11177 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 11297..11899 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(11906..13756) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(13749..14453) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 14574..15491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 15600..16004 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(16056..18218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(18205..18972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(18985..19632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 19782..20039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(20079..23420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 assembly_gap 20947..21036 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23521..23877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(23874..25463) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(25504..27018) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(27034..27261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(27274..27411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(27427..28695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 note possible pseudo, frameshifted CDS complement(28692..29372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 note possible pseudo, frameshifted CDS complement(29374..30366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(30540..31031) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(31044..31616) product ATP synthase F0 subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(31645..31869) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(31928..32671) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(32689..33027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(33294..36755) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene smc CDS complement(36894..37517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(37592..38110) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 38211..39215 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene mutY CDS 39255..40193 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene argC CDS complement(40213..41352) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(41409..42053) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 42219..42710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(42721..43515) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 43621..44232 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 44392..44850 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rplM CDS 44854..45351 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rpsI CDS complement(45402..46307) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 46430..46861 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 47367..48119 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 48136..48645 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 48649..48900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(48907..49707) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(49704..49919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(49919..51463) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene xseA CDS 51519..52799 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene purD CDS 52874..53950 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(53952..54815) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 55061..55714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(55776..56225) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 56259..57581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 note possible pseudo, internal stop codon, frameshifted CDS 57559..58107 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rsmD CDS complement(58168..60006) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mutL CDS complement(60018..61337) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(61494..62105) product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(62119..62613) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene lspA CDS complement(62606..65434) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ileS CDS complement(65554..66498) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(66512..66946) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 66974..67168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 67202..67588 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 67599..68318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 68355..69200 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(69163..70005) product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(70024..70326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(70336..71697) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 71836..72321 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 72335..72655 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(72767..73006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 72915..74099 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(74077..74526) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rnhA CDS complement(74519..75487) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(75500..76444) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene ispH CDS 76554..77129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 77514..78725 product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene hemA CDS complement(78741..79235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(79316..80059) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 80160..81062 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(81117..84836) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 85162..86988 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene recJ CDS 86998..87291 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 tRNA 87458..87533 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 87571..87978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(87975..88679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(88773..89597) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(89638..90336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 90544..91293 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene lepB CDS 91290..91961 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rnc CDS 91958..92884 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene era CDS 92996..93421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 93518..94504 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(94501..95457) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene coaA CDS 95658..96389 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene recO CDS 96400..98625 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene parC CDS complement(98622..98828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(98844..99533) product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(99589..100026) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 100151..101056 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 101137..101988 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene phnC CDS 102021..103022 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene phnD CDS 103144..103977 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene phnE CDS 104076..104903 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene cobA CDS complement(104919..105572) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(105569..106459) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 106556..107323 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(107361..108233) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 108311..108748 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(108873..109151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(109229..109777) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 109839..110774 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(110719..111450) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(111447..112946) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(113015..113482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(113486..114058) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 114161..115297 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 115316..115714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(115716..116822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 116949..117746 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(117747..118223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 118334..119908 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene purH CDS complement(119935..120171) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(120204..121052) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(121158..123353) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene purL CDS complement(123353..124045) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene purQ CDS complement(124048..124287) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene purS CDS complement(124363..125127) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 125352..125663 product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 125660..126121 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 126223..126621 product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(126622..126801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 127004..128194 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(128191..129072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 129180..130358 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 130398..131012 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 131009..132499 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(132507..132722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 133007..134200 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 134318..135442 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(135456..136724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(136822..137289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(137368..138540) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 138829..140268 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(140273..141280) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(141405..141764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 141937..143598 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 143600..144946 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene gltX CDS 145025..146164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 146472..147455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(147449..147670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 147557..148948 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene cysS CDS 148953..150623 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene cimA CDS 150620..151477 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(151560..152330) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(152346..152702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(152761..153282) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(153279..153644) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(153728..154678) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 154791..155657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(155578..156963) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 157240..157698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 157759..158931 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(158903..160282) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 160175..160435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 160398..161327 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(161285..161722) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(161722..162489) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene xth CDS complement(162496..162888) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene erpA CDS 163021..164223 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 164220..165980 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene argS CDS 165980..166885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 166872..167900 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene nagZ CDS 167897..168577 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 168594..169382 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 169379..170089 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene scpB CDS 170194..171882 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 171895..172941 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 173047..173289 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 173358..173750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 173752..174570 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene tatC CDS 174657..175925 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene serS CDS 175918..176712 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene surE CDS 176716..177357 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 177389..178672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(178673..179530) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 179640..179978 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene yajC CDS 180051..182633 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene secD CDS 182637..183014 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 183016..183846 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 183930..184820 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 184834..185472 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene gmk CDS complement(185447..186043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 186102..186737 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(186709..187554) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(187621..188832) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(188829..189686) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene rsmA CDS complement(189683..190711) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene pdxA CDS complement(190716..192017) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(192163..194376) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene lptD CDS complement(194376..195482) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene lptG CDS complement(195484..196617) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene lptF CDS complement(196627..198171) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 198298..199794 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 199803..200261 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 200383..202317 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 202461..202766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(202809..203120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(203224..205107) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 205225..205647 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene ndk CDS complement(205737..207296) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(207634..208545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(208549..209193) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene purN CDS complement(209190..210314) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene purM CDS 210406..211014 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 211070..212275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 212306..212860 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 212857..213936 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 213923..214630 product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene hdaA CDS 214723..216903 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 216918..218429 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene ppx CDS complement(218426..219175) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene prsW CDS complement(219205..220377) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene rnd CDS complement(220431..221525) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 221757..223538 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene aspS CDS 223638..224276 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 224385..224852 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rpiB CDS 224885..226189 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 226260..226721 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene nrdR CDS 226750..227826 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene ribD CDS 227838..228434 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 228431..229564 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene ribB CDS 229570..230085 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 230082..230570 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene nusB CDS 230602..231576 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene thiL CDS 231573..232046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 232051..233283 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 233398..235494 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(235581..236084) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 236235..236774 product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 236779..237345 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 237461..237604 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene rpmF CDS 237625..238710 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene plsX CDS 238707..239696 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 239792..240103 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 240110..240673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 tRNA 240775..240851 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(240894..241103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 241238..242497 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 242668..243231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 243315..244379 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(244459..245742) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(245851..246270) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 246396..247910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(247920..248666) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(248681..250138) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(250255..253302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 253963..254289 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 254434..256923 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 257185..258153 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene prfB CDS complement(258190..258627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(258569..259909) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(260011..260481) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(260486..263467) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, frameshifted CDS 263631..266783 product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(266790..267677) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene nadC CDS complement(267674..269299) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(269332..270435) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene nadA CDS complement(270516..270899) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(270896..271177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 271209..272138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(272151..273224) product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(273261..274511) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene tyrS CDS 274601..275689 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(275656..276300) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 276597..277346 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene cysE CDS 277360..277824 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 277842..278996 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 tRNA 278124..278217 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 278989..280242 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 280269..280655 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene iscU CDS 280674..281018 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 281035..281649 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene hscB CDS 281649..283532 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene hscA CDS 283565..283903 product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 283914..284108 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene iscX CDS 284105..284821 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene tenA CDS 285005..285751 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(285745..285978) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(286026..286298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(286363..287196) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene hemF CDS complement(287193..287663) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 287815..288363 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene petA CDS 288375..289604 product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 289619..290383 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 290463..291344 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 291346..291897 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 291905..292972 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene htpX CDS 293039..293356 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 293510..293827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 294055..295056 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pdhA CDS 295074..296420 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 296435..297712 product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 297723..299120 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene lpdA CDS 299130..300074 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene lipA CDS 300088..300540 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(300516..300959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 301128..302021 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 302202..303548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 303558..304475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 304588..305037 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(304998..305837) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 305990..306787 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene mazG CDS complement(306796..308151) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene hflX CDS complement(308148..308402) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene hfq CDS complement(308747..310141) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(310131..312383) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(312463..313932) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ntrC CDS complement(313948..315066) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(315066..316082) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene dusB CDS 316304..317413 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 317415..317876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 317870..318388 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969234.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 318385..319209 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene murI CDS 319240..320265 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 320354..321250 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(321235..322917) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(322931..323824) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(323821..324834) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(324850..326475) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 326771..327577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 327465..329036 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 329033..332233 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(332246..332638) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(332635..332973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 333861..337109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 337128..338027 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene cas1 CDS 338029..338370 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene cas2 repeat_region 338446..343695 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttagcggtctggtgactggggtccaaccgcaac CDS complement(343752..344387) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(344384..344863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 344981..345910 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 345944..346408 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 346405..346929 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 346919..347599 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(347654..348928) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene eno CDS complement(348952..349797) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene kdsA CDS complement(349813..351438) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(351505..351942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(352031..352783) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene tpiA CDS complement(352881..353888) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 354012..355916 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 355913..357424 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene trpE CDS complement(357372..358574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 358768..360393 product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 360390..361193 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene trpC CDS 361190..361666 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene moaC CDS 361663..362856 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 362860..363822 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene pip CDS 363926..364630 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene lexA CDS complement(364624..366606) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 366802..368214 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene gltX CDS 368424..369719 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene gltA CDS 369737..369955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(369965..371161) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene lpxB CDS complement(371158..371997) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(371984..372787) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene lpxA CDS complement(372799..373272) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene fabZ CDS complement(373265..374305) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene lpxD CDS complement(374302..374862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(374862..377126) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene bamA CDS complement(377201..378346) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene rseP CDS complement(378415..379572) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(379572..380384) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(380421..381155) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(381190..381750) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene frr CDS complement(381755..382474) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene pyrH CDS complement(382660..383586) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene tsf CDS complement(383635..384438) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene rpsB CDS 384710..385732 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 385842..388238 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(388300..388833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(388887..392360) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene dnaE CDS complement(392398..393078) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(393071..394312) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(394464..395780) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 396501..396836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(396900..397160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(397368..399062) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(399059..399853) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(399857..401308) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene nuoN CDS complement(401308..402852) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(402849..404831) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene nuoL CDS complement(404836..405144) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene nuoK CDS complement(405148..405759) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(405770..406258) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene nuoI CDS complement(406270..407274) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene nuoH CDS complement(407296..407451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(407444..409510) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene nuoG CDS complement(409521..410816) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene nuoF CDS complement(410821..411255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(411438..412616) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(412630..413295) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(413309..413845) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(413836..414201) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 tRNA complement(414639..414715) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(414969..416612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 tRNA complement(416841..416917) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 417076..417801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 tRNA complement(417789..417863) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(417958..418233) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(418424..420835) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene lon CDS complement(421021..422286) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene clpX CDS complement(422582..423223) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(423337..423711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(423782..425095) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene tig tRNA complement(425119..425203) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(425258..426748) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(426745..427299) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(427302..427631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(427635..428648) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 tRNA complement(428823..428899) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 429287..433612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(433634..434593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(434764..435933) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 436217..436555 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 436608..438017 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene glnA CDS 438168..439253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(439388..439816) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 439999..441975 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene parE CDS 441999..442550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 442733..443161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 443393..445027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(445140..445643) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120796836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(445811..447259) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 447518..448165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 448303..449103 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 449198..449998 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene paaG CDS 450004..450804 product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(450808..452118) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(452123..453157) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(453229..454446) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 454556..454894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 454894..456075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(456069..457325) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(457459..458517) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(458533..459858) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(459855..460364) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(460373..461140) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 461294..462166 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(462097..463866) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(464092..465393) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(465390..467138) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(467135..468646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(468646..470505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(470648..475084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(475238..480322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(480477..480887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(481037..482968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(483154..483555) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene acpS CDS complement(483552..484301) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(484339..484926) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene pyrE CDS complement(484988..487153) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(487251..487631) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rpoZ CDS complement(487726..488232) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene folK CDS 488338..488958 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(489071..489442) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 489530..491173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(491184..492881) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(492962..494290) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(494485..494967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 tRNA complement(494980..495063) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(495136..495447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(495634..496413) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 496456..497436 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 497517..498341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 498376..499449 product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 499474..500532 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 500542..501576 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 501632..502465 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 502462..503166 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188483638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene sfsA CDS 503247..504092 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene map CDS 504082..504807 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene radC CDS 504902..508384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 508493..508660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(508664..509110) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 509231..510529 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene purB CDS complement(510550..511698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(511760..515329) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene mfd CDS complement(515342..515608) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(515642..516097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 516144..518237 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene recG CDS 518281..519078 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 519178..520374 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(520409..521308) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene rarD CDS complement(521434..521739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(521736..522239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 522437..522832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(522841..523161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 523484..524479 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 524610..525629 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(525849..526577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 526919..527482 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 527519..529402 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 529424..530512 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 530627..531526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 531654..533210 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 533212..534285 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 534288..535217 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 535243..536331 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 536396..537697 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene guaD CDS complement(537684..539396) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene ade CDS complement(539456..539998) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(539995..541065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(541062..541703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(541791..542351) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(542369..542665) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene rpmB CDS 542874..543965 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767796.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 543980..544888 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(544892..545926) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene meaB CDS 546003..546887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(546975..549341) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(549563..550234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(550287..550709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(550818..551264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(551264..552058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(552045..552914) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(552919..553173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 553346..553927 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 553938..554615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 554682..555206 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 555318..555950 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(555985..556392) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene mscL CDS complement(556481..556834) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(556881..557285) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene rnk CDS 557595..559436 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(559426..559893) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(559982..561631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 561771..562451 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(562463..562699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(562780..564069) product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(564066..565349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(565346..566266) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 566401..567456 product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 567569..568267 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067653415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(568277..568498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(568715..569470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(569618..571258) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene groL CDS complement(571309..571644) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene groES CDS 571979..572806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 572806..573183 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 573180..573563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 573646..574791 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rodA CDS 574797..575432 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(575454..575837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(575844..576428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(576445..577515) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(577613..578245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 578350..578775 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(578797..578967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(579056..579934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(580281..580901) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(580916..581374) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene nikR CDS complement(581442..582674) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(582810..583976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 584278..584922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(585164..586378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(586831..588069) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 588216..590030 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 590144..592075 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 592095..592862 product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(592843..593775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(593772..595160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 595274..596398 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(596697..597377) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(597374..599635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(599705..600067) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(600146..600568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 600689..601330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(601334..602761) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(602914..603435) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 603830..605263 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(605299..606534) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(606641..607483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(607483..608391) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(608381..610201) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(610309..611193) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(611291..612484) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(612587..613603) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(613635..613832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 613839..615476 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(615670..617319) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109795256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 617422..618243 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(618341..618511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 618473..620155 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 620145..620663 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene moaB CDS 620730..621914 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(621931..622917) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene thiS CDS 623062..625008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 625097..625579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 625599..626105 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene sodN CDS 626114..626431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 626555..627013 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene aroQ CDS 627084..627545 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene accB CDS 627561..628913 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene accC CDS 628973..629617 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene aat CDS complement(629693..630205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(630202..630675) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene mlaD CDS complement(630740..631120) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(631226..631774) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene cobU CDS 631958..636301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(636309..636692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(636689..637150) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(637147..638589) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119204.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene amn CDS complement(638632..639000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(638975..639172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(639169..641007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(641029..642072) product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene pseI CDS complement(642069..643613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(643610..644320) product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene pseF CDS complement(644317..645468) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene pseC CDS complement(645468..646466) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene pseB CDS 646847..647143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 647147..647473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(647363..647596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 647618..647794 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(647856..650411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 sequence03 source 1..601736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 355..1854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1910..4558) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene clpB CDS complement(4768..5229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(5489..6343) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene prmC CDS complement(6359..7429) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene prfA CDS complement(7431..8675) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene hisS CDS complement(8753..9868) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene ispG CDS complement(9886..10995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(11197..13461) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ptsP CDS complement(13461..14501) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(14527..15750) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 15898..16650 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene ubiG CDS complement(16758..17180) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(17223..18203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(18205..19029) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(19048..19308) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene grxC CDS complement(19363..20124) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 20173..21090 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(21109..22146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(22228..22629) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(22637..23884) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene argJ CDS complement(23930..24835) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 25217..27919 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene secA CDS 27971..28435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(28450..28788) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(28782..29345) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 29806..32460 product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ndvB CDS 32492..33040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(33037..34557) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(34769..35644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 35850..36689 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(36673..37098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(37136..39403) product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(39421..39822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(39812..41728) product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(41881..42561) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(42566..43405) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 43569..44993 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(45054..46610) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(46807..47712) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene hflC CDS complement(47712..48833) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene hflK CDS 49012..50112 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 50141..51850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(51862..53793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(53798..54712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(54849..55508) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(55505..55966) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 56248..57021 product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene fpr CDS 57092..58606 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 58603..60063 product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 60115..63153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 63173..63859 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mtgA CDS complement(63850..64467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 64756..65196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, internal stop codon CDS complement(65225..67729) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene hrpB CDS complement(67782..68516) product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene pppA CDS complement(68513..69265) product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene tagF CDS complement(69247..72843) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene tssM CDS complement(72851..74353) product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(74380..75717) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene tssK CDS complement(75753..77273) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene tagH CDS complement(77287..77589) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(77586..78221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(78280..80244) product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene vgrG1b CDS complement(80271..80951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 80863..81132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(81099..81590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(81767..84394) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene tssH CDS 84744..85913 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene tssA CDS 86142..86645 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene tssB CDS 86649..88139 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene tssC CDS 88162..89700 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene tssC CDS 89726..90562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 90559..91050 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene tssE CDS 91043..92869 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene tssF CDS 92833..93894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 93910..95427 product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 95616..97544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(97674..98141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 98095..98874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 99032..100861 product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 100875..108332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 108329..111334 product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 111344..112681 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(112678..113589) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(113661..114476) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(114476..115648) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(115650..116021) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(116048..118795) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(118921..119541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 119671..119874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 119909..120697 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene cysQ CDS complement(120699..121121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(121118..121585) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(121639..122214) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(122243..122872) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(122893..124749) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 125016..126020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 126244..126423 product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 126438..126743 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110754436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 127089..127352 product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 127437..129041 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 129051..129701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 129698..130789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(130790..131560) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(131548..132324) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(132434..133471) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 133659..135053 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(135046..136287) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(136325..137023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 137598..139373 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene ggt CDS complement(139382..140788) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(140869..142674) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(142696..143763) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 143896..145116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(145088..145375) product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(145453..147582) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene pbpC CDS 147781..148056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 148053..148376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(148490..148657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 148867..149067 product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 149080..149568 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene purE CDS 149565..150731 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(150712..151374) product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(151380..151877) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene def CDS 152030..152275 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 152356..152916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 153005..153640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 153731..154330 product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006699921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 154327..155583 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 155981..157267 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 157285..158154 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene ntrB CDS 158166..158966 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 158963..161419 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene nirB CDS 161416..161748 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene nirD CDS 161748..164396 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 164368..165231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 165395..166336 product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 166440..168143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 note possible pseudo, frameshifted CDS 168151..169095 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 169178..169795 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 tRNA complement(169861..169937) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(170000..171157) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene mnmA CDS 171331..172131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 172040..172474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 note possible pseudo, frameshifted CDS 172493..173152 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 173236..173520 product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(173540..174160) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(174180..174566) product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 174748..175932 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 176053..177633 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene serA CDS 177810..178064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(178167..178967) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene thiD CDS complement(178964..180313) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene glmM CDS complement(180324..181313) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene folP CDS 181209..181484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(181376..183283) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ftsH CDS complement(183359..184642) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene tilS CDS complement(184626..185504) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene ybgF CDS complement(185687..186172) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene pal CDS complement(186389..187705) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene tolB CDS complement(187863..188177) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 188386..189099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(189116..189724) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 189852..190934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 190960..192114 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 192134..192916 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 192931..193407 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 193504..194676 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(194682..195872) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 195993..196418 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene arfB CDS 196471..197076 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(197087..197776) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102323.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(197766..198191) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014843191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 198284..199162 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(199166..199816) product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(199928..200929) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 200986..201180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(201323..201793) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(201986..202210) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rpmE CDS complement(202397..203446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 203589..203834 product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(203881..204654) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(204651..205148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(205188..206240) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(206461..208257) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 208320..209330 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 209443..210855 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 tRNA 210086..210171 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 210879..211862 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 211863..212306 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 212354..213124 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 213290..214261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(214262..215446) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(215450..216697) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(216694..217509) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(217506..218300) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(218309..218695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 218845..220008 product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 220001..222592 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 222736..223368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(223382..225073) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(225219..226595) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(226621..228579) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(228714..229907) product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(230145..230921) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(230935..231732) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(231750..232526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 232685..234274 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 234271..235869 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 235893..236570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 236582..237619 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(237770..238579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(238588..239223) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(239331..240353) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(240362..242023) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(242142..242678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 242876..243823 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(243849..244766) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 244996..246870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 246867..247313 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(247333..248277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 248733..252239 product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(252244..253002) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(253009..253299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 253387..253668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(253672..254826) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(254826..255224) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808211.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 255359..255673 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 255826..256461 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 256664..257830 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 257827..258315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 258329..260518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(260525..261736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(261780..262964) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(263068..264591) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(264668..265912) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 266052..267143 product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 267166..268641 product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 268688..269587 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene mepA CDS 269649..270422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(270400..271383) product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(271453..272166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(272494..274365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(274493..275272) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(275286..276590) product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(276596..279121) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene mprF CDS 279340..279636 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(280141..280383) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 tRNA complement(280947..281023) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 281563..282480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(282545..283519) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 283661..284233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 284240..285457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(285439..287049) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(287326..288669) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 288917..290617 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 290614..291945 product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene dctD CDS 292067..293695 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(293685..294281) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(294287..295234) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 295421..296524 product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(296516..297886) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(297891..299678) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(299743..300003) product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 tRNA 300177..300263 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 300314..300925 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 301035..302003 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 302005..302658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 302655..303212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 303209..303958 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene lptB CDS 303971..305533 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene rpoN CDS 305729..306325 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene raiA CDS 306336..306800 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene ptsN CDS complement(306834..307058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(307188..307640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 307911..308945 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(308918..309478) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(309661..310320) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 310390..311238 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene gluQRS CDS 311357..312406 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 312594..313475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(313525..314790) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 314863..315456 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(315464..316366) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 316461..317453 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(317455..317946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(318069..320084) product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 320351..321628 product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene ccrA CDS 321692..323377 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 323380..323802 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(323799..324893) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(324899..326104) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene hmpA CDS complement(326117..326482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 326594..327025 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene nsrR CDS complement(327086..327511) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(327582..328895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(328870..329754) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 329799..330539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(330941..331114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(331147..332301) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene queG CDS complement(332305..332973) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(333050..333622) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(333679..334389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(334592..339133) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene gltB CDS complement(339151..340593) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(340983..341942) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 342009..342842 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 342839..343636 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 343693..344388 product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(344393..345214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 345364..346008 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 346170..346649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(346652..348286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 348673..350253 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 350303..351313 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 351310..352203 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 352206..353204 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 353204..354181 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 354263..354868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(354880..356220) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(356231..357997) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene asnB CDS complement(357976..359052) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(359088..359414) product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(359392..359664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(359751..361394) product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(361460..362368) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene gcvA CDS 362483..363409 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 363477..364001 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene ppa CDS 364226..365872 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(365885..366673) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(366793..367185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 367464..368672 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 368745..369137 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene apaG CDS 369269..369952 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene folE CDS 370027..371196 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene argE CDS complement(371314..372426) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene leuB CDS complement(372531..373142) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene leuD CDS complement(373161..374564) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene leuC CDS complement(374676..375062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(375068..375826) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene trmD CDS complement(375823..376419) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene rimM CDS complement(376447..376803) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene rpsP CDS complement(376850..378265) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene ffh CDS 378739..379143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 379156..379356 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(379516..380841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 380922..381527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 381580..382179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 382223..383065 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene dapF CDS 383073..384326 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene mtaB CDS 384323..385291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 note possible pseudo, internal stop codon, frameshifted CDS 385288..385869 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 385998..386741 product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(386725..389208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(389313..389861) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(389931..390209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(390220..391317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(391317..391784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(391781..392323) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(392327..394291) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(394288..394779) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene ccmE CDS complement(394776..394994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(394975..395703) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(395755..396420) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene ccmB CDS complement(396541..397152) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene ccmA CDS complement(397158..397922) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 398153..400864 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene acnA CDS 401118..402629 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 402709..403293 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(403328..404533) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(404530..404955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(404962..405882) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252334.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene metA CDS complement(406070..407020) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(407082..407714) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(407711..408166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 408356..409303 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(409278..409898) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 410043..410372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(410380..411984) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 412235..412540 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 412731..413213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(413234..413647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(413700..415283) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 415451..417163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(417137..417475) product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(417503..418105) product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene wrbA CDS 418223..419140 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(419137..420852) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(420867..422291) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(422295..423062) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(423121..423411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(423438..424223) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(424238..425443) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(425456..426208) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 426419..427339 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(427394..427798) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(427795..428118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 428278..429042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 429092..430399 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 430386..431612 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 431625..434729 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 434726..437821 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 437826..439034 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(439018..440259) product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(440270..440557) product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(440545..441537) product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(441537..442079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(442083..443180) product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(443116..444162) product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(444165..444647) product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 445131..446528 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(446568..448106) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(448207..450402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(450482..451861) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(452237..453595) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(453616..455358) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(455557..456609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 456776..459394 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 459489..460235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897942.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(460255..460500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(460512..461090) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 461231..462025 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(462032..462805) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 462931..464082 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(464098..464511) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(464504..465274) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 465398..466210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(466207..467721) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(467768..469921) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(469937..471145) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(471222..472370) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(472463..473830) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(474014..475312) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 475562..477148 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(477152..477541) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(477596..478087) product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(478087..479385) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 479601..480197 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 480306..481082 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(481089..482606) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(482617..483402) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448787.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(483399..484601) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(484606..486087) product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(486090..487010) product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(487007..487750) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(487752..488582) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 488732..490060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 490384..499158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 499204..501066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 501063..501650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 501678..502697 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 502678..504591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 504578..505678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 505675..507030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 507027..507839 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 507833..509260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 509244..511169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 511166..512260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 note possible pseudo, internal stop codon, frameshifted CDS 512257..513453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 513440..514066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 514068..515327 product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene rifK CDS 515356..516195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(516165..517232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(517279..518256) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(518460..520148) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 tRNA complement(519717..519801) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(520242..520907) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene rpe CDS complement(520948..522267) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(522289..523170) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene htpX CDS 523365..524168 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 524175..525530 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(525538..526605) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 526698..527690 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rsmI CDS 527687..528046 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 528074..528658 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene dolP CDS 528667..529512 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 529545..530489 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene gshB CDS 530550..531074 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 531049..532326 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 532452..533009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(533032..533256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(533364..534827) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 534899..535153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 535161..535964 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 536061..536834 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(536855..537703) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 537843..538526 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 538501..539472 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(539474..540253) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene tam CDS 540301..541209 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 note possible pseudo, frameshifted CDS complement(541190..542872) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(542876..543658) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 543783..544001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 543998..544621 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(544629..544931) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 545016..545417 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 545473..546330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(546334..547251) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(547248..547670) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(547673..548386) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene cobB CDS complement(548392..548985) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene thpR CDS complement(549034..549999) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 550231..550785 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 550791..551798 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 551860..552834 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(553002..553517) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 553668..554555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 554619..555833 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(555897..556589) product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(556586..557149) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 557281..557805 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 557816..558991 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene rlmN CDS 559025..560161 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 560232..561113 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 561253..562938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(562935..564401) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 564530..565552 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(565546..566253) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene phoB CDS complement(566285..566998) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene phoU CDS complement(567019..567819) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene pstB CDS complement(567825..569147) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene pstA CDS complement(569144..570517) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene pstC CDS complement(570613..571671) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(571947..573107) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(573128..574156) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene arsB CDS complement(574159..574596) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene arsC CDS complement(574589..574927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(575075..575230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(575300..577210) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(577272..577961) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 578034..578690 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(578699..579430) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930359.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(579427..580212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(580224..581093) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(581093..582199) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(582287..583351) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(583384..584811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(584811..585947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(586039..586911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(586925..588427) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(588441..589778) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(589973..590644) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(590766..591278) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene infC CDS complement(591489..591770) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(591837..592544) product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 592979..595312 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221892407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(595370..595909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(596054..597073) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene ilvC CDS complement(597103..597606) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ilvN CDS complement(597725..599485) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(599583..600527) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene miaA CDS 600556..601455 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene serB sequence04 source 1..543275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(779..2308) product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene pap CDS complement(2445..2801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(3010..7230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 7891..8136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 8467..9531 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 9534..10421 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 10418..11479 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 11463..12263 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 12298..12963 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 13177..13698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 13850..14158 product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 14172..15827 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 15814..16302 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 16421..17113 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 17113..18345 product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 18342..18779 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 18776..19039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 19039..20283 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(20290..21168) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(21241..21678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(21744..22541) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 22617..24161 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(24134..25123) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 25345..26487 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 26562..27629 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 27633..28517 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 28514..29302 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 29372..30742 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 30745..32127 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920974.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 32209..32631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 32641..33279 product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 33276..35012 product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(35015..35329) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(35329..35670) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene arsC CDS complement(35742..36881) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(36884..38059) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(38082..38846) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(38881..40530) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 40648..41688 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 41870..45262 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112465.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(45247..45750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 note possible pseudo, frameshifted CDS complement(45747..46664) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene puuE CDS 46829..47188 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene uraH CDS 47191..48666 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene xdhA CDS 48653..50962 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene xdhB CDS 50959..51753 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene xdhC CDS complement(51758..51955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 51970..52569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(52573..53208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(53205..53744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(53738..54085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(54100..54462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 54679..55248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(55312..56241) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061554.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 56377..57606 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972222.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene puuD CDS 57645..59066 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 59242..59436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 59438..60337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 60494..65602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 65686..66114 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(66132..66992) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene purU CDS complement(67059..68360) product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene glnT CDS complement(68389..69708) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968347.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(69724..70410) product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731166.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(70407..71306) product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(71405..72040) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(72136..72885) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 73030..74346 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039185890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(74350..75723) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 75796..76932 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(76922..78892) product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(78987..79385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(79382..80752) product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 80881..81165 product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 81165..81845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 81847..82755 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(82766..83743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 83869..84840 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(84824..86251) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 86331..86939 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(86973..87566) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(87586..88356) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 88460..89152 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(89156..90343) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(90391..91293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(91305..91769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 91784..92485 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 92579..93793 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 94048..95703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 95818..96987 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 96998..97684 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 97684..98892 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 98956..100008 product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(100011..100901) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene mmsB CDS complement(100936..101967) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(101971..103113) product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 103263..104291 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene hemB CDS complement(104278..104679) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(104676..104927) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 105077..105778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(105859..106989) product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957762.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 107135..108055 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 108095..109321 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(109357..109704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(109694..110014) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(110069..110974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 111070..111930 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene motA CDS 111945..113006 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(113026..114759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 114881..115330 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene moaE CDS 115504..116412 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene cysD CDS 116412..118310 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene cysN CDS complement(118350..118787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 118847..119845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(120219..120908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 120909..121247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 121244..121672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 121676..121888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 121885..122082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 122079..122516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 122641..123117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 123114..125216 product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 125218..125976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 125973..126542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 126539..126913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 126903..127178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 127235..127456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 127587..128171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 128175..128519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 128509..128832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 128836..129165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 129162..129701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 129701..129937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 129947..130564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 130561..131097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 131084..131602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 131668..132270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 132281..132748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 132969..133346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 133352..133651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 133654..134199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 134196..135629 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 135632..137155 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 137160..138455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 138820..139773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 139784..140122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 140133..141062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 141074..141370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 141367..141585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 141582..142016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 142013..142591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 142584..143015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 143017..143229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 143232..144152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 144170..144523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 144775..144933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 144930..152690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 assembly_gap 150376..150470 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 152687..154255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 154257..155126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 155123..156193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 156203..156571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 156748..157002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(157021..159693) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(159778..160461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(160592..161911) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(162138..162461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(162485..163138) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 tRNA 163287..163360 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 163457..163531 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(163869..164141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(164333..164752) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 164883..166343 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 166340..167632 product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 167629..168387 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 168384..169658 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 169770..171140 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(171148..171594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(171692..171940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 172102..172701 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 172803..173801 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 173823..174668 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene sseA CDS 174685..175266 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(175267..176442) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ubiM CDS complement(176526..177491) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(177558..178247) product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(178250..179386) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(179383..180072) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene phnL CDS complement(180075..180854) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene phnK CDS complement(180844..181695) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(181692..182783) product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104083.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(182794..183390) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267543.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene phnH CDS complement(183383..183838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 183919..184650 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene phnF CDS 184911..186074 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 186148..186486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(186532..188088) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene gcvPB CDS complement(188085..189431) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene gcvPA CDS complement(189446..189820) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene gcvH CDS complement(189830..190957) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene gcvT CDS 191399..192106 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087231.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(192093..192539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(192548..193294) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535109.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 193293..193733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(193749..194135) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(194154..197372) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(197436..198107) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 198219..198737 product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 198785..200407 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(200564..200917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(200914..202173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(202500..203177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 203262..204665 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene fumC CDS 204682..204918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(204927..205424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 205692..206618 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(206628..207509) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(207512..210934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 211099..211392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(211383..213446) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 213484..214131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 214280..214483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 214584..215714 product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene odc2 CDS 215743..215988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(216050..216670) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene plsY CDS complement(216686..218017) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene pyrC CDS complement(218014..218976) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(218987..219484) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene ruvX CDS complement(219504..219986) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480622.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 220043..220456 product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(220585..221766) product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene aruH CDS complement(221876..223051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(223048..223323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(223328..223957) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(223954..224541) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 224631..225629 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 225644..226513 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 226514..229213 product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 229210..231279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(231291..231539) product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(231523..231765) product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(231793..232278) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(232352..232687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(232763..232951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 232920..235223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 235327..235665 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene grxD CDS complement(235721..236461) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 236744..239161 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 239364..239765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 239863..240285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(240293..240949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(241011..242189) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(242192..243382) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 243496..244404 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 244580..246793 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 246879..247979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(247980..249071) product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(249061..250023) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(250056..250991) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(250996..251868) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(251879..252634) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene aztA CDS 252566..252811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 252893..253366 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973425.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene soxR CDS 253375..253560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(253658..255088) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 255320..256081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(256124..257251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(257299..257505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(257596..257805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(257922..259736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 259843..261045 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(261165..262154) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene glpX CDS complement(262198..263499) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(263496..264728) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(264782..266437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 266583..268388 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene phaC CDS 268503..269198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 269195..270238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 270306..270851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(270855..271691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(271766..272722) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(272882..273859) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(273913..274911) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(274908..276710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(276691..276831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 276985..277584 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 277577..278698 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene aroB CDS 278857..280581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 281023..282681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 282741..283139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 283295..283681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 283758..284654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(284774..285490) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(285487..286533) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 286734..287000 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 287076..288761 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528669.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(288783..289847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(289975..291021) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 291207..291593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(291659..292069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 291969..293231 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 293289..294167 product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 294179..294769 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(294810..295670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(295789..297030) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(297096..297869) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(297880..299220) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(299239..300270) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(300273..301154) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(301168..302028) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(302090..303217) product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551446.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene sfnG CDS complement(303239..303820) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene msuE CDS complement(304051..305064) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407646.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(305532..305687) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(305886..307274) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(307305..308624) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(308643..309518) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene galU CDS complement(309627..310466) product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 310759..311619 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene panC CDS complement(311624..312460) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(312480..312914) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(312974..313375) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391497.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene cueR CDS complement(313448..314470) product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene aphB CDS complement(314467..315360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(315357..316406) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(316435..317220) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(317220..318122) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(318138..319262) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(319446..321560) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 321686..321883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 note possible pseudo, internal stop codon CDS complement(321841..323022) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 323200..324036 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene fdhD CDS 324033..324548 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene mobB CDS 324545..325744 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene moeA CDS 325741..326382 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969527.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene mobA CDS complement(326678..327121) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 327277..327870 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(327851..328027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(328789..329703) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 329879..331102 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 331127..332023 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(332008..332799) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969826.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 332978..333877 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 334008..334475 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 334472..336019 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 336029..338875 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene fdhF CDS 338878..339099 product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 339173..340828 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(340863..342392) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(342400..343101) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(343112..344038) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(344038..345129) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243181.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(345175..346302) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243182.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(346534..347592) product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(347594..347950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(347998..349518) product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(349533..349802) product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(349820..350812) product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(350849..351097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(351108..352037) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(352271..354688) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(354688..355830) product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(355909..357261) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(357292..358905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 359152..360084 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(360081..361745) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 362006..363466 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 363474..364271 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 364268..365065 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 365086..365319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 365316..366248 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 366245..367354 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene dmpG CDS 367362..368108 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 368159..368581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 368578..368892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(368889..369269) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 369462..370850 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(370851..372308) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338276.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(372308..373027) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene hypB CDS complement(372934..373266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(373285..373626) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene hypA CDS complement(373619..374605) product HupK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338273.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(374602..375405) product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene hybE CDS complement(375420..376289) product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(376300..376713) product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(376716..377012) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(377032..377649) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(377902..378606) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene cybH CDS complement(378620..380434) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(380439..381509) product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(381667..383115) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(383125..384123) product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(384120..385439) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 385743..386513 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339127.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 386536..387147 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339128.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene cbiM CDS 387144..387707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 387704..388447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 388444..389169 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339131.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(389177..389728) product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(389857..390525) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene rpe CDS complement(390518..391402) product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene cbbX CDS complement(391399..391788) product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(391801..393258) product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(393287..394366) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene fba CDS complement(394378..395613) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337524.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(395610..396620) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene gap CDS complement(396635..398647) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene tkt CDS complement(398644..399519) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(399531..400583) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 400752..401687 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(401673..402536) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene hypB CDS complement(402536..402874) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene hypA CDS complement(402884..403951) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene hypE CDS complement(403948..405078) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene hypD CDS complement(405075..405764) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(405761..406042) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene hypC CDS complement(406012..408411) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene hypF CDS complement(408408..409586) product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(409583..410446) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(410457..410681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(410692..410901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(410919..411908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(411963..412292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(412289..412780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 note possible pseudo, frameshifted CDS complement(412753..413070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(413083..413397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(413465..415063) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(415092..416054) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(416242..416460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(416536..417981) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 418175..419005 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 419048..419968 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(419952..420383) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(420380..421069) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(421184..421390) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(421566..422063) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(422081..423535) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene gatB CDS complement(423540..425018) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene gatA CDS complement(425018..425305) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene gatC CDS complement(425394..427259) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 427466..428479 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 428583..429902 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 429983..430495 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(430521..432344) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene glmS CDS complement(432362..433705) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene glmU CDS 433822..434547 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 tRNA 434569..434643 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(434732..434890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(434975..435958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(436255..437232) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(437271..437633) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(437686..438912) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(438944..439633) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene urtE CDS complement(439649..440410) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene urtD CDS complement(440424..441548) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene urtC CDS complement(441554..442477) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene urtB CDS complement(442555..443823) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965210.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene urtA CDS 444057..447461 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 447403..448350 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(448355..449158) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 449338..450546 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 450556..450903 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 451262..453151 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389198.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 453142..454227 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082838.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(454228..455085) product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(455082..458684) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982294.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(458981..459970) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 460386..461588 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 461690..462877 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 462938..464173 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 464448..465500 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(465556..466275) product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530572.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 466439..467332 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(467373..468065) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 468394..469020 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 469017..470384 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(470338..471720) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(471707..472384) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(472506..473300) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(473331..473588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 473600..473758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 473814..474200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(474245..475591) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene hemL CDS complement(475588..476484) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 476765..477472 product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 477497..478360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 478354..478719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 478716..479567 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 479576..480709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 480649..481101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 481098..482912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 482887..484269 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(484281..485018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(485019..485657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(485657..486691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(486684..487406) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176600.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(487418..488539) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(488727..489071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 tRNA complement(489325..489398) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 489612..490223 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene rpsD CDS 490312..490878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(490982..491302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(491363..492685) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 note possible pseudo, frameshifted CDS 493021..493569 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(493551..494468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(494465..494908) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 494983..497142 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 497198..497950 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 498053..499480 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(499481..500989) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene ilvA CDS 501102..501767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 501854..503308 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(503321..503989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 504124..505137 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 505818..506963 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531225.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(507008..508810) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(508942..509202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(509248..509871) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(509876..510358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 510484..511944 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene gabD CDS 511941..512600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 512597..513985 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene gor CDS complement(513986..514261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(514324..516474) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene scpA CDS 516617..517624 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(517664..517861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(517877..518497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(518726..519148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 519540..520787 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 521092..521337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 521350..521700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 521697..524168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 524232..524795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 525369..525995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 525992..526420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 526404..527810 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 528019..528771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 528962..529150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 529268..530137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(530144..530593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(530598..530822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 tRNA complement(531003..531095) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(531208..532830) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 532896..533687 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(533736..534734) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(534853..536580) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(536705..537790) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene pstS CDS 538212..538958 product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 538973..540145 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 540270..540713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 540909..541874 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 misc_feature complement(541923..>543275) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:YDG domain-containing protein locus_tag LOCUS_24740 sequence05 source 1..433178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 399..1382 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 1476..1754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 1747..2043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2056..2802 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2807..4420) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 4567..4974 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 5086..7572 product DNA translocase FtsK 4TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(7612..7920) product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(8166..8378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(8459..11098) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene alaS CDS complement(11172..11513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(11515..12639) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(12650..13225) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 13382..14563 product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 14694..15440 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 15446..16843 product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 16961..17875 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 17947..18312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(18316..18825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 19048..19746 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 19815..20372 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(20377..22194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(22460..24238) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(24295..25674) product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene ompQ CDS complement(25686..27635) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(27639..28976) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene macA CDS complement(29102..29917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(29925..30353) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene tolR CDS complement(30384..31154) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(31434..33236) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene atzF CDS complement(33239..36760) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919695.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene uca CDS complement(36769..37422) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(37440..38261) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(38276..39133) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(39133..39951) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 40325..41215 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(41235..41984) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(42085..42654) product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene cbiZ CDS complement(42768..43643) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066755.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(43697..44629) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(44631..45380) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(45658..46218) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(46220..46414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(46457..46888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389554.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(46906..47178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(47227..48012) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 48011..49219 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(49225..49983) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 tRNA 50100..50174 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(50331..50918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 51381..52064 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 52153..53769 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085804.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 53863..54351 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(54341..55243) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 55346..56509 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(56521..57714) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(57832..58740) product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(58898..59947) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821528.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(60046..60492) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(60781..60954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 61167..61397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 61563..62039 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene bfr CDS 62280..62597 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 62608..62904 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 tRNA complement(63088..63163) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(63263..65173) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene mrdA CDS complement(65170..65694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(65703..66686) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene mreC CDS complement(66746..67786) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(67938..68570) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(68685..69722) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene corA CDS complement(69750..70352) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(70376..70501) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene ykgO CDS 70675..71472 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 71603..73273 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene fliF CDS 73275..74291 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene fliG CDS 74308..74937 product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 74956..75285 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene fliN CDS 75299..76675 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 76695..78803 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene flhA CDS 78819..79928 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene flhF CDS 79925..80740 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 80742..82259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(82266..82868) product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene fixJ CDS complement(82858..84333) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(84364..85464) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 85671..87089 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene pyk CDS complement(87109..88029) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(88085..88648) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 88791..89183 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(89208..90893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 91186..91827 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(91854..92468) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene recR CDS complement(92468..92788) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(92801..94642) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 94991..95560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 95598..96533 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene nudC CDS complement(96530..97402) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(97402..98166) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 98372..98917 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 98943..100769 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 100872..102632 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 102632..103717 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 103722..104756 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 104753..106354 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(106846..107094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(107091..108035) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(107941..110214) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(110310..111299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(111338..112204) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(112206..113621) product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 113780..114430 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(114437..115507) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 115640..116518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(116538..118472) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene dxs CDS complement(118491..119408) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(119415..119672) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 119853..120269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 120315..120827 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 120911..121201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 121198..121470 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(121477..122412) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 122609..122932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 123043..124854 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 124937..126022 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(125950..127119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 127259..127387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 127384..127785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(127843..128145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 128144..129115 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 129112..129846 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 129848..131782 product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 131796..132968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 133058..134956 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene htpG CDS complement(134994..135944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(135955..136728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(136957..137988) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(138064..139413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(139449..141710) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(141844..143016) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 143137..143805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(143802..144680) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(144670..145134) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 145250..147958 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene mutS CDS 148034..148936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 149089..150333 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523157.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(150390..151889) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 152020..152919 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 152990..154807 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626092.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 154848..155822 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529992.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene corA CDS 155827..156630 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(156631..157194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 157249..158661 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640438.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene argH CDS 158672..158851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 158867..160147 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene lysA CDS 160149..162617 product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066760.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(162637..163179) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene hpt CDS complement(163176..163841) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 164019..164684 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene ftsE CDS 164687..165568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 165572..166126 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene gmhB CDS 166126..166782 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 166782..167519 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 167777..170113 product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(170219..170830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(170827..171693) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(171735..173885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 174081..174716 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(174729..176228) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(176356..176970) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243834.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(177061..177951) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene folD CDS complement(177964..178302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(178299..178589) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 tRNA 178707..178782 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(178918..179121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(179096..179695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(179692..179850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(179933..180325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(180403..180546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(180625..181488) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 note possible pseudo, frameshifted CDS 181963..182526 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene ahpC CDS 182632..184206 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene ahpF CDS complement(184253..185260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 185440..186594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 186614..187654 product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene benC CDS complement(187661..188878) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 188984..189601 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 189621..191105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 191269..191760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 191762..193369 product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(193376..194323) product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene bauR CDS 194476..195576 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 195548..196441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 196441..197247 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810041.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 197247..198329 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039355.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(198326..199159) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(199152..200144) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091955884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 200043..200237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(200253..200633) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(200700..201455) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172654773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(201464..202156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(202158..202865) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(202942..203757) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 204047..205000 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 tRNA complement(205052..205141) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 205250..205594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 205714..206028 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene rplU CDS 206059..206328 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene rpmA CDS 206433..207497 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene obgE CDS 207549..208703 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene proB CDS 208709..210004 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 210001..210651 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 210944..211393 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene rsfS CDS 211407..211874 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rlmH CDS 211945..213534 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene gpmI CDS 213593..214852 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 214873..216144 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 216161..217528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 217572..218045 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 218058..218858 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 218858..219400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 219411..220193 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(220200..221108) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene rpoH CDS complement(221281..222213) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 222233..222535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 222532..222951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 223029..224009 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 tRNA 224054..224129 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 225596..226318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 226415..226624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 226635..228749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 229208..230209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 230181..231095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 231694..232425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(232445..232738) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390813.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(232735..233100) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(233144..233503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 233742..234731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(235005..235319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(235316..235687) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(235751..237118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 237753..238499 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 238939..240060 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 240066..241580 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 241600..243027 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 243274..244203 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 244446..245438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 245448..246233 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 246307..246723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 246766..248175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 248181..248801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 248740..251277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 251373..253646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 253648..254388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(254468..255328) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(255325..255780) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(255786..257672) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(257673..259283) product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 259385..260242 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(260253..262670) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(262764..263732) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(263768..264265) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(264435..266798) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 267098..267598 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 267624..268655 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 269276..269530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 270133..270789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 270894..271445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 272513..275917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 275929..277653 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 277650..278933 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(279038..279925) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(279934..281199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(281322..282788) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(282913..283626) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(283686..284570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 note possible pseudo, internal stop codon, frameshifted CDS complement(284567..284974) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 285473..286366 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 286363..287265 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 287262..288017 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057948.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 288020..288754 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 288783..289913 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 289988..290767 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 290793..292007 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(292052..293350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(293485..293970) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(293972..294208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 note possible pseudo, internal stop codon, frameshifted CDS complement(294211..294990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(294998..295981) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815527.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(295986..296945) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene pdhA CDS complement(296954..298102) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228882.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 298424..299029 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(299066..300331) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 300543..302159 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(302220..302870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(302887..304047) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(304063..304770) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(304754..305503) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(305514..306527) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(306535..307401) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 307294..307632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 307822..309039 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 309042..309836 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 309852..310292 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921327.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(310303..310884) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 311056..311409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 311428..313017 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(313157..314584) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(314600..315688) product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(315688..316710) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(316784..317752) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(317791..318711) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(318731..319522) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(319536..320462) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(320464..321549) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(321576..322646) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(322782..323759) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(323870..324781) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(325274..325663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 325556..326494 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 326615..326842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(326858..327706) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(327757..328023) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073326483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(328292..329746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(329743..331152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 331418..332614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 332760..334847 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 334915..335958 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 336267..337196 product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 337376..337792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 338430..338753 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 339179..339538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 339560..339772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(339776..339985) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 340168..340440 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 340547..340753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 340716..341297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 341422..341706 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 341722..342762 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 342759..343397 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene parA CDS 343394..343633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 343630..344115 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 344112..344705 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 344689..345024 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 345028..345741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 345974..347707 product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(347711..348082) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(348085..348378) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 348648..349016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 349278..351266 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 351276..351695 product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 351808..352788 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene trbB CDS 352785..353105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 353105..353362 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 353367..355808 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene trbE CDS 355805..356533 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene trbJ CDS 356549..357886 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene trbL CDS 357886..358569 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene trbF CDS 358566..359546 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene trbG CDS 359543..360661 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 360658..360942 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(360896..361843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(361914..363467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 363990..364250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(364661..366895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(367029..368408) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(368643..370061) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(370093..370428) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 370539..371576 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086614.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(371744..373303) product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(373740..374060) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(374206..375309) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 375733..377391 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(377532..378599) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087190.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 378900..380063 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 380072..381679 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 381690..383681 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 383674..384567 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(384643..384837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 note possible pseudo, frameshifted CDS complement(384779..385234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 note possible pseudo, frameshifted CDS complement(385231..386145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 note possible pseudo, frameshifted CDS complement(387004..387288) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082867.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene tnpB CDS 387442..387648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(387926..389698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(390157..390303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 390714..391187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 391184..391585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(392178..392618) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(392602..392841) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 393232..393447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 393440..394087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 394181..394453 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 394626..394748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(394826..396145) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 397735..397971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 398027..398560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(398585..398833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 399360..400874 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(400974..401663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 402312..402479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 402699..403625 product DUF707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975521.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 403746..404816 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 405338..405928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 406856..407419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 408205..408462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 408789..409601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(410801..412537) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(412534..413619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(413616..415037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480626.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 415353..415526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(415859..416605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(416610..418904) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(418977..420209) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(420292..420966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(421173..421775) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(422833..423060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 423101..423550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 423874..424419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(424376..425353) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene galE CDS 425673..426095 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163163084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 426092..426445 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene tnpB CDS 426479..426691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 426755..427831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(427907..428233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(428899..429954) product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 430142..430360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 431261..431530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(431631..432938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 tRNA complement(433084..433160) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 sequence06 source 1..369616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1001..1076) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1147..2274) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene tgt CDS complement(2271..3314) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene queA CDS complement(3404..3940) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3981..4493) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene coaD CDS complement(4490..7297) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene gyrA CDS 7551..8180 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(8177..8884) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 9034..9495 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313784.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 9555..10373 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 10493..10822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(10884..11852) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024927297.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(12007..12309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(12311..12556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(12633..13715) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(13743..14291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 14491..17367 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene uvrA CDS complement(17377..17754) product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(17932..18750) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene map CDS complement(18747..19328) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(19379..19774) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(19774..20259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(20268..20894) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088884.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(20936..21607) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 21700..22125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 22185..24305 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 24411..25838 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 25874..27220 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene trmFO CDS 27257..27808 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(27812..28141) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397041.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(28152..29123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(29147..30412) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene fabF CDS complement(30453..30689) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(30896..31651) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388175.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene fabG CDS complement(31648..32544) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene fabD CDS 32929..33348 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene rpsF CDS 33345..33608 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene rpsR CDS 33621..34175 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene rplI CDS 34462..35691 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 35748..37445 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene ybaL CDS 37538..39052 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 39036..40184 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene alr CDS 40181..40957 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 40954..41727 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 41727..43133 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene radA CDS 43136..43906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 43921..45375 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene purF CDS 45382..46104 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 46128..46970 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene cysE CDS complement(46990..48405) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396062.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene der CDS complement(48479..49843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(49840..50544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(50678..51535) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene panB CDS complement(51593..51799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 52081..52695 product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 52787..53422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 53627..54655 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 54665..57736 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 57773..58696 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(58701..59174) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene zur CDS 59248..59634 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene hisI tRNA complement(59822..59897) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(59993..60661) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(60781..62769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(62820..64700) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene dnaG CDS complement(64805..65380) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(65377..65931) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(65939..66571) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(66731..67186) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 67556..68587 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene carA CDS 68580..71807 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene carB CDS 71905..72378 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene greA CDS complement(72455..73030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(73119..73511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(73830..74714) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 74877..75377 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 75379..76077 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972139.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 76065..77432 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 77445..78170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(78178..78540) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(78602..79036) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(79141..79587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(79653..80276) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(80332..81162) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene proC CDS complement(81190..81687) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 tRNA 82011..82085 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(82118..82759) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703591.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(82811..83116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(83130..83810) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(83819..84073) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 84182..85027 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene lgt CDS 85024..86103 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 86100..86867 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090180.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene pgeF CDS 86935..87825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 87971..88906 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 89177..90385 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 90487..91110 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 91177..91794 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037437113.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene pth CDS 91796..92896 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene ychF CDS complement(92930..94315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(94398..95036) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(95168..95962) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(95973..97520) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532087.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene metG CDS complement(97559..98728) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(98792..99427) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720716.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene tmk CDS complement(99432..100586) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(100621..101583) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(101678..102772) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705995.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 102816..104129 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 tRNA 104364..104453 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(104457..104951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(105620..106084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(106228..107037) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(107040..107612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256223.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(107612..109552) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(110096..112228) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974037.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene katG CDS 112461..113357 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(113365..113667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(113664..114299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(114301..115488) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(115485..117575) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(117660..118487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(118587..118841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 118794..121409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 121425..122114 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 122108..122758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 122783..124183 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 124196..125302 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(125294..126091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 126741..127250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 127288..127986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(128003..128443) product DUF6527 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105776.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(128440..129612) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(129587..130333) product multiubiquitin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459823.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(130415..133816) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459833.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(133818..134396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(134393..135223) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(135468..136415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(136412..138028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 138323..138877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 138891..139817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 139887..141287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 141284..142207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 142226..142729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 142726..143373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(143334..144476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(144480..146036) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(146050..148422) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(148419..149447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(149447..150259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 150642..151853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 152001..154130 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 154200..155243 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 155566..156498 product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(156506..157258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050061411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 157485..157925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 158485..158811 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(158957..159202) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384747.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 159359..159634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 159759..159983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 160057..160527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 160678..160968 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 160965..161603 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene parA CDS 161600..161854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 161851..162357 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 162354..162899 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 162945..163280 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 163284..164045 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082877.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 164272..166029 product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 166058..168043 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 168052..168486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 168704..169639 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene trbB CDS 169636..169968 product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 169968..170249 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 170261..172696 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene trbE CDS 172693..173454 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene trbJ CDS 173477..173767 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene trbK-alt CDS 173771..175123 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene trbL CDS 175123..175806 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene trbF CDS 175803..176828 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene trbG CDS 176825..178027 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 178031..178291 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(178200..179153) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090981.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(179150..179641) product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(179661..180218) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(180282..180827) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(180914..181633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(181652..182326) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(182689..183381) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene pdxY note possible pseudo, frameshifted CDS complement(183381..184085) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(184099..184407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 184602..184943 product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene tnpA CDS 185034..185348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(185350..185772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 185852..186289 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 186286..186615 product DUF6522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 186602..187066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(187744..189024) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(189316..190896) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968497.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene guaA CDS complement(190973..191452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(191523..192791) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(192805..194271) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene guaB CDS complement(194404..195165) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(195182..195907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 note possible pseudo, frameshifted CDS complement(195964..196311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 note possible pseudo, frameshifted CDS complement(196328..197518) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(197639..198658) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 198889..200076 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene metC CDS complement(200073..200900) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 201039..202238 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 202214..202948 product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015930683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(202929..203366) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(203381..204343) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 204412..205179 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 205176..206366 product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(206470..207564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(207792..208289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(208300..209043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(209165..210706) product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(210699..211892) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771463.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(211886..212608) product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene tagT CDS complement(212608..214548) product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(214682..215917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(215932..218574) product putative virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390901.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(218583..221555) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(221805..223142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(223152..224339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(224467..225417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 225599..226096 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 226101..228416 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337230.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 228458..229339 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976184.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(229430..229840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 230020..232074 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 232138..232866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 232998..233393 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene crcB CDS 233395..234003 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(234129..234626) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 234932..235900 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene trxB CDS 235935..236828 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 237404..237670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 237676..237963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(237973..238974) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene msrP CDS complement(239058..239579) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(239658..240581) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(240589..241791) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(241907..243997) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 243879..244187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 244322..246493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 246542..246964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 247423..249351 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene uvrC CDS 249364..249927 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene pgsA CDS 249929..250183 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene moaD CDS complement(250201..251472) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 251531..251833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 251922..252665 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 252715..253920 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(254077..254295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 254189..254701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(254708..255487) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 255594..256805 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(256827..257213) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190295.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(257223..258188) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene ubiA CDS 258240..258968 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921244.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 259067..260428 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 260439..261038 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(261025..261504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 261597..262553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(262582..264030) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene tldD CDS 264525..265382 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene coxB CDS 265405..267057 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene ctaD CDS 267083..268018 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 268147..268746 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 268776..269636 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 269660..269974 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 269991..270764 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 270761..272257 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(272283..272996) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 273230..273808 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(273872..274624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(274682..275713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(275748..276332) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(276340..277596) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(277611..278999) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene thrC CDS 279088..279684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 279681..280394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 280375..282969 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972374.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene mprF CDS complement(282973..284082) product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(284086..284628) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 284710..285144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(285149..286318) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(286322..287707) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 287780..288157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(288242..289270) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(289540..291222) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene ettA CDS 291581..292030 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 292035..293120 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 293117..294184 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094854.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(294204..294842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(295013..295471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(295507..297858) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene clpA CDS complement(297962..298327) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene clpS CDS complement(298627..299088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(299334..300032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 300229..301743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 301902..302630 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 302647..303150 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 303147..304313 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 304392..304559 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene rpmG CDS 304673..306172 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(306266..307309) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene recA CDS complement(307482..309866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(309885..310964) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene flhB CDS complement(310975..311730) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene fliR CDS complement(311740..312039) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene fliQ CDS complement(312056..312394) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327338.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(312413..312835) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene flgC CDS complement(312850..313299) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene flgB CDS 313428..313763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 313763..314065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 note possible pseudo, internal stop codon CDS 314062..314811 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene fliP CDS 315060..315374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 315346..315648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 315645..315842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(315849..319091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(319105..319815) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(319906..320583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(320580..320972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(320972..322117) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640397.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene fliM CDS complement(322117..322719) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 322984..323721 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene flgF CDS 323737..324525 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene flgG CDS 324538..325035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 325068..325841 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene flgH CDS 326087..326326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(326401..327105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(327406..327822) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene dksA CDS complement(327962..328372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 328606..329718 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 329718..330023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 330013..330456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 330742..331647 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 331777..332175 product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 332156..332590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 332587..334422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 334419..336362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 336359..337411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(337446..337775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(337855..338748) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene aguB CDS complement(338785..338991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 339118..340221 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene aguA CDS 340247..340711 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 340711..341010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 341007..341747 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 341744..342490 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230841.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 342523..343149 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819270.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 343146..344660 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537726.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 344679..345848 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 345850..346749 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(346685..347284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(347296..348348) product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175825.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(348527..348745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 348645..349652 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 349633..350430 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 350427..351230 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(351262..351708) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 tRNA complement(351871..351947) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(351958..352251) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 352368..353576 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene rmuC CDS 353580..353798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(353805..354911) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(354999..356495) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 356608..357753 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 358009..359100 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 359105..360028 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723477.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 360025..361236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(361249..361467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(361583..361852) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970118.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 361845..362555 product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083016.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 362581..363573 product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene cobS CDS 363580..365526 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene cobT CDS 365531..366535 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(366550..367197) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene upp CDS complement(367230..367730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(367944..369344) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 sequence07 source 1..341565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..1232) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(1326..2222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(2219..2662) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770871.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene tolR CDS complement(2678..3361) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245914.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene tolQ CDS complement(3385..5301) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(5366..7867) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 8197..9114 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 9122..10159 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(10165..10680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(10773..11045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(11137..12012) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 12200..12940 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967118.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 12948..14330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 14315..15160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(15154..16095) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 16290..17603 product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731498.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(17600..18010) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(18022..18477) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(18538..18978) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(18994..20349) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 20644..22257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(22229..23047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(23230..25359) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083601.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene pnp CDS complement(25589..25858) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene rpsO CDS complement(25870..26814) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene truB CDS complement(26811..27281) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090290.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(27292..27663) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene rbfA CDS 27601..27831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(27900..30983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(30987..31688) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626660.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(31657..33213) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene nusA CDS complement(33224..33817) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241712.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene rimP CDS complement(33969..34688) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene trmB CDS complement(34691..35863) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene metK CDS complement(35988..36410) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(36486..38033) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene lnt CDS complement(38045..38932) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(38929..39399) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene ybeY CDS complement(39413..41875) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629711.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(41877..42872) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(42896..44254) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene miaB CDS complement(44408..45352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(45394..45864) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(46001..46429) product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(46903..47355) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(47355..48011) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene tsaB CDS complement(48034..48624) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(48668..49219) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 49331..50644 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577461.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(50663..51151) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(51210..52184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391281.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 52493..53152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(53330..54328) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene trpS CDS complement(54391..55953) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene murJ CDS complement(55963..58788) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 59032..60189 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 60194..60985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(60994..61434) product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639951.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 61627..62088 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(62093..62317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(62419..62643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(62745..62951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(63060..63440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 63663..65570 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 65567..66571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 66556..67464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(67514..68323) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(68355..69173) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(69203..70078) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 70260..70913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(70927..71223) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(71239..71538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(71727..72644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(72716..74263) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 74355..75008 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(75012..75920) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(75938..76894) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene speB CDS complement(76897..77850) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene speB CDS complement(77982..78491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(78555..78866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(78892..79713) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(79980..80378) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(80390..81811) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene atpD CDS complement(81836..82723) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529037.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(82750..84279) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene atpA CDS complement(84279..84839) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539095.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(85147..85626) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096599.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(85645..87807) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563538.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 87916..88572 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene fsa CDS 88542..89378 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 89354..90328 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 90325..90765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(90679..91170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(91170..91595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(91640..92056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(92351..92875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(92872..93300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(93302..93853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(93856..95625) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene lpdA CDS complement(95734..96939) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970379.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene odhB CDS complement(96976..99906) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(100360..101235) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene sucD CDS complement(101235..102404) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene sucC CDS complement(102517..103536) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067155.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene mdh CDS complement(103666..104808) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene zapE CDS complement(104896..105066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(105063..107249) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(107246..107728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(107725..109176) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164757824.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene ccoG CDS complement(109181..110059) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene ccoP CDS complement(110062..110232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(110248..110985) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene ccoO CDS complement(110999..112468) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene ccoN CDS 112677..113723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(113725..114507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(114628..115719) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene ribA CDS 115826..116497 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 116562..118013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 118016..119056 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 119133..121052 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene thrS CDS 121067..122236 product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene cotSA CDS 122233..123027 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 123024..124073 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 124066..125151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 125242..126510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 126512..127162 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 127219..128370 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707819.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 128503..129276 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563253.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene rfbF CDS 129267..130337 product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene rfbG CDS 130334..131572 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909598.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 131577..132116 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037176.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene rfbC CDS 132234..133334 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 133440..134585 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 134582..135628 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 135625..136443 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 136736..138082 product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 138099..138599 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(138625..138996) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(138993..139202) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973261.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(139214..139882) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(139899..140831) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene trxA CDS complement(141037..141570) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330108.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 tRNA 141728..141802 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 141862..141936 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(141950..142702) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972018.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 142872..145280 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 145277..146077 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(146100..147071) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(147139..148173) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene ansA CDS complement(148379..149596) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 149833..151158 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087876.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 151177..151932 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 151943..152866 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(152870..153532) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 153820..155040 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene phaZ CDS 155057..155455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 155575..156165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 156162..157277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(157237..157692) product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(157692..158114) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 158229..159458 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174403731.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene chrA CDS complement(159455..160183) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970804.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene pyrF CDS complement(160192..161538) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(161629..162270) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 162461..163903 product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 163900..165417 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(165463..166347) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(166474..167283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(167361..168176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(168184..168834) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(168880..170022) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 170224..171678 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240434.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(171675..172280) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 172582..173664 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 173679..176819 product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene acrB CDS complement(176856..176999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(177182..177424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 177571..178317 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 178387..178740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(178746..179780) product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258142.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(179782..180909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(181120..182202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(182405..183280) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(183383..184048) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene thiE CDS complement(184050..184982) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(185117..186319) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337524.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(186331..187338) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535991.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene gap CDS complement(187351..189372) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393622.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene tkt CDS 189678..190163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 190172..190546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 190672..191193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(191200..191802) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 192137..192712 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337060.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 192709..193524 product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 193630..194376 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 194384..194899 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004445748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene ruvC CDS 194896..195516 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene ruvA CDS 195513..196562 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene ruvB CDS 196555..197040 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 197037..197801 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene tolQ CDS 197805..198242 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene tolR CDS 198280..199293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(199307..201997) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(202087..203355) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(203360..204154) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(204151..204894) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(204891..205859) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(206254..206490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(206584..206703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 207239..208297 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(208379..209917) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 210093..211511 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 211618..212499 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 212499..214577 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene glyS CDS 214582..217242 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene ppdK CDS 217269..217886 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 217883..218803 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(218787..219464) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945512.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(219626..220567) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(220641..221549) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 221659..222753 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 222810..223853 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434020.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 223850..224704 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969977.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 224701..225501 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 225527..226585 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene speB CDS 226600..227388 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 227385..229067 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228710.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 229081..230661 product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 230666..231370 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 231392..231799 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene msrB CDS complement(231774..233159) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339053.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 233338..234858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 234888..235301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(235315..239247) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038942.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 239910..241742 product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532694.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 241784..243310 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(243320..243760) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene gloA CDS complement(243873..244220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(244466..245269) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene ssuB CDS complement(245269..246066) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene ssuC CDS complement(246063..247043) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767090.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 247149..247619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(247697..248188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 248337..248765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202812.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 248800..249246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 249254..250198 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038966.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 250202..251761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 251790..252245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(252313..254253) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530233.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 254384..255805 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(255806..256369) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 256664..257053 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063783.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(257095..258087) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 258208..258924 product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400525.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 259245..259802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 259883..260215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(260222..260872) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene nth CDS 260926..261150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 261147..261527 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 261535..262053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(262094..262579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(262691..263494) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene dapB CDS complement(263562..264707) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene dnaJ CDS complement(264788..266707) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene dnaK CDS complement(266932..268968) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(268983..270341) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390892.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(270408..270881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(271013..271588) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(271606..272640) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene hrcA CDS 272810..273028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 273105..274061 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(274071..274517) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 274648..275367 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene rph CDS 275367..275969 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene rdgB CDS 276027..276302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 276309..277487 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968537.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene hemW CDS complement(277488..278156) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene dnaQ CDS complement(278156..278809) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene coaE CDS complement(278793..279632) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(279629..280282) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917893.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 280346..281449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(281436..282347) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 282617..283669 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene hemE CDS 283666..284661 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene hemH CDS 284649..285092 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene hemJ CDS 285343..286599 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene rho CDS 286616..287437 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(287444..288346) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(288370..289173) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(289166..289801) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene rsmG CDS complement(289801..291651) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene mnmG CDS complement(291768..293063) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene mnmE CDS complement(293065..293430) product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(293427..293711) product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(293762..294016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 293933..294277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 294274..295047 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(294978..295355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 295263..296039 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(296036..297349) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085401.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene ribB CDS complement(297407..298072) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(298130..299029) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(299143..299829) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 299958..300953 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 301080..301430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(301466..301831) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(301836..302162) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(302174..302932) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene hisF CDS complement(302932..303666) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene hisA CDS complement(303663..304322) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene hisH CDS complement(304319..304678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(304678..305277) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene hisB CDS complement(305378..306337) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene cysK CDS complement(306361..306825) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(306825..308045) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene coaBC CDS 308208..308798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(308780..309631) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(309628..310887) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(311087..311428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 311312..311641 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 311665..313008 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330072.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 313160..314071 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 314205..316046 product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(316109..317296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(317654..317959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 317843..319000 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 319048..320340 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972329.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 320439..320597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 320594..320854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(320864..321559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 321635..322753 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 322750..325860 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140808.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(325844..326476) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707886.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(326530..326973) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909719.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 327133..327900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(327897..328616) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(328619..329101) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene queF CDS complement(329103..330014) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 330114..330533 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 330567..331343 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521980.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(331354..332730) product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene spuC CDS complement(333002..333385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 333591..334655 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(334674..335096) product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 335273..340027 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 340033..341427 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 sequence08 source 1..204638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..1248 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 1263..2051 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 2079..3629 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 3824..5116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(5164..6174) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(6171..7040) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446584.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(7045..7950) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(7989..9173) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(9184..10053) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(10050..10502) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(10523..11722) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063909.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(11726..13177) product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 13328..13819 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 13846..14607 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 14637..15431 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene menB CDS 15490..16692 product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 16772..17947 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 17972..18904 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525204.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 18907..20049 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 20067..20525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(20616..20885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(20888..21460) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(21457..22176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194683.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(22270..22980) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192996.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 23069..24409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(24445..25464) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 25865..27640 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 27655..29019 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(29095..31920) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 32233..33387 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(33396..34397) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 34538..35758 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878467.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 35778..37052 product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 37068..37553 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276064.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 37562..38323 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene fabG CDS 38337..38651 product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 38638..39363 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125138.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 39360..40229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 40226..41083 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 41114..41938 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 41944..42732 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160723.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene mhpD CDS 42729..44450 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 44980..47352 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 47391..48773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 48795..49748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 49848..51671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 51837..53213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(53229..54290) product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(54325..55755) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 56098..57222 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 57302..57772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 57988..59142 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 59147..60325 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 60399..62030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(62043..62534) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 62631..63398 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 63715..65043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 65182..65976 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064685.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 65990..68032 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188470974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 68034..68774 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 68789..69733 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 69735..70934 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 70937..71701 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 71728..72924 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973831.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 73097..74341 product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 74334..75386 product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113291.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene gtdA CDS 75377..76078 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(76082..76549) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966628.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 76690..77484 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877397.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 77609..78241 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene maiA CDS 78254..79744 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775406.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 79976..80218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 80229..81647 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 81660..83390 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 83455..84303 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 84303..85310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 85303..86016 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene livG CDS 86013..86708 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 86739..87941 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 87995..88720 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(88729..91131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(91184..91840) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920954.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 91936..93297 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(93307..94791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(94794..96812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(96972..98138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(98336..99355) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642813.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene moaA CDS complement(99382..100008) product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(100090..101712) product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(101709..102677) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(102689..103258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(103319..104137) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(104152..105333) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337089.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(105335..106213) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(106213..108633) product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(108630..109130) product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene cutC CDS complement(109158..110024) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 110382..111077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(111034..111789) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 111927..112817 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 113122..113799 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388217.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 113996..115492 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(115500..116030) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(116076..116849) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066948.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(117016..117360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 117819..118298 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198641.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(118286..119092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(119089..119946) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(119979..122045) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(122175..125327) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922389.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(125324..126538) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 126762..127655 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene dapA CDS 127663..128145 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene smpB CDS 128250..129101 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 129174..129416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 129470..129847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(129863..130804) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017265782.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 130933..131484 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066818.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(131494..134130) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113574.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(134279..136171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(136194..137144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(137233..138612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(138656..141091) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 141342..141548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 141552..142811 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965474.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 142823..143143 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(143200..144831) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113025.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 144960..146798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 146776..147141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 147156..147521 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene rplT CDS 147632..148708 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene pheS CDS 148705..151110 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene pheT CDS 151122..152924 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067667.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene lepA CDS 153005..153301 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(153317..153859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 153993..154466 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918847.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene ybaK CDS complement(154470..154781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 tRNA 154964..155053 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(155308..155580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 note possible pseudo, frameshifted CDS complement(155652..155966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 note possible pseudo, frameshifted CDS complement(156227..156469) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197949286.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 157033..157332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 157329..158090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 158087..164578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 assembly_gap 161815..161908 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 163025..163122 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 164663..166921 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975077.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 166939..168411 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(168516..174401) product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(174413..177832) product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339135.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(177832..179085) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 179799..180188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(180525..181526) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(181523..182599) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397425.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(182599..183441) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310154.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene ugpE CDS complement(183446..184369) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047141.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(184437..185732) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310152.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 185929..189021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 189070..191199 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 191196..192587 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 192677..193573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 193589..193999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 194013..194804 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974510.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene fabG CDS 195041..195742 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 195916..196734 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528429.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 196787..197923 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528425.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 197929..198642 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728924.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 198659..199558 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528427.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 199555..200649 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 200606..201430 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(201442..202218) product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292350.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(202288..202920) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 203306..204385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 sequence09 source 1..162189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(323..610) product type II toxin-antitoxin system antitoxin YacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079957.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene yacA CDS complement(772..1920) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389867.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(2181..3005) product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(3099..4166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 4473..5027 product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 5116..5358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 5412..7982 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene leuS CDS 8059..8532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 8542..9576 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene holA CDS complement(9655..10437) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(10462..11634) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(11959..12168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 12150..13055 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene gcvA tRNA complement(13165..13241) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(13303..14346) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 14472..14714 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 14711..15433 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(15426..15926) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531041.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(15937..16128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 16279..17178 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 17175..18062 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 18073..18300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(18297..19523) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(19516..20256) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(20253..21683) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(21831..22190) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(22187..22411) product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(22574..23029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 23289..23552 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970291.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 23582..25009 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529649.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(24960..25862) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(25875..26279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 26402..26923 product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 26947..27723 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640621.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(27656..28801) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 28860..30617 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 30732..31292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(31333..32310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388512.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(32315..32716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(32767..33321) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene ddpX CDS 33409..33951 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene hslV CDS 33954..35258 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene hslU CDS 35369..36184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(36231..36824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 36903..37667 product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 37679..38065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(38188..38421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(38797..39672) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(39669..40223) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 40337..40789 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528430.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(40864..41436) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(41433..42680) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(42702..43370) product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 43538..44050 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968288.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene secB CDS complement(44051..45181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(45368..45580) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 45758..47749 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 47832..48275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 48382..48804 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(48753..49004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 48987..49364 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 49357..50997 product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205826934.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 51255..52550 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene urtA CDS 52730..54355 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene urtB CDS 54352..55515 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene urtC CDS 55528..56289 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene urtD CDS 56300..56995 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene urtE CDS 56961..57815 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 57821..58018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 58032..58334 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972301.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 58346..58651 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525615.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 58653..60365 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329296.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene ureC CDS 60456..61061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 61051..61731 product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 61835..62545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 62567..63190 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene ureG CDS complement(63215..64015) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(64117..65016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 65181..66098 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 66400..68313 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 68404..69771 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 70004..72034 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 72249..74591 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 74631..76004 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 76407..78545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 78666..79667 product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(79692..80141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 80184..81392 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 81392..81928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(81937..82464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(82521..84374) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene ilvD CDS 84522..84971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(84984..85211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 85270..85815 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(85934..86224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(86295..86438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(86442..86687) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(86769..87488) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 87463..88065 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(88055..88468) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(88470..88763) product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 88938..89558 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532915.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(89594..93085) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene metH CDS complement(93096..93962) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene metF CDS complement(93959..94912) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976246.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 95185..96012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 96084..96680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(96696..97568) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(97568..99367) product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(99509..104698) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625869.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(104899..106440) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 106566..106703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(106704..107270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(107279..108058) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 108164..108739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 108963..109835 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene cysT CDS 109852..110709 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396228.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene cysW CDS 110729..111793 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 112101..112655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 112655..113437 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene bcsQ CDS 113434..118047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 118049..122617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 122614..123093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 123098..124129 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970096.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 124325..124822 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene tsaA CDS 124852..125058 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(125013..125819) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392936.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(125825..126823) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(126823..127860) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 127986..130103 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(130114..131622) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(131707..133272) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene ubiB CDS complement(133276..134046) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene ubiE CDS 134094..134921 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391546.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene mutM CDS 134930..135310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 135358..136134 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 136223..136492 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene rpsT CDS 136984..137415 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 137523..139022 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene dnaA CDS 139307..140428 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene dnaN CDS 140439..141623 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene recF CDS 141634..144078 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene gyrB CDS 144097..144765 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389412.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 144762..145445 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(145429..146391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 146476..147096 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731339.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 147148..149232 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(149235..150341) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(150387..151067) product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064114.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(151155..153467) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551717.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(154063..154785) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 155203..156045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 156062..156868 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 157005..157436 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 157981..159168 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 159165..160085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(160079..161014) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328117.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 161222..162022 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396522.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 sequence10 source 1..149714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 19..95 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(52..1722) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(2088..4157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(4246..4785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 4979..5410 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214523.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(5523..7748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(7819..8151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 8361..8597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 8898..11309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 11334..11672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 11701..12321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(12488..12907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(13142..13951) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(13956..14459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(14617..15147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 15280..15516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 15915..16265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(16277..16558) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 16710..17504 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086691.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 17614..18795 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111467.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 18805..19245 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 19262..19675 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 19700..20533 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene fabG CDS 20539..22098 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 22123..23265 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135174843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 23321..26023 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547973.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(26115..28340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(28418..29785) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(30047..30226) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004619421.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(30235..31521) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(31674..34337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(35426..35704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 note possible pseudo, frameshifted CDS complement(35972..36397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(36647..36877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 36809..37261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 37477..37680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 37685..38011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(38113..39381) product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974577.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene arsK CDS complement(39378..40742) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(40793..41149) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 41277..41897 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(41892..42920) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene arsB CDS complement(42931..43356) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene arsC CDS complement(43372..43899) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(43923..44261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 44540..45598 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 45700..46740 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 46743..47990 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene arsJ CDS 47977..48369 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(48435..48584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 48751..51456 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547973.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 51859..53538 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 53548..54897 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 54967..56052 product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 note possible pseudo, frameshifted CDS 56080..58491 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 58597..59613 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552284.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 59667..60647 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188311.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 60658..61572 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 61622..62680 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188681.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 62755..64062 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529505.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 64095..64664 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523271.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 64848..65873 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 65870..66745 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(66746..68227) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173520038.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 68425..69567 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972095.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 69650..70534 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720512.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 70531..71319 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720513.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 71322..72380 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 72485..73468 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703932.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 73465..74256 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene hisN CDS complement(74444..75235) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene mhpD CDS complement(75250..76023) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(76035..77765) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(77777..78766) product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087449.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene bphC CDS complement(78763..79638) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(79658..80527) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 80672..81283 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014162.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(81321..82391) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(82526..84160) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007420.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(84189..85142) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(85154..86266) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(86263..88158) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193082.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(88161..88796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 89471..89887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(90473..90943) product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(90940..91572) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 91689..92585 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703861.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(92706..94592) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 94763..96136 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 96138..96977 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene ntrB CDS 96983..97882 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 97917..98396 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene cynS CDS complement(98514..99125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 99337..100407 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312415.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 100404..103172 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene rbbA CDS 103177..104289 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 104352..104762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 repeat_region 105056..107733 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcgatccacgcctccgtgcgggaggcgac CDS complement(107918..108208) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene cas2 CDS complement(108212..109252) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene cas1c CDS complement(109266..109904) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene cas4 CDS complement(109909..110841) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388586.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene cas7c CDS complement(110838..112607) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene cas8c CDS complement(112604..113278) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene cas5c CDS complement(113357..115747) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 116089..116616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(116662..117837) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766812.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(117792..118577) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 118744..119832 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 119834..120562 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 120572..121531 product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246890.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(121535..122188) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536681.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(122209..124353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(124366..125043) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419265.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(125047..126048) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(126041..126982) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087314.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(126979..127803) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368601.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(127808..128785) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(128782..130305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(130302..131828) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328128.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 note possible pseudo, frameshifted CDS complement(131839..134049) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(134127..135065) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(135117..136214) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103708.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 136764..137138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 137164..138801 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene groL CDS complement(138866..139726) product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(139750..140949) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene prpF CDS complement(140950..143586) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene acnD CDS complement(143592..144755) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821414.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene prpC CDS complement(144881..146752) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389198.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 147272..148891 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919632.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 misc_feature complement(149035..>149714) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992369.1:malate synthase G locus_tag LOCUS_40770 sequence11 source 1..145447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 15680..16816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 17194..18234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 18231..18965 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(18973..19695) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241973.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(19692..22394) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391520.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(22434..23003) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene kdpC CDS complement(23015..25042) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene kdpB CDS complement(25109..26812) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene kdpA CDS complement(26846..26968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(27201..27452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 27340..27882 product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390593.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(27904..29544) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(29541..30455) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(30457..31740) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(31751..32836) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(32854..34212) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(34227..36137) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 36323..37003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 37051..38046 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 38066..38761 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(38876..39589) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(39655..40431) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(40415..40942) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339035.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 41090..42343 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 42356..42643 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 42640..45609 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529659.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 45602..46159 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 46179..47525 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920944.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 47519..48568 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 48669..49928 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523139.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 49925..50971 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 50984..51964 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199315.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 51982..54009 product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene dgcA CDS 54014..55900 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186901.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 55897..57063 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114448.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 57060..57773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 58410..59600 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(59655..61733) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene ligA CDS complement(61730..63397) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene recN CDS complement(63441..64286) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(64493..65398) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene lpxC CDS 65312..65506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(65615..67333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(67391..68632) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene ftsA CDS complement(68657..69574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(69562..70488) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(70485..71435) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene murB CDS complement(71438..72877) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene murC CDS complement(72874..74010) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene murG CDS complement(74007..75146) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene ftsW CDS complement(75143..76522) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene murD CDS complement(76527..77615) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene mraY CDS complement(77643..79070) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene murF CDS complement(79067..80530) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972057.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(80540..82312) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(82309..83031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(83028..84017) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene rsmH CDS complement(84014..84529) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599021.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene mraZ CDS complement(85018..86430) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(86484..86864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 86961..87422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(87925..88665) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(88685..89557) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491181.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 89704..90411 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS complement(90446..91039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 91224..92252 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(92266..93087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(93116..94288) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389701.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(94285..94977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(94974..96581) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(96640..97368) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(97433..98812) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene mgtE CDS 98987..99562 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180325543.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 99579..100004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 99994..100533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(100541..101536) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(101536..102162) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 102334..102939 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(102976..103539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(103793..105862) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528930.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 tRNA complement(105981..106066) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(106208..106939) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(106936..107496) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 107671..107856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(107915..108151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 108221..108934 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene lipB CDS complement(108965..109639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(109737..110084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(110092..110367) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(110440..112440) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(112460..113992) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719342.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(114168..114863) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(114860..115876) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537406.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(115873..116253) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene crcB CDS complement(116442..116744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(116741..117457) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974932.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 117578..117808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(117831..118934) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(119086..119991) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930998.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(120041..121225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(121227..122084) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene choW CDS complement(122127..123074) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969911.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 123287..124783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 124786..126450 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene betA CDS 126597..126851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 126974..127540 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(127547..127930) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(127943..129190) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187435849.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 129403..129882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(130090..130851) product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 131049..131558 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 131555..132250 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 132623..133618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 133847..134500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 134513..135031 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017206458.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(135048..136655) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(136666..137343) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384704.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(137354..138634) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 138828..139826 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 tRNA 139193..139283 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 139828..140214 product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 140217..141509 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921283.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 141545..142786 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 142808..143128 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(143269..144474) product mannose-6-phosphate isomerase Pmi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397972.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 gene pmi misc_feature complement(144860..>145447) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055873.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase locus_tag LOCUS_42010 sequence12 source 1..133967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..1048 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene fghA CDS 1126..2106 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 2160..3272 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene dprA CDS 3309..6014 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920309.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene topA CDS 6020..8302 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene rnr CDS 8328..8786 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975121.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 9180..9950 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384112.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 10067..10573 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975559.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 10961..11761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS 11758..12840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS 13045..16320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 16320..16601 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537516.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS 16681..17133 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 17157..17495 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972540.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 17909..18424 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265581.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 18734..19552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(19566..20387) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 20490..22163 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 22248..23528 product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 23573..25204 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene hutH CDS complement(25211..25852) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343108.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(25870..27081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(27078..28466) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(28472..29692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337258.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(29689..30684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(30705..31733) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(31799..33298) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene glpK CDS 33397..34431 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642813.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene moaA CDS 34448..35227 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS 35224..35967 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 35968..36879 product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 37028..37492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 37503..37856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(37945..38676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 39049..39612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 39594..40673 product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene vmeJ CDS 40670..43816 product multidrug efflux RND transporter permease subunit VexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494544.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene vexF CDS complement(43824..44672) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene pssA CDS complement(44692..45393) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(45494..47335) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 47467..47862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(47831..48754) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927239.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 48823..49734 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040767.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 49869..52049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(52111..52449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(52481..53386) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706867.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 53747..54199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(54204..55190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(55196..56554) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811875.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene flgK CDS complement(56583..57851) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086481.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene flgE CDS 58093..59217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 59214..62378 product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626057.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 62398..62667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 62822..63676 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 63698..64876 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 64891..65316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS 65418..65840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 65830..66237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS 66300..67706 product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388787.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 67703..68503 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085780.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene eutC CDS complement(68509..69093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(69243..70025) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(70088..71056) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene lpxK CDS complement(71043..72320) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(72317..73075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(73053..74792) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 74987..75691 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(75701..76225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(76228..76629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(76678..77496) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(77496..78830) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(78910..79902) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(79915..81468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 81625..81876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 81933..82763 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS 82760..83506 product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920743.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 83591..84808 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626371.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene opgC CDS complement(84816..85214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(85310..86539) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 86684..87844 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(87828..88070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(88234..88482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(88573..89613) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998299.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene dmpG CDS complement(89613..90554) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene mhpF CDS complement(90658..92034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(92040..93386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 93608..94354 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 94400..95488 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968218.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene dinB CDS complement(95527..95892) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063677.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(95939..96901) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 96975..98225 product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532907.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 98238..98498 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 98495..101431 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 101424..101999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(101996..102637) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 102753..103217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 103232..104089 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113146.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 104092..105861 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551438.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 105880..106767 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113144.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(106774..108129) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 108282..109757 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337936.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(109819..109938) product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383171.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene cydX CDS complement(109954..111108) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene cydB CDS complement(111114..112688) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(112731..114413) product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(114431..116107) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538124.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene cydD CDS complement(116110..116652) product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 116876..117193 product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973063.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene bigR CDS 117186..117608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 117620..118036 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 118042..118698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(118776..120524) product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(120524..121138) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056046.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(121150..122913) product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(122952..123368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(123370..123570) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(123584..124447) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(124729..125127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(125127..125903) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(125925..126611) product transcriptional regulator FixK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918638.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene fixK CDS 126759..127148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(127152..127817) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 128005..129021 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 129028..130542 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528956.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 130539..131606 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 131599..132543 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 132540..133811 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 sequence13 source 1..73619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 608..2029 product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(2153..3553) product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 3707..7162 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390070.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene pyc CDS 7159..9822 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene acnA CDS 9952..10323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 10670..12961 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene metE CDS complement(13028..13630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(13677..14933) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 15063..16991 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 16994..20812 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene cobN CDS 20820..21284 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 21284..21628 product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(21662..23638) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(23641..24840) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551445.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS 24975..25715 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208494.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 25715..26998 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(27043..27594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 27488..27736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 27738..28772 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116069.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 28903..30138 product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS complement(30214..31506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(31571..32944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(33157..35223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS complement(35263..36141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 36512..37105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 37118..40885 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 41079..42425 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196472.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 42432..44417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 44754..45896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 45893..47767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 47764..48912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 49821..50723 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene gmd CDS 50726..51691 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 51906..55700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 56002..56925 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940255.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 56944..58548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 58816..59793 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene galE CDS complement(59944..61455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(61452..64628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 65527..66633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS 66620..67450 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 67463..68125 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(68036..68224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 68381..70054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(70077..72779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 sequence14 source 1..73128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..607) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(700..1497) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(1497..2501) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(2501..3334) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(3337..5277) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS complement(5645..6286) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene bluB CDS complement(6283..7311) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 gene cobD CDS 7289..8287 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531121.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 gene cbiB CDS 8314..9135 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 9110..10072 product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202848.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 10226..11158 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385731.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(11199..12662) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(12662..13279) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 gene cobO CDS 13660..14025 product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086045.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 14022..15059 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 gene cobW CDS 15064..18351 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337770.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 gene cobN CDS 18393..19526 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 gene cobG CDS 19523..20155 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 20155..20877 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528814.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 20874..21623 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311008.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(21599..22351) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 22376..23614 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526984.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 23611..23973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 23970..24740 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337777.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene cobM CDS complement(24731..25801) product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258096.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 25831..27141 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339112.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(27145..28431) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(28428..28904) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(28901..29833) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(29837..31198) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 31447..31719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS 31719..32018 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 tRNA complement(32244..32320) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 32572..33294 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 33291..34088 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 34085..35023 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(35089..35610) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967130.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 35930..36421 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 36423..36680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 36677..37030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 37034..38008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 38005..38388 product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 38385..39869 product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 39874..41367 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 41364..42938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 42954..43361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 43378..43914 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 43958..44416 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 gene mce CDS complement(44468..45073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 45201..46175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(46109..46441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 46533..46811 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626377.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 46877..47230 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 tRNA complement(47300..47374) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(47481..47801) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 gene trxA CDS complement(47869..51288) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 gene addA CDS complement(51285..54272) product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 gene addB CDS complement(54256..54987) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(54984..56030) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(56027..56512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 note possible pseudo, frameshifted CDS 56628..57650 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 57673..57999 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532523.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(58001..59071) product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(59074..59931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(60049..60384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(60393..61271) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(61268..62041) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 62209..62832 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene msrA CDS complement(62865..64538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS 64843..66708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 66785..67948 product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(67938..69197) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259113.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(69258..70055) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(70144..70725) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(70996..72201) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972933.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 misc_feature complement(72541..>73128) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055873.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase locus_tag LOCUS_44480 sequence15 source 1..29508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(350..2542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(2562..3941) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 4341..7043 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187933.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(7060..8190) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(8192..10903) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140331.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 gene rbbA CDS complement(10900..11865) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 12042..13775 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 13759..14547 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338824.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene fabI CDS complement(14529..15662) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249265.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(15665..16789) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(16803..18206) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968504.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(18271..19524) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527916.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS complement(19640..20437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(20530..22437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 22781..23779 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937871.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 23760..24155 product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061781412.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 24234..24989 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 25046..26167 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 26291..27043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 27030..29156 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085126.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 sequence16 source 1..22449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1989 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148161.1:two-partner secretion system adhesin CdrA locus_tag LOCUS_44690 CDS 2004..3761 product two-partner secretion system transporter CdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 gene cdrB CDS complement(3890..4648) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(4668..5213) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067721.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(5213..6916) product two-partner secretion system transporter CdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 gene cdrB CDS complement(7163..8122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(8411..8611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 sequence17 source 1..17040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..1538) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931072.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene paaF CDS 1817..3322 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS complement(3340..4245) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 4354..5607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 5626..5934 product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230485.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 5931..6434 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS 6482..7042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(7103..8509) product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705608.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene paaC CDS 8671..10707 product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene paaZ CDS 10709..11692 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 gene paaA CDS 11689..11970 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 gene paaB CDS 11981..12715 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 gene paaC CDS 12718..13188 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813291.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 gene paaJ CDS 13196..14266 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene paaK CDS 14291..15085 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 gene paaG CDS 15087..15521 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 gene paaI CDS 15518..16723 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene pcaF sequence18 source 1..11713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..991) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(1006..2052) product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(2049..2237) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(2239..3009) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(3011..3808) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 gene mhpD CDS complement(3821..5281) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(5294..6217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(6221..6556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(6560..7627) product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(7643..8005) product phenol hydroxylase subunit P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(8061..9596) product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(9609..9899) product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(9911..10909) product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(10940..11170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45060 sequence19 source 1..6508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS complement(1627..3507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(4011..5780) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666240.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(5912..6295) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241260.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 sequence20 source 1..5899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 554..2035 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 2238..2314 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 2331..2406 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 rRNA 2762..5484 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5655..5764 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 5823..5899 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 sequence21 source 1..4514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1388..3265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS complement(3378..4514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 sequence22 source 1..2324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..1949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence24 source 1..1151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..1120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..1114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(509..>1114) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918095.1:CoA transferase subunit A locus_tag LOCUS_45130