COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..525936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1245) product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1504..1875 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1893..2360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2420..3643) product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene khtU CDS complement(3785..4102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4121..4609) product K(+)/H(+) antiporter subunit KhtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene khtT CDS complement(4700..5593) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 6073..6909 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene araC CDS 7135..8859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8960..10069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 10066..11190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11187..11906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11951..12670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12906..13418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(13395..14108) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene cobB CDS complement(14626..14868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(14974..15810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16157..16471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(16588..16920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(16995..17870) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18048..19037 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19188..19634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(19726..20502) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene cobA CDS complement(20527..21354) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(21341..21700) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene nirD CDS complement(21718..24129) product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene nasD CDS 24832..25779 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 25782..26537 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26515..27384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 27389..28255 product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene mntD CDS complement(28355..29236) product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(29218..29349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 29554..30303 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(30505..31140) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(31196..32215) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 32417..33235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(33375..33650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(33930..35405) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(35714..35854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(35884..36249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 36451..37005 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 37058..38767 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 38757..39587 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(40883..41629) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 41921..42826 product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 42839..43474 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(43605..44945) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(45153..47258) product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene aguA CDS complement(47291..48082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(48193..49833) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(49896..50768) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(50811..51776) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(51893..54262) product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene galB CDS complement(54403..55089) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(55362..55877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(55874..57457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 57818..58381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 58448..58861 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 58984..59718 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 59820..60239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(60298..61221) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene ppaC CDS complement(61322..61945) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(62003..63637) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene metG CDS complement(64109..65014) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(65088..65681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(65770..66594) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(66770..68680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025992.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(68655..69419) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(69502..70506) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002183605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(70507..71229) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 71546..72205 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(72264..72503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 72652..73242 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 73245..73916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 73949..74386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(75294..76139) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(76321..76614) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 76733..77419 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 77560..78372 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 78466..79419 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(79379..79582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(80113..80427) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(80522..80974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(81003..81896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(81893..82189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(82454..82639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(82788..83351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(83372..83650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(83836..85077) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(85202..85825) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 85969..86700 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 86793..87284 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(87428..88576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(88599..89303) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(89611..91395) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene recQ CDS 91538..92347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(92412..94328) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(94321..96057) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(96148..97068) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(97221..97697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(97712..99070) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(99186..99398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 100473..101594 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 101661..103166 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 103163..104152 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 105321..106154 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 106161..106838 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(107216..107383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(107475..107900) product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 108051..108347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(108363..109118) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(109147..109446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(109751..110206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 110372..110956 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(111176..111886) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 112034..113203 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 113227..114714 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene nhaC CDS complement(114786..116390) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(116587..118191) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(118212..119105) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(119121..120095) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(121594..123198) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(123217..124110) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(124124..125098) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(125624..126604) product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene yumC CDS 126858..127517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 127533..128450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(128457..129035) product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene tmrB CDS complement(129211..130680) product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 130985..131917 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 132131..132568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 132638..133513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(133580..134032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 134201..134497 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(134853..134972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 135259..135798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(136042..136368) product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene qoxD CDS complement(136370..136978) product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene qoxC CDS complement(136995..138947) product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene qoxB CDS complement(138966..140012) product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene qoxA CDS complement(140451..140999) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(141195..142463) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(142851..144443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 145499..145963 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(146132..147784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(148216..148962) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(148959..149474) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(149769..151778) product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene bmrD CDS complement(151775..153523) product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene bmrC CDS complement(154033..155100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 155318..155551 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 155806..156531 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 156576..157715 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene sat CDS 157712..158344 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene cysC CDS 158402..159172 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene cobA CDS complement(159259..160209) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene trxB CDS complement(160314..161750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 162284..162844 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene chrA CDS 162841..163371 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene chrA assembly_gap 163492..163585 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(163700..163942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(163899..164159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 164344..164682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 164812..165582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(165673..166764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(166973..167701) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(167780..168445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(168942..169496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(169579..170829) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(171017..172009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(172099..173490) product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 173613..173993 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene crcB CDS 173990..174355 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene crcB CDS 174373..174999 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(175122..176105) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 176370..176900 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(176948..177640) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene araD CDS complement(177667..179109) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene araA CDS complement(179137..180810) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene araB CDS 181142..181330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(181543..182625) product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene araR CDS 182857..183495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(183625..183996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 184122..184517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(184603..185502) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(185633..186739) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(186944..187579) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(188210..189688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(189681..190130) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(190350..191555) product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene egsA CDS complement(191824..193368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 193623..194624 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 194725..195498 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene phnC CDS 195495..196283 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene phnE CDS 196280..197086 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene phnE CDS 198092..198808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 198810..199760 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 200420..200656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(200866..201192) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 201340..201789 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(201849..203081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 203424..204860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 204857..205507 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(205582..205971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(205923..206930) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(206927..207640) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 207814..208437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(208774..210522) product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 210717..212009 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101331783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 212040..213359 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 213360..214202 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 214285..215295 product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene malR CDS complement(215374..215529) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 215705..216340 product spore germination lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene lipC CDS complement(217624..218112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(218109..218543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 218722..222291 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 222310..222693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 222724..223626 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 223915..224748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(224812..225915) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene nadA CDS complement(225905..226762) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene nadC CDS complement(226731..228299) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene nadB CDS 228481..229623 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 230436..231644 product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(231782..233143) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene glnA CDS 234068..236278 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 236301..236744 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 236741..237010 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 237038..238336 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 238419..239411 product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 239424..240161 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 240166..240900 product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 241203..241865 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(241907..242887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(242903..243697) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(243974..245932) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 246139..246735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(246786..247778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 249517..250362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(250382..250798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(251113..252126) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(252123..253154) product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene oppD CDS complement(253175..254194) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(254194..255123) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(255241..256956) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 257354..257686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(257772..258275) product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 assembly_gap 259126..259217 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(259323..260165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(260107..261294) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(261391..262791) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(262976..263362) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(263543..264022) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(264230..265738) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene ypwA CDS complement(266094..267548) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(268191..269255) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 269532..270698 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(271001..271453) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(271460..273658) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene topB CDS 273835..274305 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 274787..275884 product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene ansZ CDS 276224..276748 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 276942..278420 product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene abfB CDS complement(278535..280238) product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(280242..281324) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(281338..282126) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(282123..282953) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(282950..283897) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(283982..285031) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(286486..287313) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(287329..288195) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(288198..289289) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(289371..290690) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(291295..291885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(292055..292738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(292738..293634) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(293636..294001) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(294515..295117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(295212..295871) product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(295922..297829) product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rhgX CDS complement(298046..299530) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(299706..301220) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(301302..302810) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(302844..303728) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(303739..304707) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(304881..307211) product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene yesS CDS 307440..309728 product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(309811..310050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(310047..311246) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 311454..312299 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(312599..312862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 313824..314315 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 314541..316913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(317078..324091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(324285..324896) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398204.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(325012..326562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 327060..327839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(328293..329525) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(329709..330560) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 330874..331359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(331397..332611) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(333031..334230) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(334263..334913) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 335082..336113 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(336287..336463) product YezD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(336594..337658) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(338075..338944) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene cysW CDS complement(338956..339780) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene cysT CDS complement(339817..340920) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(341506..343398) product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(343395..344327) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene pfkB CDS complement(344324..345079) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(345320..346384) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene uxuA CDS complement(347309..349564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(349640..351139) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(351177..352034) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(352055..353014) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(354283..355635) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(355660..356514) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(356531..357463) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(357868..358428) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(358700..359608) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(359813..360013) product YjfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(360030..360266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(360420..361904) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 362185..362799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 362827..363258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 364825..364989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 365517..365684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 365900..366877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 368083..368310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(369233..369772) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 369984..370727 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 371041..371280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 371280..371621 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 371818..372273 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 372747..374024 product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(374068..374751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(374942..375637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(375609..376127) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 376301..376720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(376784..377812) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 377938..378870 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(378954..380552) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(380604..381482) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(381499..382455) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(382709..383200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(383391..384200) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(384193..385071) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(385056..386186) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(386183..387274) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(387276..389252) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(389249..391318) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(391959..393227) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(393229..394740) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(394780..396285) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(396303..397598) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 398122..400437 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(401533..402501) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene glpX CDS 402807..405923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 406313..407143 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230722.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene kduI CDS 407170..407946 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene kduD CDS 408128..409132 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene kdgT CDS complement(409691..410467) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(410589..412085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(412075..413856) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(413900..414778) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(414802..415680) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(415968..417236) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(417416..418702) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(419304..420179) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(420200..421165) product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rmgP CDS complement(421421..422980) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(423490..424086) product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 425044..425592 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(425850..426722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(426868..427950) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 428096..428986 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(429913..430737) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(430718..431413) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(431426..432046) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(432318..432851) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(432966..433466) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 433599..434402 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(435127..435966) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(435950..436747) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(437111..437470) product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 438047..439003 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(439115..441328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(441577..443343) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene msbA CDS complement(443340..445079) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 445335..445544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(445628..447247) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(447260..448159) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(448172..449158) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(449552..450523) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(450655..451518) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(451558..452115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 452871..453047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 453057..453398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(453466..453780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(453968..455140) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(455297..456697) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene glcD CDS complement(456715..457788) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(457846..459210) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(459238..460131) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene murQ CDS complement(460671..461549) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(461562..462422) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(462481..463797) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 464152..465675 product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 466051..467076 product phosphate ABC transporter substrate-binding protein PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene phoX CDS 467158..468105 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene pstC CDS 468107..468985 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene pstA CDS 468998..469831 product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene pstB CDS 469860..470525 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene phoU CDS 470928..471506 product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene ylaC CDS 471475..472215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 472217..473089 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 473113..474330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 474346..475449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 475547..476173 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 476337..477344 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 477650..478915 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene codB CDS 478916..480184 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(480863..481210) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242640.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 481400..482002 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158950.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(482059..483150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(483214..484500) product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene uglF CDS complement(484926..486986) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 487406..488005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 488940..489410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(489447..489680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(489698..489835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(489975..490973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 491328..492905 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 493136..493759 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 494081..494869 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(495027..497516) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 497676..498383 product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(498703..499599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 500017..500823 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene glnH CDS 500908..501558 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 501555..502277 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(502408..502911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(503058..504122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 504648..505142 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene moaC CDS complement(505301..506509) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene narK CDS 506865..507761 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 507758..508471 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(508610..509185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(509198..510301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(510426..512474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(512578..514485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(514482..515201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(515307..516701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(516849..518219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(518618..518788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(518788..518970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(519205..520575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(520692..522074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(522234..523613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(523677..524714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(525044..525679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 sequence02 source 1..476122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..745) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(888..2279) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(2365..3189) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 3468..4634 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 4699..5436 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 5759..6808 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rsgA CDS 7118..11032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(11147..12064) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(12965..14164) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 15000..18317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(18454..19614) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(19741..20190) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 20393..21733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(21737..22477) product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene ywaC CDS 22662..24071 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 24088..25170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 25167..26327 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 26328..26555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(26696..27811) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene nagZ CDS complement(27964..29193) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 29346..29570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 29602..29820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(30074..30553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 31114..32364 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 32380..33318 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 33334..34158 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 35087..35827 product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ecsA CDS 35824..37041 product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ecsB CDS 37083..37811 product ecs operon protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene ecsC CDS complement(37980..39209) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(39284..40471) product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene sndC CDS 41114..41623 product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene yfkM CDS 41875..42138 product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(43091..43561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 43762..45882 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 45997..48207 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene helD CDS 48321..49184 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(49310..50146) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 50566..51618 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene hemE CDS 51620..52549 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene hemH CDS 52611..54026 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene hemY CDS complement(54179..55978) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(55978..57519) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(58929..59591) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(59582..61201) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(61198..62085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(62046..62774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(62856..65009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 65378..66928 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 68042..69205 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 69220..70317 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 70554..70940 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 70963..71895 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 71913..72647 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(72727..73857) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(73847..74341) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene sigM CDS 74722..74922 product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene cspB CDS 75102..75734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 76117..76671 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 76623..76802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 77149..78351 product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene zinU CDS 78344..78613 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene rpsN CDS 78824..79999 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 80277..82316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 82344..84578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 84612..85577 product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene rmgP CDS 85591..86484 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 86527..88161 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 88406..89428 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 89466..90413 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 90388..91185 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 92321..93313 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 94213..95433 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 95514..96449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811522.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(96450..96584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 96695..97228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(97294..97539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(97612..98064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 98208..98681 product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene comK CDS complement(98678..99709) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(99702..101039) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 101242..101853 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 101889..102458 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene lepB CDS 102637..102984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 note possible pseudo, internal stop codon CDS 103647..104699 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 104713..105432 product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 106036..107547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 107567..108151 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 108142..108930 product biofilm matrix protein TasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene tasA CDS 108960..109877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 109874..110518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(110478..110801) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(110890..111033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 111663..115151 product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene addB CDS 115148..118897 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene addA CDS 118894..120084 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 120059..123469 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene sbcC CDS 123482..123772 product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene hlpB CDS complement(124286..124495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(124628..124849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(124889..125278) product spore germination protein GerPE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(125275..125451) product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene gerPD CDS complement(125448..126071) product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(126103..126312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(126337..126561) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 126670..127575 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 127629..129047 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene gabD CDS 129101..129889 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 130142..131983 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene asnB CDS 132682..134181 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 134178..135656 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene crtI CDS 135671..136504 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(136548..138020) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134752840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene crtI CDS complement(138017..139129) product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene cruC CDS complement(139148..139822) product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene cruD CDS complement(139819..140598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(141236..144682) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene metH CDS complement(144706..146565) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(146562..147689) product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene metI CDS complement(147946..148812) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(149373..150209) product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene ldcB CDS complement(150417..151061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(151151..152011) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 152200..153030 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 153112..153954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(154215..154478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(154844..154966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 155157..155441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(155477..155677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 155865..156176 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 156624..156770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 157247..158284 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene argC CDS 158329..159555 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene argJ CDS 159579..160352 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene argB CDS 160353..161522 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 161552..162628 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 162621..165749 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 165746..166705 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene argF CDS 166925..167302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 168095..168274 product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(168590..168778) product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211116.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 168992..169726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 169746..170435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 170535..171485 product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene med CDS complement(171772..172035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 172254..173189 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene fabH CDS 173260..174501 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene fabF CDS complement(174740..175771) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 175927..176709 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(177188..177325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 178004..179062 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 179028..180044 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 180059..181786 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 181854..182819 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 182832..183755 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 183843..184595 product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(184741..185724) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene trpS CDS 186169..187356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 188144..188689 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 189064..189459 product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene spx CDS complement(189525..190187) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 190416..191072 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene mecA CDS complement(191490..191873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 192353..192583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 192637..194451 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pepF CDS complement(194656..194832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(194907..195788) product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene spxH CDS complement(195801..196190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(196424..196996) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 197196..197843 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 197848..198648 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 198648..199541 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(199673..200857) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 200955..202316 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene mgtE CDS 203312..204085 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene fabI CDS 204271..204729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(205722..206183) product spore coat protein CotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene cotY CDS 206401..206574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 207951..208193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(208204..208629) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(208619..209152) product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 209303..209863 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 tRNA complement(210016..210090) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 210443..210769 product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene tnrA CDS complement(210807..211052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 211186..212097 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene glcK CDS 212177..212980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 213005..214090 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 214208..215296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 215484..216464 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 216468..217346 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 217999..219006 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 219009..220322 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene xylA CDS 220338..221831 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene xylB CDS 221905..223044 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 223066..224184 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 224592..225719 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(225716..226900) product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(227116..227889) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 228494..229219 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090110.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 229686..231299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 231497..232702 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 232776..233012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 233072..233668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 234380..234595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(234685..235530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 235688..236371 product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene lutR CDS 236418..237149 product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene lutA CDS 237156..238598 product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene lutB CDS 238579..239298 product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene lutC CDS 239610..240572 product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene kdgK CDS 240580..241224 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene eda CDS complement(242351..243901) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene zwf CDS 244238..244555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 244766..245542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 245953..246825 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 246885..247886 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene cytR CDS complement(248221..249468) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene proA CDS complement(249461..250567) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene proB CDS 250999..253266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 253715..254833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 254830..256077 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 256090..257061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 257065..257928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 257947..258153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 258186..258872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 258893..261133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 261149..261733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 261746..262246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 262260..263939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 263936..264829 product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 264836..265504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 265789..266466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 266517..266708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 266705..267598 product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 267605..268276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 268548..269030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 269542..270435 product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 270442..271119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 271254..271922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 272027..272272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 272348..272695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 272782..273465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 273521..274177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(274557..274739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 275029..275241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(275247..275708) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(275831..278056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(278062..279930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(279927..280565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(280766..281122) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(281197..281928) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(282080..282523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(282550..282693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 284232..284513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 284714..285430 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 285418..286851 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(286934..288100) product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 288310..289170 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 289260..290669 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene gndA CDS 290775..292250 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene gntK CDS 292321..293037 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 293141..293800 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(293994..294257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(294701..294901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(295353..295817) product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(295921..296205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(297215..298084) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 298173..299384 product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 299479..299724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(299785..300630) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene proC CDS 300851..302947 product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene clpE CDS complement(303001..303927) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 304062..304247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 305473..306360 product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene ccpC CDS 306451..307173 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene dapD CDS 307260..308378 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(309188..310039) product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene mscT CDS 310284..310826 product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene ahpA CDS 311229..312986 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 312998..314821 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 315082..315750 product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene ktrC CDS complement(316022..317689) product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rnjA CDS complement(317693..317902) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 318268..319044 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(319085..319639) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene def CDS 319790..320509 product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 321254..321436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 321952..323037 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene pdhA CDS 323041..324018 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene pdhB CDS 324054..325364 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene pdhC CDS 325369..326781 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene lpdA CDS complement(326868..327191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 327423..328310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(328370..329842) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene speA CDS complement(329935..330570) product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 331038..331244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 331500..332303 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene suhB CDS complement(332352..332543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 333670..335511 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene typA CDS 335548..335919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 336555..336827 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 337063..338388 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(338507..338947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 339043..339972 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene glsA CDS 340151..340435 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 340576..341745 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene ftsW assembly_gap 341922..342019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(342302..343225) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene ctaA CDS 343652..344611 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene ctaB CDS 344663..345718 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene coxB CDS 345743..347632 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ctaD CDS 347632..348240 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene ctaE CDS 348322..348585 product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene ctaF CDS 348664..349575 product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ctaG CDS 349607..350074 product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 350190..350684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 350685..351842 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(352009..352383) product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 352556..353599 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 353682..354680 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 354677..355657 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 356287..356682 product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 356686..356928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 357191..357853 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 357871..358869 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 358874..359611 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 359724..360542 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 360689..361039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 361112..361555 product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene ricF CDS 361601..361921 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(361982..362377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 364131..364682 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene rsmD CDS 364689..365174 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene coaD CDS complement(365313..366518) product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene spoVV CDS 366603..367640 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(367647..368867) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 369016..369555 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232214.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 369570..369743 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene rpmF CDS 369907..370404 product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene gerR CDS complement(370549..370764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 371618..371995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 372120..373742 product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene bshC CDS 374182..374613 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene mraZ CDS 374659..375591 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rsmH CDS 375617..375979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 375994..378276 product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene pbpB CDS 378337..380286 product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 380321..381799 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene murE CDS 381789..383153 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 383166..384143 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene mraY CDS 384145..385497 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene murD CDS 385546..386637 product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene spoVE CDS 386659..387558 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene murB CDS 388846..389646 product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene divIB CDS 389636..390337 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 390342..391052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 391054..391425 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 391647..392933 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087558.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene ftsA CDS 392973..394142 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene ftsZ CDS 395201..396139 product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene spoIIGA CDS 396143..396874 product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene sigE CDS 396962..397741 product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene sigG CDS 397904..398152 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 398235..399023 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene pgeF CDS 399027..399707 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 399767..400204 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene sepF CDS 400211..400474 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 400477..401256 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 401411..401911 product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene divIVA CDS 402282..405053 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene ileS2 CDS 405104..405571 product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene lspA CDS 405572..406495 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(406425..406616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 406747..407289 product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene pyrR CDS 407430..408728 product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene pyrP CDS 408769..409707 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 409664..410947 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene pyrC CDS 410944..412041 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 412025..415237 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene carB CDS 415234..416004 product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene pyrK CDS 416004..416942 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 416914..417618 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene pyrF CDS 417621..418253 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene pyrE CDS complement(418326..418934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 419624..419914 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 419911..420243 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(420436..422139) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 422284..425007 product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 425094..425972 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 426039..426302 product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene remA CDS 426306..426926 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene gmk CDS 426926..427159 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene rpoZ CDS 427932..429134 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene coaBC CDS 429140..431542 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene priA CDS 431708..432661 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene fmt CDS 432658..434001 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rsmB CDS 434003..435097 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rlmN CDS 435106..435864 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 435861..437939 product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene prkC CDS 437949..438827 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene rsgA CDS 438835..439494 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rpe CDS 439919..441493 product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene yesM CDS 441477..442229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 442342..443640 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 443760..444656 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 444658..445494 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 445588..446244 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025388434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(446684..446872) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rpmB CDS 448224..448583 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 448599..450281 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 450377..452422 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene recG CDS 452508..453104 product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene fapR CDS 453088..454083 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene plsX CDS 454140..455090 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene fabD CDS 455087..455824 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene fabG CDS 455864..456106 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene acpP CDS 456299..457039 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rncS CDS complement(457132..457359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 457472..461038 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene smc CDS 461066..462043 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene ftsY CDS 462146..462475 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 462644..463996 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene ffh CDS 464470..464742 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rpsP CDS 464756..464983 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 465508..466686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 467752..468123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 468141..468662 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene rimM CDS 468659..469399 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene trmD CDS 469498..469839 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene rplS CDS 470051..470575 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene lepB CDS 470599..471516 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene ylqF CDS 471491..472252 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene rnhB CDS 472309..473508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 473496..473831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 473892..475052 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene sucC CDS 475069..475968 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene sucD sequence03 source 1..301356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..894 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 918..2423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 2496..3101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(3232..3657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(3823..4263) product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene mhqR CDS complement(4458..5084) product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(5077..5943) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(5946..6323) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(6614..9055) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene parC CDS complement(9093..11036) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene parE CDS 11230..11550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(11553..12128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(12208..12885) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(12895..13665) product DUF3891 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(14488..14835) product IDEAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(14938..15291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 16953..17855 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene dapA CDS complement(17941..18813) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(19063..19983) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(20075..20989) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(21365..22774) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(22858..23079) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 23217..23855 product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene sleB CDS complement(24052..25308) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene ilvA CDS 25695..26135 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(26178..26678) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(26790..27785) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene galE CDS complement(27782..28951) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(28942..29937) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene galT CDS 30046..31254 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(31239..32105) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(32278..32724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(32929..33582) product YpjP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(33919..34995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(34988..35440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(36161..36610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(36839..37282) product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(37359..39056) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene ilvD CDS complement(39667..40779) product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 40899..41186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 41261..42178 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene metA CDS complement(42795..43013) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(43036..43689) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 43769..44164 product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(44143..44427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 44679..44798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(45080..45658) product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene bpsB CDS complement(45658..46713) product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene bpsA CDS complement(46829..47008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(47070..48206) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(48762..49070) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene gpsB CDS complement(49133..49708) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(49864..50187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(50382..51629) product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene mrfB CDS complement(51607..53895) product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene mrfA CDS complement(54066..54776) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 54884..55141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 55203..55613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 55663..56508 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 56505..58295 product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(58297..59754) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(59937..60308) product YppE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(60364..60822) product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene racA CDS complement(62220..63161) product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 63308..63913 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene recU CDS 63939..66668 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(66849..67373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(67370..68023) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene nth CDS complement(68038..68733) product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene dnaD CDS complement(68773..70065) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene asnS CDS complement(70139..70627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(70627..70800) product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(71011..71394) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene panD CDS complement(71391..72269) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene panC CDS complement(72254..73078) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000851109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene panB CDS complement(73294..74256) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(74243..75430) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(75427..76557) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene bshA CDS complement(76559..77260) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene bshB1 CDS complement(77253..77678) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene mgsA CDS complement(77700..78497) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene dapB CDS complement(78499..78837) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(79440..79619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(79780..79959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 80168..81040 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(81195..81863) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(81923..82747) product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene ypjB CDS complement(82846..83436) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(83671..84447) product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(84482..85156) product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene qcrB CDS complement(85159..85671) product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene qcrA CDS complement(85807..86262) product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(86301..86846) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(86875..88131) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(88294..89394) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(89391..90497) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene hisC CDS complement(90512..91321) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene trpA CDS complement(91318..92526) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene trpB CDS complement(92516..93166) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(93163..93927) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene trpC CDS complement(93920..94954) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene trpD CDS complement(94947..96449) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene trpE CDS complement(96727..97107) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene aroH CDS complement(97104..98192) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene aroB CDS complement(98192..99364) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene aroC CDS complement(99435..100217) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene cheR CDS complement(100273..100719) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene ndk CDS complement(100797..101759) product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene hepT CDS complement(101789..102508) product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene menG CDS complement(102508..103290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(103400..103624) product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene mtrB CDS complement(103777..104049) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(105847..107325) product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene spoIVA CDS complement(107561..108262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(108275..108475) product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(108906..109943) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene gpsA CDS complement(109967..111289) product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene engA CDS complement(111366..111971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(112075..113127) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(113140..114303) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rpsA CDS complement(114433..115017) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(115014..115694) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene cmk CDS complement(115964..116599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(116678..118036) product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ypeB CDS complement(118059..118871) product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene sleB CDS complement(120251..120955) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene prsW CDS complement(121050..122015) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(122055..123053) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(123199..124470) product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene gudB CDS complement(125159..125755) product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(125895..126797) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(126876..127643) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(127719..128090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(128158..128931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(129123..130586) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(130591..131637) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 131897..132148 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(132345..133004) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene opuCD CDS complement(133017..133934) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(133950..134621) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(134618..135757) product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene opuCA CDS complement(135761..136450) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 136609..138657 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 139278..140849 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene serA CDS complement(141974..143233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(143208..143765) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene sigX CDS complement(143922..145688) product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene resE CDS complement(145689..146444) product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene resD CDS complement(146463..147647) product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene resC CDS complement(147635..149335) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene resB CDS complement(149361..149894) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene resA CDS complement(150010..150738) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene rluB CDS complement(150967..151485) product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene spmB CDS complement(151491..152075) product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene spmA CDS complement(152068..153183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(154392..154982) product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene scpB CDS complement(154979..155746) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene scpA CDS complement(155847..156539) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 156886..157377 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(158063..158440) product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ribT CDS complement(158479..158955) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene ribH CDS complement(159115..160305) product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene ribBA CDS complement(160317..160937) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene ribE CDS complement(160969..162042) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ribD CDS complement(162469..162909) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(162924..164249) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene lysA CDS complement(164328..165812) product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene spoVAF CDS complement(165760..166380) product stage V sporulation protein SpoVABEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene spoVAEA CDS complement(166412..166813) product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene spoVAB CDS complement(166818..167438) product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene spoVAA CDS complement(168124..168873) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene sigF CDS complement(168886..169326) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene spoIIAB CDS complement(169330..169680) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene spoIIAA CDS complement(169801..170967) product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene dacF CDS complement(171194..171727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 172539..172874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(172932..174239) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(174236..175075) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(175053..175874) product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(175864..177066) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene deoB CDS complement(177188..178081) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene xerD CDS complement(178099..178296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(178354..178812) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene fur CDS complement(178936..179577) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene spoIIM CDS complement(179638..180168) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 180318..180530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 180527..181435 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(181877..182521) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003057850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(182592..182927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(182893..183480) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 183703..183951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(183922..184089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(184404..185183) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 185977..186696 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(186712..187653) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene rnz CDS complement(187650..188801) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(188819..189928) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(190003..191379) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(191642..192184) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(192205..193206) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(193266..193688) product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene brxB CDS complement(194120..195376) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(195415..196398) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene bfmBAB CDS complement(196395..197402) product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene bfmBAA CDS complement(197415..198809) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene lpdA CDS 198969..199217 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(199302..200705) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(201799..202560) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(203985..204770) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene spo0A CDS complement(205014..206309) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene spoIVB CDS complement(206427..208112) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene recN CDS complement(208197..208655) product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene argR CDS complement(208721..209545) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(209551..211455) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene dxs CDS complement(211673..212560) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene ispA CDS complement(212553..212795) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(212782..214140) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene xseA CDS complement(214150..214536) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene nusB CDS complement(214905..215273) product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene yqhY CDS complement(215289..216650) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene accC CDS complement(216656..217114) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene accB CDS complement(217463..218089) product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene spoIIIAH CDS complement(218093..218758) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene spoIIIAG CDS complement(218755..219360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(219368..220588) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene spoIIIAE CDS complement(220585..220974) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene spoIIIAD CDS complement(221003..221203) product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene spoIIIAC CDS complement(221230..221742) product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene spoIIIAB CDS complement(221739..222662) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene spoIIIAA CDS complement(223041..223598) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene efp CDS complement(223622..224683) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene pepQ CDS complement(224707..225135) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene aroQ CDS complement(225202..225723) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 225902..226846 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 226910..227311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(227820..228707) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(228815..229255) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene mntR CDS 229512..229889 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(230074..231537) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene gcvPB CDS complement(231509..232885) product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene gcvPA CDS complement(232885..233973) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene gcvT CDS 234380..236032 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 236019..236801 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(236965..237135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(237205..237708) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(237733..238188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(238121..238534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(238531..238875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(238865..239290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(239283..239618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(239643..240662) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene comGB CDS complement(240646..241662) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene comGA tRNA 241844..241917 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(242018..242407) product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene mgsR CDS 242644..242886 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(244386..245000) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 245189..245368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(245460..246569) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene thiO CDS complement(246757..247533) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene thiG CDS complement(247538..247735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(247741..248376) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene thiE CDS complement(248605..249627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(249707..250582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(250712..252559) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(252886..253845) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene glcK CDS complement(253896..254114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(254283..255746) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(255970..256146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(256209..257210) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene thiF CDS complement(257228..257782) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(257845..257994) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rpmG CDS 260146..260511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003740295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 260508..261020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 261487..262314 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene dapA CDS complement(262728..264809) product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene pbpA CDS complement(264879..266171) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(266304..266912) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene sodA CDS complement(267060..268028) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(268215..269255) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 tRNA complement(269662..269754) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(269762..269838) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(269855..269930) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(270040..270525) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 270675..271406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(271429..272076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 272271..272621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 272742..273857 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene ispG CDS complement(274001..274381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(274452..275312) product zinc ABC transporter permease ZurM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene zurM CDS complement(275309..276082) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(276315..277028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(277098..278516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 278659..278919 product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(278958..279857) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 280010..280960 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(281071..282168) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(282165..282857) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(282924..283259) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene cccA CDS complement(283539..284660) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rpoD CDS complement(284742..286568) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dnaG CDS complement(286992..287453) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(287965..288774) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(288872..290938) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene glyS CDS complement(290940..291821) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene glyQ CDS complement(292187..292942) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene recO CDS complement(293011..293154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(293242..294144) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene era CDS complement(294141..294536) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(294641..295048) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(295017..295499) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene ybeY CDS complement(295496..297673) product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene pgpH CDS complement(297776..298738) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(298742..299926) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene yqfD CDS complement(299942..300226) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene yqfC sequence04 source 1..284574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1315..2997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 3189..3551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 3661..4800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(4937..5773) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(5795..6616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(6636..7388) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(7402..8517) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(8688..9242) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(9495..9959) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(10357..10953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(11239..11403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(11482..11940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 12294..13199 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rbsK CDS complement(14048..15415) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(15408..16892) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(16962..17957) product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene degA CDS complement(18047..19900) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(19914..20681) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(20959..21471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(21626..22513) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene iolE CDS complement(22529..24448) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene iolD CDS complement(24474..25913) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(25934..26917) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene iolC CDS complement(26914..27753) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene iolB CDS complement(27767..28795) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene iolG CDS complement(29121..29618) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(29640..30044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(30737..31720) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(31738..32604) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(32601..34898) product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(34916..35530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(35527..36999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 note possible pseudo, frameshifted CDS complement(37080..37940) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(37944..38909) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(38909..41887) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(41966..43378) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(43964..45163) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(45336..45623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(46284..47999) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene cydC CDS complement(47996..49729) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene cydD CDS complement(49768..50781) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(50778..52136) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(53163..54461) product serine protease AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene aprX CDS 54636..55664 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 55657..56331 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(56425..57117) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(57102..58202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(58387..58914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(58982..59383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 59693..60559 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 61149..62213 product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(62256..63038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(63411..64253) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(64276..65001) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene queE CDS complement(64998..65474) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene queD CDS complement(65474..66136) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene queC CDS 66402..67934 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(68380..69372) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(69715..69996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 70547..71146 product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene yxaF CDS 71143..72609 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 72725..73888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(74019..75053) product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene gutB CDS 75193..75960 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(75996..76613) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(76870..77745) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(77761..78723) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(78753..80321) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(80415..82694) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 82846..83280 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 83327..83557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 83557..84180 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(84281..84448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(84426..84938) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 85024..85449 product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 85628..87151 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(87290..88660) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 88770..89096 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(89153..90019) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 90142..90675 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(90760..91800) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(92105..93157) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(93210..94541) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(95297..95695) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(95767..96501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(96574..97551) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(97791..98573) product BA2930 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene aacC CDS 98908..99951 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 99948..101153 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 101404..103062 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 103121..104818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 104811..105965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 106003..106959 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 106970..107851 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(107912..108427) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(108634..109242) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(110403..111692) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(112051..113217) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(113545..114543) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene pdxA CDS complement(114509..115810) product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(115821..116987) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(117015..117893) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene dapA CDS 118274..119926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(120845..122242) product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene tcyP CDS complement(122519..123091) product DUF4825 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(123233..124714) product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene bmr3 CDS complement(125023..126726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(127028..128743) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(129132..130202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(130480..131382) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(131385..132767) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(132774..133772) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(133890..134591) product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene nagR CDS complement(134702..135529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 135690..136574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 136596..138305 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 138280..139110 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 139128..139904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 140063..141055 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 141437..143509 product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene nrdJ CDS complement(143664..144155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(144800..144994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(145030..147444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 147668..148183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(148238..150310) product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene ganA CDS complement(151302..152324) product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene ganR CDS complement(152409..153068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(153118..153336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(153510..154400) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(154419..155309) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(155376..157082) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(157243..158646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(158624..160369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(160552..161010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(161059..161826) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 162008..162463 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 162460..163104 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 163114..163407 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(163779..164363) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 164674..164952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(165035..165454) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(165548..166525) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(166657..167670) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(167854..168012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(168435..168644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(168660..168818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(168965..169648) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 169752..170636 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(170824..171711) product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 171868..172629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(172664..173677) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(173848..174444) product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 174564..175418 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(175440..177794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(178646..179107) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(179357..179890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 180343..180690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(180828..181616) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(181646..182875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(182946..184034) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(184024..185073) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 185289..185810 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 185826..186629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(186844..187626) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 187937..188701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 188761..189993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(190367..190717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 190904..191557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 191649..192461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(192533..192721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 192872..193999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 194017..194844 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265959.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 194929..195183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 195341..195610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 195841..196497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 197008..197313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(197474..198127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(198410..199138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(199199..199678) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 199799..200593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(200671..201420) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(201523..201972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(202131..203126) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 203427..203975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 204255..204722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(204780..206315) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene garD CDS complement(206339..207694) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene gudD CDS complement(207805..209271) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(209322..210251) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene kdgD CDS complement(210425..211114) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 211349..212563 product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(212597..212764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 213040..214044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 214676..215344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 215688..216689 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 216686..217375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 217495..217854 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(217985..219163) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(219335..219712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 219688..219864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(220419..221069) product type A-8 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene catA CDS complement(221166..222314) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene dgoD CDS 222596..223801 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 224231..224452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(225033..226061) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124219794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(226495..227448) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 227842..228657 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 228756..229766 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 229772..230587 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(230610..231383) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(231810..233717) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(233752..234621) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(234643..236505) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 236768..237976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(238149..239045) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(239102..240514) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(240552..241418) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(241425..242159) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(242178..243275) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(243339..244673) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(244675..245358) product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(245386..246192) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(246223..247098) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(247117..248400) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(248742..249572) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(249569..250558) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(250633..252054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 252369..252746 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 252765..253043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 253216..253503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(253581..254564) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(254713..255207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(255167..256015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 note possible pseudo, frameshifted CDS complement(256025..256234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 256859..257140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 257202..258248 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 258336..259520 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(259910..260749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, frameshifted CDS complement(260758..261075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205008888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(261181..262521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(262534..263427) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(263449..264324) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(264445..265443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(265440..266282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(266307..267506) product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 267662..267796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 267815..268138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(268376..269578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(269595..270716) product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(271208..272428) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003157243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(272503..273066) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 273260..274144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 274048..274545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 274684..275223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(275533..275922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(276310..276519) product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(276832..277701) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(277822..278763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 279012..279536 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 279606..279998 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 280115..280369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(280421..281071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(281180..282409) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(282683..283729) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 283979..284452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 sequence05 source 1..272280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..777 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(789..1499) product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1902..2957 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 3103..3897 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 4109..4708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(4749..5582) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene dapA CDS complement(5632..6207) product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 6394..6738 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 6837..7148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 7264..7836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(7972..8157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 8413..8598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(8735..10384) product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene vmlR CDS complement(10736..11236) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 11456..12019 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 12158..13063 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 13380..14228 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 14249..15049 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 15131..15592 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 15653..16951 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 17481..17870 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(17946..18767) product RsbT co-antagonist RsbRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene rsbRB CDS complement(18960..19943) product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 20262..21323 product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 22023..22163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 22228..23106 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 23122..24003 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 24021..25292 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 25424..26476 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 27374..31552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(31683..31868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(32059..32877) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(32937..33551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(33548..34294) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene sirB CDS complement(34955..36148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 tRNA 36746..36820 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 36835..36919 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 36927..37001 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 37003..37075 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 37234..37698 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 38035..38598 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene sigW CDS 38616..39221 product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene rsiW CDS 39636..40457 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene cdaA CDS 40450..41766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 41859..43208 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene glmM CDS 43623..45425 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene glmS CDS complement(45748..46998) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(46995..47426) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(47429..47977) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(48273..49337) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 49507..49947 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 49999..50469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 50598..52082 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 52126..52794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(52775..53371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 53686..54096 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(54144..54593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 54893..55780 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 55800..56624 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223902.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 57120..58100 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 58097..58927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(59267..59461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(59480..59923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(60673..61095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 61271..62077 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(62120..63997) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 64132..65004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(65608..66159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 note possible pseudo, frameshifted CDS complement(66159..66581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 note possible pseudo, frameshifted CDS 66767..67174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 67432..68139 product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene azlC CDS 68147..68473 product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene azlD CDS 68850..70124 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(70224..71729) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene narK CDS complement(72053..72259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 72382..76065 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 76055..77527 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene narH CDS 77547..78077 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene narJ CDS 78099..78776 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003331448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene narI CDS 79070..80080 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene moaA CDS 80099..81100 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene thiF CDS 81157..82407 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene moeA CDS 82421..82894 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 82891..83127 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene moaD CDS 83132..83650 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene mobB CDS complement(83594..84316) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene fnr CDS 84418..84999 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 85002..85511 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 85504..86280 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene modA CDS 86258..86929 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene modB CDS 88048..89031 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 89097..89561 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 89601..89756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(89793..91019) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene hmpA CDS 91348..93990 product calcium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721406.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 94147..95055 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 95130..95534 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 95751..96413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 96516..96773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 97276..98883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 98989..99945 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 99942..100712 product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(100841..101191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(101678..102559) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 103390..104880 product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene msr(C) CDS complement(104950..106491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 106658..107671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 107705..108514 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 108548..109948 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene betC CDS complement(110178..110954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 111140..112039 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 112584..113615 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 113651..115045 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 115081..115989 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 116345..118321 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 118403..119401 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 119398..120540 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 120559..121587 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 121577..122596 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 122593..122973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 122966..123445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 123442..124263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 124424..124768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 124801..125622 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 125649..126299 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(126322..126843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(126824..127597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 note possible pseudo, frameshifted CDS 127721..128245 product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(128330..128767) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(128844..129725) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 129889..130287 product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 130469..130705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(130753..131424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(131540..132490) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(132487..133416) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 133605..134177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 134202..134423 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 134556..135137 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 135276..136514 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(136614..136889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 137052..138218 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(138321..138740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(138824..139984) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 140271..140420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 140377..140832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 note possible pseudo, frameshifted CDS 140864..141409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 141441..141749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 142021..142590 product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene phoE CDS 142694..143593 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene pyrB CDS complement(143787..144425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 144860..145297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 145276..145557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 145768..146562 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(146556..147509) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 147618..148451 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(148576..150237) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 150431..151291 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 151922..153841 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene thrS CDS 154311..154739 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 154893..155630 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 156736..157836 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 157814..158920 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 158926..159678 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 159671..160684 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 160723..161412 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164691160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 161438..162763 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene gntP CDS complement(162861..164807) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 164934..165776 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 166047..167495 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene cls CDS complement(167688..168602) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 169941..170849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 171382..176604 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 176756..177376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 177373..178596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 178749..179333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(179343..180035) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(180337..181767) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 181932..182783 product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 183633..184925 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 185243..186097 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 186094..186918 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 186934..188652 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 188667..190913 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 191070..192053 product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene ganR CDS complement(192130..192681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 192890..193420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(193428..193634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 193748..194365 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(194481..197546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(198036..198779) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(199072..199407) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 199569..199868 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 200380..202359 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(202517..203650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(203709..204368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(204540..205352) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 205477..206301 product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene hisJ CDS 206498..207223 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 207241..208185 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene glnH CDS 208333..208977 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 208991..209644 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(209961..210146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 210593..211453 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 211469..212986 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(213033..214730) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 215264..216418 product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene opuCA CDS 216432..217076 product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene opuCB CDS 217093..218022 product osmoprotectant ABC transporter substrate-binding lipoprotein OpuCC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene opuCC CDS 218024..218668 product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene opuCD CDS 218707..219276 product opuC operon transcriptional regulator OpcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene opcR CDS 219269..220147 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 220167..221126 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 221175..221648 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(221718..221942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 222098..222232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 222442..224073 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene abc-f CDS 224298..224828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(224832..225140) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 225237..226751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 227063..227611 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(228096..228923) product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 229107..230180 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene pdhA CDS 230838..231311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 231683..232465 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 232514..233425 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 233444..234667 product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rocD CDS 234664..236214 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene pruA CDS 236230..237840 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049528.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 238107..238307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(238537..239142) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(239139..240242) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(240324..241010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(241007..241732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(241732..242679) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(242927..243313) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(243313..244203) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene catE CDS 244329..244472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 244488..246287 product DUF3981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 246420..247337 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 247406..247930 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 248343..248483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 248662..249618 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene corA CDS complement(249699..249866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(249952..250794) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(250990..252327) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene brnQ CDS 252765..253724 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 253742..254641 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 254661..256301 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 256840..259566 product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(259590..259799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 260889..261827 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 261990..262574 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002005730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 262610..264118 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(264278..265261) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 265564..266853 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 267035..268309 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 268306..269211 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 269215..270084 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(271375..271854) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene bsaA CDS 272021..272206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 sequence06 source 1..222090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(624..3044) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene leuS assembly_gap 3152..3248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3973..4236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 4399..5373 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 5373..5933 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(6048..7130) product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(7156..7962) product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene ytpA CDS 8078..8590 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(8592..9446) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(9464..10075) product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004438834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(10362..11552) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene metK CDS complement(11705..12178) product antimutator 8-oxo-(dGTP/GTP)ase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene mutTA CDS complement(12199..12774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 12974..13837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(13958..14269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 14549..14707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(14901..16376) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(16395..17207) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene menB CDS complement(17171..18037) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene menH CDS complement(18043..19770) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene menD CDS complement(19767..21158) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 21498..22430 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 22576..22950 product 1,4-dihydroxy-2-naphthoyl-CoA thioesterase MenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene menI CDS 23010..23672 product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 23800..24846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(24902..25435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(25485..26114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(26362..26670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(26779..27849) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 28206..30866 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene ppc CDS complement(31025..31432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(32742..34802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(34960..35451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(35534..36307) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(36470..37846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(37950..38798) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(38864..39217) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene spoVAE CDS complement(39221..40234) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene spoVAD CDS complement(40231..40704) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene spoVAC CDS complement(40733..41182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(41380..41544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(41991..42353) product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(42363..43181) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 44214..46064 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 46282..47118 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 47145..47762 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 47897..48154 product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene spoVIF CDS 48343..48882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(49042..49692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 49831..50709 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene htpX assembly_gap 50885..50977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(51345..52289) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(52442..53284) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene dat CDS complement(53462..54787) product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene melA CDS 54914..55798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 55932..56957 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(57007..59760) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(59741..61549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(61559..62428) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(62425..63429) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(63431..65038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(65061..65918) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(65915..66844) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(66837..69191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 69733..69894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(69839..70705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(70698..72830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(73035..73487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(73560..73814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(74000..74584) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(74581..75414) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(75381..75833) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(76086..77000) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(77415..78680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 79073..79558 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987071.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 79655..80230 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 80383..80931 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(81101..82024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(82038..83672) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(83712..84593) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(84630..85604) product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene rmgP CDS complement(85808..88060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(88327..88689) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(88708..90549) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(90536..91303) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 91453..92160 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 92172..93545 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 93662..93868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(94071..94406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(94789..95145) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(95211..96041) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(96126..96833) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(98536..99957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 100410..101093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(101340..101957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 102327..103082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 103087..103686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(103767..104030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(104020..104811) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(104834..105487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(105873..106751) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447171.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(106761..108074) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(108196..109416) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(109856..110677) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 110953..111231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(111335..114202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(114354..117359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(118186..118395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(118415..121507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 tRNA complement(122664..122739) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(123036..123446) product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(123635..125896) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene metE CDS complement(126287..127636) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(127760..128923) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 129080..129310 product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(129396..130961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(130954..131514) product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene sigW CDS complement(131639..132844) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(132841..133335) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 133469..134338 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(134300..134965) product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049992.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rpiA CDS complement(135169..136503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(137205..137468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(137545..138213) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(138313..138573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(138630..139214) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(139219..139674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(139678..139929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 140068..141240 product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene patB CDS complement(141695..142843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(143219..143368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(143453..143989) product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene sodC CDS complement(144072..144278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 144393..144785 product kinase-associated lipoprotein KapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene kapB CDS complement(144867..145136) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 145377..146228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 147361..147966 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(148118..149596) product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene pepA CDS 149935..150420 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(150428..151123) product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene spsC CDS complement(151330..151647) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(151783..153000) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197317646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(153449..153805) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(154472..155338) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene dapF CDS complement(155458..155703) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 155926..156993 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(156990..157331) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 157437..157658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(157859..158785) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene thrB CDS complement(158782..159843) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene thrC CDS complement(159849..161144) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(161263..162177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 162316..162807 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(162811..163575) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(163572..164045) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 164134..164409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(164875..165150) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 165354..165986 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 166026..167015 product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene lytH CDS complement(167137..167910) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene yunB CDS complement(168070..168375) product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(168432..169829) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073806426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(169849..170703) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 170817..171104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(171201..172499) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809213.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pbuX CDS complement(172496..173086) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(174860..175306) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432567.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(175901..177298) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene sufB CDS complement(177432..177869) product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene sufU CDS complement(177856..179079) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene sufS CDS complement(179079..180386) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene sufD CDS complement(180405..181187) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene sufC CDS complement(181783..181926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(182140..182511) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(182679..183551) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene metQ CDS complement(183570..184238) product methionine ABC transporter permease MetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene metP CDS complement(184235..185263) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene metN CDS complement(185449..186732) product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(186855..187658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(187685..188431) product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene sigI CDS 188938..189156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(189239..189550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(189579..189923) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(190078..190320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(190405..190788) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene gcvH CDS complement(190867..191229) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 191321..191563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 191563..191886 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(192119..192811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(192883..193656) product oxalate:formate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 193859..194272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 194288..194995 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 195089..195928 product LiaRS two-component regulatory system accessory protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene liaF CDS 195930..196985 product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene liaS CDS 196991..197623 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(198051..198626) product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 198745..199413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(199407..200357) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(200403..201359) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene msrB CDS complement(201415..202131) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 202304..204025 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 204087..205685 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 repeat_region 206529..210343 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actggacctaccggactttc CDS 212277..212489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 212798..213571 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 213568..214329 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 214346..215332 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(215383..216510) product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene kdpDN CDS complement(216512..217102) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085543.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene kdpC CDS complement(217118..219178) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene kdpB CDS complement(219192..220874) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene kdpA CDS complement(221548..221904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 sequence07 source 1..199627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 689..943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 1065..1955 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene dprA CDS 2043..4118 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene topA CDS 4140..5447 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene trmFO CDS 5516..6430 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene xerC CDS 6451..6993 product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene clpQ CDS 7155..8558 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene hslU CDS 8580..9359 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene codY CDS 10087..10482 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene flgB CDS 10485..10928 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene flgC CDS 10947..11252 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene fliE CDS 11289..12884 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene fliF CDS 12900..13913 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene fliG CDS 13906..14682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 14645..15973 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene fliI CDS 15963..16412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 16415..16984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 17002..18282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 18293..19135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 19161..20564 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene flgE CDS 20598..20792 product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene swrD CDS 20808..21239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 21256..22254 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene fliM CDS 22247..23371 product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene fliY CDS 23390..23752 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene cheY CDS 23752..24381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 24378..25037 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene fliP CDS 25072..25341 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene fliQ CDS 25345..26124 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene fliR CDS 26121..27242 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene flhB CDS 27239..29281 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene flhA CDS 29278..30384 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene flhF CDS 30377..31270 product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene flhG CDS 31263..32372 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 32350..34389 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene cheA CDS 34404..34877 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 34879..35490 product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene cheC CDS 35487..35984 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene cheD CDS 36011..36805 product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene sigD CDS 36810..37343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 38858..39556 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rpsB CDS 39709..40593 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene tsf CDS 40730..41452 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene pyrH CDS 41455..42012 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene frr CDS complement(42135..42302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 42336..43118 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene uppS CDS 43135..43923 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene cdsA CDS 44272..45534 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene rseP CDS 45680..47374 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene proS CDS 47510..51811 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 52083..52556 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene rimP CDS 52576..53700 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene nusA CDS 53720..53983 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 53980..54285 product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 54299..56518 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene infB CDS 56687..57037 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rbfA CDS 57133..58032 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene truB CDS 58077..59036 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene ribF CDS 59166..59435 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rpsO CDS 59618..61741 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene pnp CDS complement(62140..62325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 62796..63809 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 63855..65063 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(65599..65982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 66215..66469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 66553..67455 product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene dpaA CDS 67457..68050 product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene dpaB CDS 68198..69250 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene asd CDS 69268..70515 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene dapG CDS 70552..71427 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene dapA CDS 71671..72426 product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene tepA CDS 72423..72638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 72746..75124 product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene spoIIIE CDS 75142..76452 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 76430..77725 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 77739..78461 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 78528..78791 product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 79004..79795 product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 79819..80754 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 80861..81439 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene pgsA CDS 81455..82684 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 82959..84005 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene recA CDS 85020..86594 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene rny CDS 86690..87487 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene ymdB CDS 87596..87856 product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene spoVS CDS 88174..89106 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 89623..91455 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 91452..93308 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 93537..95069 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene miaB CDS 95075..95512 product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 95814..96371 product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene cotE CDS 96717..99290 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene mutS CDS 99303..101135 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene mutL CDS 101161..102099 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene miaA CDS 102144..102386 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene hfq CDS complement(102512..103519) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 103661..104629 product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene spoVK CDS 104639..105868 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene hflX CDS 105882..107141 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 107239..107652 product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene glnR CDS 107724..109067 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene glnA CDS 109399..109551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(109687..110244) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(110286..110525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 110555..111337 product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene spo0M CDS complement(111560..112180) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene lexA CDS 112398..112709 product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene yneA CDS 112709..113383 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 113422..113652 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 113838..115847 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene tkt CDS 116130..116606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 116646..116861 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 116908..117333 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 117472..117954 product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(118068..118496) product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889373.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(118582..118821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 119719..122427 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene acnA CDS 123163..125412 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 125768..125911 product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene sspN CDS 126053..128263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 128276..128701 product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 128701..129021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(129044..129340) product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(129452..130216) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(130363..130533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(130900..131805) product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene gltC CDS 131998..136617 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene gltB CDS 136632..138116 product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene gltD CDS 138265..139263 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 139591..140706 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 140672..141565 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 141583..142392 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 142510..143838 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 144664..145998 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(146080..146664) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene plsY CDS 146919..148583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 149404..150459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 150456..152015 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 152021..152428 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 152598..152846 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 153143..153517 product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 153510..154190 product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene bshB2 CDS 154239..154598 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(155173..155415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 155609..156547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 156581..157657 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene murG CDS 157767..158930 product AimR family lysis-lysogeny pheromone receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 158979..159146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 159927..162773 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene sucA CDS 162800..164044 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene odhB CDS 164111..164491 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(164759..165124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(165160..166026) product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene sigJ CDS 166460..167194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 167295..167561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 167697..168065 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 168052..169092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140186737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(169214..170260) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104604.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene mtnA CDS complement(170257..171462) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene mtnK CDS 171826..173016 product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene mtnW CDS 172985..173668 product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene mtnX CDS 173665..174282 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 174286..174822 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene mtnD CDS 174896..176080 product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene sndC CDS complement(176221..177048) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(177166..177588) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(177616..178173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(178402..178965) product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene cdoA CDS 179151..179423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(179341..179568) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(179558..179923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 180419..180808 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263478.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 181065..181580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(181753..184353) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ppsA CDS 184604..185041 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 185201..185527 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 185532..185903 product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(186130..186990) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 187225..187803 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 188402..188887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 188889..190055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(190397..190939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(191171..192412) product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 192545..192715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 192737..193168 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(193381..194160) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(194918..195430) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 195799..196287 product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(196537..196962) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(197691..198557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(198638..199369) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 sequence08 source 1..192098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 1977..2282 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2287..2649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2754..3221 product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene mrgA CDS 3473..5092 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284049.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(5246..5470) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(5666..6598) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene cysK CDS 6701..7288 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene thpR CDS 7311..8228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 8475..9269 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(9240..9527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 9641..10312 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene trmB CDS 10383..10931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(10983..11312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 11452..12522 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(12596..13057) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 13224..13724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 13929..14951 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 15852..16682 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 16683..17294 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 17355..19601 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 19878..21200 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene murC CDS 21351..21785 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 21803..22195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 22211..22537 product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene ytxJ CDS 22699..23658 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(23689..25818) product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 26116..27195 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 27476..28477 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene ccpA CDS 28569..29393 product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene motP CDS 29380..30078 product flagellar motor protein MotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene motS CDS 30240..31967 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene acsA CDS complement(32265..32849) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 33004..35631 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene ppsA CDS 36220..39393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(39440..42325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 42943..44208 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene tyrS CDS 44509..45684 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 45853..46626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 46623..47510 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(47689..48291) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene rpsD CDS complement(48512..48997) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 49156..49773 product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene refZ CDS 50063..51769 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene ezrA CDS complement(52438..52644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 52985..54130 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 54127..55335 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene thiI CDS 55369..56976 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(56993..57802) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 58044..58607 product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 58600..59091 product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene ytfJ CDS 59201..59707 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene tpx CDS 59774..60736 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 60796..61986 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 63199..64398 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene argG CDS 64395..65768 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene argH CDS complement(65879..66721) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 66847..67926 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 67928..68731 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 69139..69390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 69404..70183 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 70203..70979 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054921.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 71313..71681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 71715..72827 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene ald CDS complement(72926..74017) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene pepQ CDS 74212..74730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 74764..75432 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 75621..76022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 76095..76670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 76707..77108 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 77195..78733 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 78790..79470 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 80388..80648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 80957..82270 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(82437..82721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 82804..83736 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene nrnA CDS complement(83738..84244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265736.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(84244..84567) product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene ytrH CDS 84698..87997 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene dnaE CDS 88288..89157 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene accD CDS 89154..90131 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene accA CDS 90220..91179 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene pfkA CDS 91211..92965 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene pyk CDS complement(93393..93680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 93874..94266 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene fxsA CDS complement(94432..95544) product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene ytvI CDS 95616..96080 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 96208..97323 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene citZ CDS 97364..98638 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene icd CDS 98711..99649 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene mdh CDS complement(99816..100259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(100349..100528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 100653..101363 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene phoP CDS 101360..103075 product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene phoR CDS 104101..106737 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene polA CDS 106866..107693 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene mutM CDS 107756..108373 product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene ytaF CDS 108392..108988 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene coaE CDS 109343..109729 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene speD CDS 109868..110266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 110610..110957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 111504..112913 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 112910..113848 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene dnaI CDS 114561..115427 product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene ytxC CDS 115735..117675 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene thrS CDS 118093..118761 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene infC CDS 118807..119007 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene rpmI CDS 119096..119452 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene rplT CDS 119823..120713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 121009..121284 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 121322..121906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(121916..122296) product sigma W pathway protein YsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229493.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene ysdB CDS 122443..123531 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(123663..123875) product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene sspI CDS 123979..124731 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 125171..126205 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene pheS CDS 126221..128632 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene pheT CDS 129471..129764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 129757..130296 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 130368..132068 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene polX CDS 132092..134449 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 134462..134869 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 135112..135426 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene trxA assembly_gap 135746..135844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 136035..137822 product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene uvrC CDS complement(137819..138259) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042224.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 138491..139105 product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene sdhC CDS 139135..140904 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene sdhA CDS 140901..141650 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291827.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene sdhB CDS 142101..142325 product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene gerE CDS 142481..142939 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 143058..143870 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774005.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene racE CDS 144062..145117 product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene gerM CDS 145372..146109 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 146106..146702 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 146721..147245 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 tRNA 147299..147369 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 147373..147449 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(147592..148704) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(148704..149120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(149134..149586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 149784..150029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 150007..150333 product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286573.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 150340..150501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 150488..150697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 150694..150849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 150861..151082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 151079..151282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 151279..151491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 151508..151747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 151740..152330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 152327..153511 product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 153534..154076 product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 154131..156089 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 156101..156271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 156278..156955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 156945..158033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 158030..158368 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 158368..158778 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 158775..159176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 159169..159444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 159441..159758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 159748..159957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 160039..160221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 160218..160403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 160396..160902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 161034..161240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 161265..163703 product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 164001..164276 product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 164296..165684 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 165668..166087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 166262..166666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 167070..167417 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 167399..167557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 167760..168257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 168254..169951 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 169964..170107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 170113..171390 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 171353..171988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 172022..173224 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 173224..173502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 173483..173809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 173806..174195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 174192..174542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 174543..175112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 175218..175643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 175640..176284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 176281..176505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 176524..176850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 177068..181636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 181641..182495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 182499..183584 product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 183581..184999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 184996..185319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 185306..185458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 185499..185813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 185829..187193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 187207..187488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(187654..188130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(188142..188435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(188448..188720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(188717..189094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 189253..189597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 189664..190269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 190269..190688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 191152..191652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 191666..191974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 sequence09 source 1..171369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(237..1133) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(1571..1801) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870223.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2014..2889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2941..3975) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(3956..5326) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(5360..6379) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene rfbB CDS complement(6380..7252) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene rfbD CDS complement(7239..7796) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene rfbC CDS complement(7820..8698) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene rfbA CDS complement(8770..10065) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(10152..11207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(11204..12220) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(12261..13109) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(13177..14082) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(14442..15341) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(15542..16639) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107244.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(16642..17538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(17570..18196) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(18379..20226) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071743885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(20260..21165) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene galU CDS complement(21560..22327) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(22429..23130) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207182.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(23111..23866) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 24540..24707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 25069..26220 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(26323..27186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(27224..27532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(27540..27842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(27966..28985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(28999..29538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(29805..29978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(30056..30433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(30604..31638) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 31875..32846 product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635759.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(33047..33220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(33224..34378) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(34861..35982) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461041.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(35964..37070) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene wecB CDS complement(37067..38188) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(38185..38856) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(38780..39406) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(39411..40748) product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene tuaD CDS complement(40755..41642) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene galU CDS complement(41667..42932) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(42947..44059) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(44056..45306) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(45303..46490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(46487..47656) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(47679..48995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(48992..50281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(50278..51621) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(51605..52648) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(52599..52916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(53033..54856) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071743885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(55065..55766) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207193.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(55756..56499) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393150.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 57145..57513 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 58796..59965 product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 59962..61104 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(61162..61605) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 61693..62073 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(62633..65737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(65882..66124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(66222..66884) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(67092..68579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(69599..70432) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(70506..70931) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene fabZ CDS complement(70956..71267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(71293..72117) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene flhP CDS complement(72132..72941) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene flhO CDS complement(72976..73977) product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene mbl CDS complement(74474..74752) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene spoIIID CDS complement(75158..75328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(75700..76338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(76521..76964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(76961..77173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 77418..78650 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 78647..78988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 79299..80384 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 80388..82040 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 82037..82741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(83051..83986) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 84125..84310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(84303..84896) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene pcp CDS complement(84921..86525) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(86559..87698) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(88099..89019) product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene spoIIQ CDS complement(89098..90159) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672623.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene spoIID CDS complement(90465..91799) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene murA CDS complement(91832..92557) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(92647..92880) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 93119..93640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(94432..94833) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene atpC CDS complement(94919..96328) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene atpD CDS complement(96366..97235) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene atpG CDS complement(97373..98890) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene atpA CDS complement(98911..99444) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene atpH CDS complement(99441..99959) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene atpF CDS complement(100130..100342) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene atpE CDS complement(100397..101140) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene atpB CDS complement(101147..101533) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(101913..104117) product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene vpr CDS complement(104597..104842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(105496..105987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 106119..106982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(107229..108377) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene wecB CDS complement(108398..109027) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene upp CDS complement(109166..110413) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene glyA CDS complement(110632..111174) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(111179..111709) product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene prpB CDS complement(112058..112612) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(113730..114788) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(114891..115313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(115428..116054) product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene spoIIR CDS complement(116144..117001) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene prmC CDS complement(116998..118068) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene prfA CDS 118258..119589 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(119797..120219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(120275..120856) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(120990..122282) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene rho CDS complement(122588..123874) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene murA CDS complement(124343..125206) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(125397..125759) product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene spo0F CDS 125992..126522 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242809.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(127435..129036) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene pyrG CDS complement(129238..129765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 130002..131201 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene cls CDS 131224..132186 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110499.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene uvsE CDS complement(132299..133969) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene argS CDS complement(133966..134403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 134628..135377 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(135525..140585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(140622..141497) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene speB CDS complement(141494..142333) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene speE CDS 142612..144645 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(145595..146107) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 146235..146417 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(146461..146973) product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(146980..148281) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(149587..149781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 150222..150392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 150527..151372 product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ywfL CDS complement(151435..152409) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene pta CDS 152653..153408 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 153766..154194 product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene cwlJ CDS 154215..154697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(154758..155252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 156544..157737 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene rodA CDS 157931..160390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(160751..161056) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(161231..161602) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 161794..162564 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene pxpB CDS 162542..163321 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene pxpA CDS 163318..164283 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(164261..164527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(164606..164908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 165006..165857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(166359..168257) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene asnB CDS 168405..168941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 168960..170474 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene crtI sequence10 source 1..150268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..763) product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089273.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(1103..1318) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(1315..1911) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene recR CDS complement(1939..2262) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(2275..3996) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene dnaX CDS complement(4466..4945) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene tadA CDS complement(5006..6649) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948850.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(7446..8207) product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene rhaR CDS complement(8221..9687) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(9684..10922) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene rhaI CDS complement(11010..13073) product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(13297..13554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(13634..13759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(13776..13943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 14311..15204 product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene cysL CDS complement(15277..15969) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene tenA CDS complement(16346..16645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(16726..17361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(17358..17900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(17897..18805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(18833..19357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(19618..20823) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(20823..21863) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(21878..23533) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 23702..24142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 24132..24551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 24544..26337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(26392..27207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(27257..28090) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 28575..34649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(34860..35210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 35514..36056 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 36122..37150 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 37143..38126 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 38143..39345 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 39372..41006 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 41123..42064 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 42081..42971 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 43018..43866 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(44275..45255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(45257..45796) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(46054..46197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 46416..46712 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 46791..46955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(46977..47147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 tRNA complement(47458..47532) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(47673..47942) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(47932..48207) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813972.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 48876..50942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(51504..52277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(52541..53617) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(53674..54495) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(54508..55674) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(55694..56842) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(56944..57756) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 57936..59120 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(59224..61704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(61810..63090) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(63123..65507) product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(65544..67583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(67559..69862) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(70126..71652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(71668..72537) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(72537..73502) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(74488..75720) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 tRNA complement(75885..75977) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(76028..77305) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene serS CDS complement(77639..78214) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene pdxT CDS complement(78233..79117) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene pdxS CDS complement(79205..80539) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene dacA CDS complement(81694..83157) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene guaB CDS 83299..84273 product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(84262..85332) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(86419..89019) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene gyrA CDS complement(89076..91004) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene gyrB CDS complement(91064..91345) product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene remB CDS complement(91355..92470) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene recF CDS complement(92484..92705) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene yaaA CDS complement(92829..93968) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212527.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene dnaN CDS complement(94268..95614) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene dnaA CDS 97148..97492 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene rnpA CDS 97820..98608 product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene spoIIIJ CDS 98605..99324 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 99513..100892 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene mnmE CDS 100928..102817 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene mnmG CDS 102836..103552 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene rsmG CDS 103616..104473 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene noc CDS 104669..105430 product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene soj CDS 105423..106268 product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene spo0J CDS 106348..107631 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(107619..108308) product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene yyaC CDS 108411..109427 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 109551..109760 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 109843..110943 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene ychF CDS 111065..111352 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene rpsF CDS 111371..111907 product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene ssbA CDS 111934..112161 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene rpsR CDS 112389..113282 product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814840.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 113304..115277 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 115274..115720 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene rplI CDS 115814..117181 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene dnaB CDS 117480..118772 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene purA tRNA 118899..118971 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 118984..119060 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 119328..119403 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 119426..119499 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 119944..120750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 120972..121538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 121531..122250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 122268..122921 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 123148..124629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 124899..125612 product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene walR CDS 125609..127459 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene walK CDS 127456..128778 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061593.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene yycH CDS 128765..129649 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 129646..130440 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 130528..131781 product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene htrC CDS 132561..133925 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 134247..134525 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 134607..134990 product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene glxB CDS 135236..135451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(135506..135991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 136151..136504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 136590..136946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(136982..137230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(137246..137893) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165965.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 138097..138837 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene map CDS 139428..139772 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(139791..141164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191848804.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 141332..141529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 142051..142812 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 142963..143142 product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002183021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 143212..143691 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene rlmH CDS 143956..145809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 146676..147560 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 147563..149281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 sequence11 source 1..148135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..3533 product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147180764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene hsdR CDS 3613..5040 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 5040..6566 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 7465..8346 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene ilvE CDS 8716..10434 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene ilvB CDS 10431..10955 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene ilvN CDS 10976..11968 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene ilvC CDS 11990..13531 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 13544..14641 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene leuB CDS 14661..16070 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene leuC CDS 16086..16670 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene leuD CDS 17112..18086 product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene ddcA CDS 18255..19541 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene tig CDS complement(19585..19791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 20231..21502 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene clpX CDS 21699..23357 product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene lonB CDS 23521..25851 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene lon CDS 25848..26435 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene yihA CDS complement(26478..26939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 27386..28747 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene hemA CDS 28772..29611 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 29681..30574 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene hemC CDS 30561..31301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 31326..32303 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087062.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene hemB CDS 32300..33583 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene hemL CDS complement(33667..34095) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 34313..34552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 34494..35600 product stage VI sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene spoVID CDS 35600..36640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 37179..37346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(37378..38664) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(38733..38921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 39308..41956 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene valS CDS 41953..43269 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 43287..44036 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 44140..45000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 45208..45795 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 45808..46494 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene radC CDS 46765..47808 product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene mreB CDS 47820..48692 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene mreC CDS 48695..49216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 49285..49953 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene minC CDS 49971..50768 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene minD CDS 51667..52368 product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene spoIVFA CDS complement(52455..52613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 52778..53251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 53248..54693 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 54841..55149 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene rplU CDS 55152..55493 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 55513..55803 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpmA CDS 55994..56515 product sporulation initiation phosphotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037006.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 56549..57829 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene obgE CDS 57854..58303 product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene thrR CDS 58768..59640 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene pheA CDS complement(59743..60282) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812272.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 60506..61852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 61845..62831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 63007..63621 product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene ruvA CDS 63624..64640 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene ruvB CDS 64624..64824 product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 64867..65910 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene queA CDS 65907..67046 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene tgt CDS 67112..67378 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene yajC CDS complement(67433..67807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 68026..69213 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 69506..70153 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(71055..72620) product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene spoVB CDS 72822..73094 product post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886981.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 73146..75410 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene secDF CDS 75498..75833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 75890..78208 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene recJ CDS 78205..78720 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 79329..81542 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene relA CDS 81563..82000 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene dtd CDS complement(82392..83741) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 84271..85548 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027084.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene hisS CDS 85545..87311 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene aspS CDS complement(88276..88911) product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(89005..90330) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 90555..91229 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 91174..91593 product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene cymR CDS 91836..92993 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 93012..94109 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene mnmA CDS 94200..94862 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066395.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 94922..97234 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 97398..97598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 97595..97750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 97956..99011 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793108.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 99283..101898 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene alaS CDS 101950..102219 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 102216..102668 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene ruvX CDS 102661..102948 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 103070..104218 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene mltG CDS 104258..104731 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene greA CDS 105547..107277 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 107446..108258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 108415..109107 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene mtnN CDS 109110..109571 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 109672..109908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(110236..110937) product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene sigK CDS complement(111135..111497) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene mnhG CDS complement(111490..111831) product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(111828..112304) product Na+/H+ antiporter Mnh1 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene mnhE1 CDS complement(112311..113804) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(113797..114135) product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(114138..116480) product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(116873..117013) product sporulation histidine kinase inhibitor Sda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 117478..117996 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 118000..119109 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene yqeH CDS 119124..119954 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812076.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene aroE CDS 119962..120258 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene yhbY CDS 120255..120827 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 120814..121389 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene yqeK CDS 121441..121815 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene rsfS CDS 121832..122572 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(123489..124310) product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene comER CDS 124633..125226 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 125219..127441 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(127744..127878) product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 128222..129214 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene holA CDS complement(129365..129631) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene rpsT CDS 129798..130895 product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene gpr CDS 130980..132146 product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene spoIIP CDS 132143..132472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 132533..134368 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene lepA CDS 134449..135597 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene hemW CDS 135711..136745 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene hrcA CDS 136766..137362 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene grpE CDS 137393..139240 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene dnaK CDS 139212..139379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 139372..140487 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene dnaJ CDS 140565..141503 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene prmA CDS 141506..142255 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 142277..143626 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene mtaB CDS 143652..144305 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene deoC CDS complement(144302..145213) product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 145435..145611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 145626..146072 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 146362..147348 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene floA CDS 147365..147736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 sequence12 source 1..134939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 1015..1770 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 1751..2443 product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene ptkA CDS 2981..4837 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071743885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 4854..5741 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097988.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene galU CDS 6168..7277 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 7274..8365 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 8398..9657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 9638..10612 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 10664..11602 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 11633..13054 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 13689..14849 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101303.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 14846..16228 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 16197..17246 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 17243..17857 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 17956..18585 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224137664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 18582..19739 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 20568..22313 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 22310..23815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 24103..24987 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 24980..25810 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 25839..27131 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(28060..28491) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721239.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(28478..28696) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 29162..29488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 29502..30062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 30288..30572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(30849..31577) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 31758..33404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 33476..34282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 35019..35567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 35719..36009 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 36379..36903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(37058..37735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 38013..38654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 38654..39577 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385397.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 39596..40483 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 40484..41497 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 41481..42470 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459112.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 42467..44005 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385396.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 44027..44449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 44654..50404 product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 50483..50875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(52005..52931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(52928..54217) product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene licC CDS complement(54242..55534) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 55684..56808 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 56844..58760 product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene licR CDS 58773..59165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 59162..59470 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 59754..60113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(60218..60787) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 60951..61871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 62216..63298 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166240.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 63552..63872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 64485..65450 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 65468..66352 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 66438..68060 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 68057..69514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(69790..70302) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 70981..71934 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 repeat_region 72281..74428 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactctacgtgagtgcgtggattgaaat CDS 75093..75554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 75666..76592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 76982..77947 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(78035..79387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 79580..79957 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(80040..81257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 81356..81835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 81842..82561 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(82576..83193) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(83218..84324) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(84331..85479) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(85800..86981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(87265..88131) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230919.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(88188..89054) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(89108..90547) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 90982..92433 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(92452..92844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(92848..93045) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(93273..94073) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene ssuB CDS complement(94046..94813) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene ssuC CDS complement(94833..95975) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene ssuD CDS complement(95980..96960) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(97544..98794) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 98986..99435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 99432..101156 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 101153..102979 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732630.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(103056..104183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 104337..104741 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 105010..106575 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 107042..108331 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 108419..109294 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 109310..110164 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 110199..111923 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 112041..113576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(114017..114574) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806318.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(114704..115135) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 115437..116498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(116687..120742) product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(121320..121685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(121756..122553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(123071..123961) product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene cesB CDS 124102..124287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 124479..125897 product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 126042..128066 product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene mtlR CDS 128071..128508 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 128505..129647 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 129883..130605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 note possible pseudo, frameshifted CDS 130568..131272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 note possible pseudo, frameshifted CDS 131316..132698 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 134340..134885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 sequence13 source 1..115704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1070..1210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(1444..1773) product DUF1093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714884.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(1794..3707) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(3704..4483) product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene bceA CDS complement(4638..5675) product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene bceS CDS complement(5686..6369) product response regulator transcription factor GraR/ApsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166501.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene graR CDS complement(6724..7278) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(7581..8642) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(8923..9321) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 9558..10688 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(10643..10837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(10940..12334) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 12504..13223 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 13275..13670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(13714..14148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(14145..14528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(14767..15585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(15605..16177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(16598..17260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 17402..18034 product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene hxlA CDS 18039..18599 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene hxlB CDS complement(18748..19464) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090110.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(19739..21283) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(21468..21884) product FosB family fosfomycin resistance bacillithiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene fosB CDS 21953..22804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(22796..23569) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(23683..25086) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(25341..26174) product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene pgoN CDS complement(26409..27128) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 27321..27863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 assembly_gap 28001..28098 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28401..29294) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(29390..29944) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 30409..30987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(31068..31394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 31727..32515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 32704..34296 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(34398..35072) product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(35069..37666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(37891..38712) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(38726..39658) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(39655..40950) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(41179..42228) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(42234..42827) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(43207..44436) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene ilvA CDS 44604..45392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 45426..45617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 45702..45875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 45955..47052 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene ddlA CDS complement(47105..48625) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(48964..50724) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(51734..52552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(52809..52940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(52973..54232) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(54225..55124) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(55251..55802) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 56119..56931 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene thiD CDS 57321..57866 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483964.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(57882..59003) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243312.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(58993..59691) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(59866..60642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(61013..61855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(61894..63240) product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene ykoH CDS complement(63237..63929) product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene ykoG CDS complement(64223..64534) product arsenical resistance operon transcriptional regulator ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026021.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene arsR CDS 64916..65458 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(65678..66286) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(66283..67260) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(67279..67701) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(67842..69353) product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene abfA CDS complement(69456..70442) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(70833..72188) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene aroA CDS complement(72295..73476) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(73478..73984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(74007..74432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(74425..74634) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(74921..75706) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene motB CDS complement(75693..76496) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene motA CDS complement(76786..77637) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene folD CDS complement(77845..79383) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(80140..80646) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(80664..81383) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene treR CDS complement(81398..83053) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene treC CDS complement(83143..84567) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene treP CDS complement(84616..85098) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473667.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 85377..86141 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene kdgR CDS complement(86487..86876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093141.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(86873..87082) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(87169..88047) product transcriptional regulator CitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233357.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene citR CDS 88164..89258 product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene citA CDS complement(89322..89510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 89803..90387 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443797.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 90619..91809 product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(92352..94298) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 94421..95242 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(95252..96094) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(96130..97746) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(97879..98802) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(98878..99210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 99661..101613 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023116.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene nagE CDS complement(101605..102111) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 102224..103240 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(103291..104094) product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(104175..105890) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene argS CDS complement(106354..107403) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene cax CDS complement(107491..107931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(108087..108503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(108695..109408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(109386..110396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(110412..111722) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(112135..112854) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 113508..114302 product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(114607..115524) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 sequence14 source 1..105124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 461..616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 891..1406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 1748..3358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 3548..4591 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 4545..4844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 4862..5119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(5260..6549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 6855..8057 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 8121..8339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 9102..9821 product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene mngR CDS 10503..12017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 12034..13140 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 13130..13813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 14025..15077 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821935.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 15074..17137 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene fhuB CDS complement(17174..17443) product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 17474..17770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 17902..18804 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733114.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(18915..19268) product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 20156..20356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 20338..20889 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene ssuE CDS 21227..21949 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 22168..23949 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(24578..25576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 26026..26580 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 26660..27469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 27770..28747 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 28766..29674 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 29684..31309 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 repeat_region 31714..33852 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactcctcgtgagtgcgtggattgaaat CDS 34042..34968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 35174..37588 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 38641..39354 product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene cas5c CDS 39355..41241 product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene cas8c CDS 41245..42096 product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene cas7c CDS 42086..42745 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene cas4 CDS 42742..43773 product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene cas1c CDS 43783..44073 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene cas2 repeat_region 44252..47249 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactccatgtgagtgcgtggattgaaat CDS complement(47617..47928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(48249..49661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(49758..50603) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(50620..51411) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(51693..52682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(52663..53145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(54416..55399) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(55858..56868) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene ccpA CDS 57010..57222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 57399..58760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 58853..60103 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(60175..61284) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(62256..62693) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(62694..63116) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 63278..64297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(64454..64756) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene mazF CDS complement(64790..65065) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 65439..66590 product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene mscY CDS 66923..70213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(70327..71175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(71430..72602) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(72617..73024) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227771.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 73241..73948 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 74094..75842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 75850..76809 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 76826..77698 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 77726..79333 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 79501..81783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(81999..82451) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 82724..83203 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 83235..84221 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 84298..85131 product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene pgoN CDS 85281..85694 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(85942..86154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 86494..88293 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393628.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(88355..88801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 89168..91672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 92291..92737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(92787..93995) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(94007..95200) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 95517..97340 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393628.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 assembly_gap 97674..97767 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 97905..98192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 98321..98599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 98630..99325 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 99338..99802 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540491.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 99802..100380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 100402..100620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(100960..102702) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 102996..104621 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 sequence15 source 1..101012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(325..1266) product accessory Sec system S-layer assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016716591.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(1277..3688) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene secA2 CDS 3817..5754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 assembly_gap 6229..6326 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6590..8299 product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847509.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 8344..9075 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 9075..10619 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034592.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 10701..11762 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 11937..13862 product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 13859..14929 product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene csaB CDS 15265..17181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 17525..17776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(17937..19016) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(19051..19683) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 20080..21231 product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene degS CDS 21286..21972 product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene degU CDS 22835..23692 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 24108..25157 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879430.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 25154..25831 product comF operon protein ComFC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene comFC CDS 25922..26338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 26351..26641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 26638..27084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 27097..28659 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene flgK CDS 28670..29551 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene flgL CDS 29631..30185 product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 30221..30673 product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene fliW CDS 30661..30882 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene csrA CDS 31084..33246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 33243..33530 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 33575..33997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 34009..34983 product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228021.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene hag CDS 35018..35458 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 35539..35874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 35890..37965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 38012..38458 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene fliS CDS 38458..38805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 39511..39708 product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene cspC CDS 40022..40588 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene raiA CDS 40765..43290 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene secA CDS 43427..44413 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene prfB CDS 45599..45985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 46280..46966 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene ftsE CDS 46956..47846 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene ftsX CDS 47940..49235 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726077.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 49380..50852 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 51029..52216 product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene minJ CDS 52386..53687 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 53700..54572 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 54562..55449 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 55901..57877 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene uvrB CDS 57883..60771 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene uvrA CDS 60889..62067 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 62094..62444 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 62612..63157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 64161..65102 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene hprK CDS 65154..65975 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene lgt CDS 65981..66934 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 66924..67559 product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene ppaX CDS 67645..68055 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 68264..68479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 68593..69768 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 69770..70408 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene hisG CDS 70405..71691 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene hisD CDS 71688..72278 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene hisB CDS 72280..72915 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene hisH CDS 72915..73652 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene hisA CDS 73649..74407 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene hisF CDS 74404..75027 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene hisIE CDS 75207..75416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 75697..77229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 77325..78284 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene trxB CDS 78546..79004 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 79083..79967 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene rapZ CDS 79968..80957 product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene mgfK CDS 81004..81954 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene whiA CDS 82102..82365 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(82458..83039) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene clpP tRNA 83594..83672 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 84020..84172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 84177..84533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 84772..84981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(85053..85262) product protein YvfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219905.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene yvfG CDS 85531..85917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 85930..86175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 86330..87358 product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene cggR CDS 87393..88400 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene gap CDS 88521..89702 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 89720..90481 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene tpiA CDS 90474..92018 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene gpmI CDS 92113..93399 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene eno CDS 94484..94717 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene secG CDS 94816..95562 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene estA CDS 95600..97951 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene rnr CDS 98018..98485 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene smpB tmRNA 98568..98927 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 99232..99456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(99439..99966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(99980..100432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 sequence16 source 1..89887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(202..279) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(295..368) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(408..484) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(523..610) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(638..712) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(719..794) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(831..904) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(912..1002) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1004..1078) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1220..1672) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(2043..4196) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426223.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(4323..4931) product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene rsbX CDS complement(4934..5725) product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721462.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene sigB CDS complement(5691..6176) product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970573.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene rsbW CDS complement(6173..6505) product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene rsbV CDS complement(6564..7574) product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene rsbU CDS complement(7590..7991) product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene rsbT CDS complement(7993..8349) product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene rsbS CDS complement(8346..9182) product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene rsbRA CDS complement(9471..9824) product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene ndoA CDS complement(9828..10100) product antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(10368..11549) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390600.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene alr CDS complement(11763..12737) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(12880..14394) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 14747..16348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 16350..16712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 16709..19942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 20049..20234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(20249..20605) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene acpS CDS 22300..22905 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091584771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(22991..24433) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(24426..24905) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(24939..25133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(25081..26568) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206587.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(27739..28593) product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene rsbRD CDS 29223..30620 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene cls CDS 30923..31219 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 31191..32027 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 32034..33035 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715551.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 33032..33790 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 34149..36383 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 36851..37897 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(37973..39334) product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene cssS CDS complement(39331..40020) product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene cssR CDS 40190..41542 product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene htrB CDS complement(41649..41807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(41873..42085) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene copZ CDS complement(42813..43007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(43135..43566) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene nsrR CDS 43765..44358 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(44970..45800) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262098.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene nadE CDS complement(45941..46942) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(47059..47640) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene clpP CDS complement(47672..48292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 48437..48649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(48586..49008) product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene ohrR CDS complement(49171..50892) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene ptsP CDS complement(51061..52917) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene ctaD CDS complement(52949..53710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(54412..55278) product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene coaW CDS complement(55527..56636) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975040.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(56741..58222) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(58223..58765) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243808.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(58897..59904) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(60017..60856) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(60853..61803) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(62642..63961) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(63900..64091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(64278..64988) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(65238..67289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(67610..68539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 68939..69736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(70036..70164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(70255..70443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(70717..72717) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(73295..74107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(74117..75751) product YndJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 75904..76641 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(76751..77908) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 78152..79360 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(79706..80470) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817566.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(80638..82092) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990069.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(82209..84491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(84754..86235) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(86635..88545) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(88650..89783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 sequence17 source 1..80935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..614 product splAB operon transcriptional regulator SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218644.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene splA CDS 611..1639 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene splB CDS complement(1993..2661) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(2674..3471) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(3588..4856) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(4857..5807) product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(5809..6795) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(6788..7810) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(7824..8708) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(8709..9671) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(9698..11302) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(11663..12652) product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene axeA CDS complement(12671..13807) product spore germination receptor protein GerAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968146.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene gerAC CDS complement(13804..14907) product spore germination receptor protein GerAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968145.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene gerAB CDS complement(14957..16408) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(16972..18852) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(19054..19587) product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(19711..20742) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(20739..21770) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(21869..23902) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059519.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 24117..25145 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(25398..26693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 assembly_gap 26948..27044 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27539..28906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 28899..32009 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 32041..32931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(33021..33317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 note possible pseudo, frameshifted CDS complement(33302..33646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 note possible pseudo, frameshifted CDS 33765..34679 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064761.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(34682..35113) product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene tnpA CDS complement(35240..35767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 35877..36239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(36286..36864) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720176.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(36858..37424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 37797..38591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 38709..39743 product staphyloferrin B ABC transporter substrate-binding protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene sirA CDS 39804..40817 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 40814..41860 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(42333..42884) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225731.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(42957..44678) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene cysI CDS complement(44709..46523) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 46749..47717 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287048.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 48235..49770 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 49792..50514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(50673..51185) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 51324..52154 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(52319..52567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(52642..53760) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(53839..54351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(54348..54686) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 54904..55224 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 55227..55616 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531186.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 55643..56350 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 56545..57144 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 57171..57833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776712.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 57919..58062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(58122..58544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(58618..59025) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 59122..59538 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282829.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(59535..60233) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(60211..61728) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(61744..62463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(62460..63239) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(63236..64195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(64504..65076) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350628.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 65191..65553 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965849.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(65540..66349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(66392..66943) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819859.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(67072..68265) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 68827..69204 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 69214..70410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(70658..71041) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(71038..71907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(71963..72844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941367.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(72916..73305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(73370..73747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(73796..74110) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(74107..74541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(74651..75181) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113538.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(75200..75814) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(75857..76495) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene tmk CDS 76966..77376 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(77428..77952) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(78033..78347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(78616..79371) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(79516..80439) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270539.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(80505..80762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 sequence18 source 1..80899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1260 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 1464..2999 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 3087..4601 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(4700..5710) product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene hemAT CDS complement(5880..6731) product aminoglycoside 6-adenylyltransferase AadK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene ant(6) CDS 6794..7474 product DUF3885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 7674..8048 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 8453..9373 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974548.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(9807..9995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(9985..11142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(11312..11989) product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(11994..12902) product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823951.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(12968..13117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(13335..13931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(13918..14754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(14764..15114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(15284..16678) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene rlmD CDS complement(16694..17569) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(17645..18442) product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene pdaA CDS 18899..20056 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156007.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene yfkAB CDS complement(20174..20971) product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 21174..21425 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene yidD CDS 21480..22394 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene folE2 CDS complement(22511..23053) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881042.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene dcd CDS complement(23128..23448) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637502.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(23506..23910) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(23903..24607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 24780..25979 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437720.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 26095..26529 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene zur CDS complement(26580..26963) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778831.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(26980..27858) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 28123..29289 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(29379..30164) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 30309..31487 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765511.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 31626..32072 product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene ykuV CDS complement(32150..32974) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(32990..33301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(33373..33768) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(33870..34880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(34881..35093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(35090..35629) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(35785..36411) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(36827..37249) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 37382..38002 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(38175..39410) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682331.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene arcA CDS complement(39654..40622) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(40975..41613) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(41727..42515) product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272242.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene ehuA CDS complement(42512..43219) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene ehuD CDS complement(43216..43872) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459281.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene ehuC CDS complement(43994..44866) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459280.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene ehuB CDS 45276..46175 product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 46504..47382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(47372..48670) product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904089.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(48844..49020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(49309..49959) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(49985..50827) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 assembly_gap 51812..51908 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(52237..53196) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(53270..53827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(53851..54813) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene galM CDS complement(55142..55540) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(55568..56464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(56501..57274) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(57293..58090) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene fabG CDS complement(58106..59266) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(59263..59595) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(59612..60442) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 60615..61619 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(61691..63778) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392265.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(63835..64377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(64635..66311) product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 66542..68860 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene yicI CDS complement(68914..69804) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(69836..70342) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654215.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 70607..72022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(72489..73520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989839.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(73517..74746) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988765.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(74743..75525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 75918..76625 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921912.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 76622..77731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 77759..80344 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610098.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(80398..80583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(80555..80707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence19 source 1..78887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..730) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(935..2056) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 2360..3217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 3335..6562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 7885..8559 product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene bdbD CDS 8552..8989 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(9095..10006) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050612.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 10151..11020 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 11031..11795 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene phnC CDS 11788..12585 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800868.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene phnE CDS 12597..13208 product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene phoE CDS complement(13569..13739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 13967..15217 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 15879..16679 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244562.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 16692..17582 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 17594..18163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(18259..18831) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 19256..19837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 19895..20923 product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 20917..21687 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 21729..22757 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 22939..24531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 24691..24873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 24863..25099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 25249..26577 product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 26574..29165 product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 29253..30149 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(30209..31318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(31318..32571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(32583..33515) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(33755..34387) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(34388..35185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 35665..36312 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 36450..37082 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064856.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 37235..38602 product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 38828..39175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(39436..39831) product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(39903..40223) product arsenical resistance operon transcriptional regulator ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene arsR CDS complement(40452..40802) product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 note possible pseudo, internal stop codon CDS complement(40838..42136) product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(42152..42496) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(42691..43869) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 44598..46340 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 46333..48147 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 48942..49901 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 50020..51768 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 51910..52203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(52215..52898) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 54219..54611 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 54614..55717 product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 55790..56761 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 56781..57269 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(57337..57783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 57812..57970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 58161..58697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 58886..61318 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 61429..61713 product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene csoR CDS 61810..62571 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 62787..64562 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 64547..65986 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 66106..67065 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 67070..67975 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 68010..69689 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 70227..71195 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 71192..72424 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831659.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 72421..74625 product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 74813..76351 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene guaA CDS 76679..77020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 77038..77853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 77876..78520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 sequence20 source 1..76763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(670..1758) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene serC CDS complement(1779..2210) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 2313..2951 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 2948..4060 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene menC CDS complement(4355..5134) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234892.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(5476..5841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 6071..8311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 8782..9768 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 9786..10688 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 10715..12292 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 12421..12816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 13094..13297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(13437..14249) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174260.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene pdxK CDS 14407..14544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 14599..16095 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802302.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 16110..17207 product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815826.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 17197..18261 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411355.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 18323..18766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 18681..19469 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(19687..19881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 20113..21363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 21472..22086 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243118.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(22314..22652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(23382..23519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(23576..24160) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 24691..25053 product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene ssbB CDS 25167..27506 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 27744..28475 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 28488..29459 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 30341..31291 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene manA CDS 31731..31892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 32045..32926 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene galU CDS 33286..34191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 34219..34377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 34758..37130 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041810227.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 37527..38180 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573662.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 38201..38479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(38623..40071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 40239..41126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 41126..42526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 42528..45752 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152945460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 45787..47532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 48271..50979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 51250..52236 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 52255..52884 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401129.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 53008..53961 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124128.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 54077..54544 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 54566..55060 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 note possible pseudo, frameshifted CDS complement(55683..56843) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 57139..57549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 57614..59374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(59404..60201) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776252.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 60284..60436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 61001..62179 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene nagA CDS 62182..62940 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene nagB CDS 62930..63658 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963513.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 63698..64036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 64033..64242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(64358..65329) product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635759.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 65652..65840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(65909..66646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 66963..69035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(69594..70040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 70544..74398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 74718..75992 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 sequence21 source 1..72572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..1467) product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(1514..2362) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722879.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(2325..3545) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 3899..4327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 4665..5207 product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239501.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 6013..6201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 6356..7267 product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene prsA CDS complement(7375..7605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(7665..8615) product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene yhaM CDS complement(8634..9200) product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene gbsR CDS complement(9507..9647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(10542..10973) product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene tnpA CDS 11654..12013 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(12149..12634) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288269.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(12693..13592) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene purU CDS complement(13607..15091) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(15173..16039) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(17180..17539) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(17610..18752) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195186.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 18901..20277 product YheC/YheD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658112.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 20295..20471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 21207..21434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 21653..22750 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene ugpC CDS complement(22974..23171) product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091640.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 23427..23642 product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene sasP CDS complement(23698..25098) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene fumC CDS complement(25435..25755) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(25769..26245) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene msrA CDS 26888..27727 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 27699..28391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 29406..29759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 29759..31045 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene ectB CDS 31221..31610 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810601.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(31874..33277) product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202693.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene spoVR CDS 33744..33986 product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(34039..35766) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(35793..37343) product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(37601..38464) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(38732..39178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 39312..39566 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638306.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 39768..41129 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(41741..43066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(43503..44666) product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene yhbH CDS complement(44856..46751) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(47151..47633) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene trmL CDS complement(47689..48549) product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260551.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(48781..51195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(51348..52037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(52151..53221) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(53661..54254) product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(54412..54915) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(54912..56060) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene queG CDS 56539..57453 product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene namA CDS complement(57942..58349) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(58792..61905) product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene lacZ CDS complement(62266..63087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(63101..64120) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260278.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(64117..65292) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215235.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 65402..67150 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404951.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 67774..68046 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182232.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 68039..68368 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 68369..69601 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000589.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 69588..70484 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225097.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(70645..71709) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene pepQ sequence22 source 1..69280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 159..264 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 345..1490 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 1517..2581 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene thiL CDS 2550..3002 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene tsaE CDS 2999..3679 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene tsaB CDS 3691..4146 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene rimI CDS 4143..5177 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene tsaD CDS 5352..6164 product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene lipM CDS 6176..7102 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene lipA CDS complement(7372..9321) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 9538..10188 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372699.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 10192..10458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 10471..11214 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene tatC CDS 12354..13880 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658863.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene ppx CDS 13957..16071 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(16676..16885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(16886..17605) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745322.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 17961..18245 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene groES CDS 18310..19947 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene groL CDS complement(20050..21243) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179343.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(21262..21975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(22049..22480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(22493..22960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 23112..23336 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393216.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 23349..23669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 23713..24369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 24366..24647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 24894..25184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 25287..25460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 25704..26654 product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 26654..27568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 27565..27741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 27738..28466 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386717.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 28477..29274 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 29452..29595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 29592..29936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 29926..30897 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 30912..31322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 31319..31567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 31554..32099 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644374.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene recU CDS 32080..32253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 32263..32706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399993.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 32700..32843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 32836..33039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 33017..33256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 33246..33536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 33594..33791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 33796..34554 product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 34622..35107 product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975413.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 35192..35323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 35323..35556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 35570..36070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 36187..36639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 36755..37000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 37061..37270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 37314..38057 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene terS CDS 38050..39360 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229917.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 39357..40910 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398894.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 40894..41793 product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398748.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 41860..43095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 43123..44319 product XkdF-like putative serine protease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229921.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 44351..45289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 45322..45666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 45672..46061 product DUF3199 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398566.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 46058..46411 product YqbH/XkdH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967053.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 46408..46920 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246050.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 46925..47377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229927.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 47374..47586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 47601..48917 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817303.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 48918..49364 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 49414..49827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 50049..50393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 50438..53242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 53254..53889 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398548.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 53886..54869 product phage-like element PBSX protein XkdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245730.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 54866..55198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 55195..55608 product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232671.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 55601..56638 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 56628..57182 product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047785.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 57185..57481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 57486..57995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 58013..59254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 59268..59609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 59596..59733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 59798..59935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 59998..60291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 60426..60821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 60827..62110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 62123..62413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(62468..62746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 62880..63548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 64047..65453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 65655..65834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 65827..66063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 66185..66523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 66516..67610 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(68755..69153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 sequence23 source 1..66708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 168..273 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 404..1117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 1254..1721 product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene ctsR CDS 1737..2279 product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene mcsA CDS 2282..3349 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 3376..5820 product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene clpC CDS 5957..7342 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene radA CDS 7343..8416 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392168.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene disA CDS 8616..9716 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 10488..11174 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene ispD CDS 11171..11650 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene ispF CDS 11709..13160 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene gltX CDS 13556..14203 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene cysE CDS 14200..15600 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152276.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene cysS CDS 15597..16007 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 16013..16759 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene rlmB CDS 16793..17272 product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene rae1 CDS 17343..17993 product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 assembly_gap 18112..18207 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18832..19017 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene secE CDS 19167..19700 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene nusG CDS 19827..20252 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene rplK CDS 20350..21045 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene rplA CDS 21266..21766 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene rplJ CDS 21803..22168 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene rplL CDS 22275..22880 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 23253..26789 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene rpoB CDS 26829..30452 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene rpoC CDS 30536..30784 product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 30907..31326 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene rpsL CDS 31379..31849 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene rpsG CDS 31892..33970 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene fusA CDS 34095..35282 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene tuf CDS 35841..36149 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040596.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene rpsJ CDS 36182..36811 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene rplC CDS 36838..37458 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene rplD CDS 37458..37745 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720948.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene rplW CDS 37768..38598 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene rplB CDS 38656..38937 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720946.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene rpsS CDS 38954..39295 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene rplV CDS 39299..39946 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene rpsC CDS 39950..40384 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene rplP CDS 40374..40577 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene rpmC CDS 40601..40864 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene rpsQ CDS 40903..41271 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene rplN CDS 41306..41617 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene rplX CDS 41640..42179 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene rplE CDS 42198..42383 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829713.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 42416..42814 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene rpsH CDS 42845..43384 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene rplF CDS 43415..43780 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene rplR CDS 43801..44304 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene rpsE CDS 44319..44501 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene rpmD CDS 44533..44973 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene rplO CDS 44973..46259 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene secY CDS 46302..46955 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 46952..47698 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene map CDS 47708..48007 product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 48023..48244 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene infA CDS 48408..48773 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene rpsM CDS 48790..49179 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene rpsK CDS 49352..50296 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene rpoA CDS 50329..50694 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene rplQ CDS 50807..51637 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711757.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 51613..52473 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 52470..53261 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 53263..54012 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene truA CDS 54173..54610 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene rplM CDS 54625..55017 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene rpsI CDS 55646..58342 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973965.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(58415..59011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(59436..59792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 assembly_gap 60043..60139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 60436..60849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 60901..61671 product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene cwlD CDS 61693..62745 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245068.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(62723..62947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(62838..63479) product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827295.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene gerD CDS 63729..64361 product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene kbaA assembly_gap 64867..64963 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(65290..66045) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene pdaB CDS 66232..66375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 sequence24 source 1..60517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1491..1994 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204933.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 2250..5474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(5534..6070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(6045..7259) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 7507..8964 product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene pnbA CDS complement(9086..9619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(9769..10200) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584245.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(10292..10813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(10908..11132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 11302..11469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(11478..11666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 12027..12308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 12346..12840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 note possible pseudo, internal stop codon CDS 12856..13128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 note possible pseudo, internal stop codon CDS 13438..14328 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(14403..14879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(14990..16318) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(16353..17114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(17111..17905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 note possible pseudo, frameshifted CDS complement(17892..18752) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(18752..19696) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(19697..21223) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469196.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(21457..22353) product macrolide 2'-phosphotransferase MphL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091345.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene mphL CDS complement(23016..23243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(23296..24399) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(24504..24752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(24980..25732) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 25920..26555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(26610..26990) product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 27604..28434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 28436..29080 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(29112..29327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(29586..31001) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798987.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(31078..31602) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene resA CDS complement(31599..32324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(32317..33138) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527105.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(33135..33758) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259401.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(33755..35056) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(35484..36020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(36017..36157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 36399..36803 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877650.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(37155..38678) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 38944..39111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 39198..39608 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287933.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(39711..40403) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886395.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(40381..41340) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221070.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(41382..42353) product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene ycbM CDS complement(42350..43048) product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene ycbL CDS complement(43309..43857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(43858..44988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 45596..46693 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 46686..47729 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459473.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 47885..48757 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 48757..49560 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814111.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(49707..50015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(51426..52703) product TIGR02679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075365474.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(52721..56857) product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(56854..58014) product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206095830.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(58014..59504) product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(59775..60146) product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene fra sequence25 source 1..55479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(352..1836) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene lysS CDS complement(1864..2865) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene dusB CDS complement(2862..3080) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(3032..3559) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene folK CDS complement(3556..3924) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene folB CDS complement(3917..4750) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene folP CDS complement(4764..5609) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene pabC CDS complement(5606..6211) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene pabA CDS complement(6238..7656) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene pabB CDS complement(7798..8742) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene cysK CDS complement(8969..9859) product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene hslO CDS complement(9980..10759) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(10934..12892) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene ftsH CDS complement(13021..13563) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene hpt CDS complement(13550..14956) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene tilS CDS complement(15063..16076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(16051..16797) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(16863..19331) product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene spoIIE CDS 19529..19738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 tRNA complement(19889..19963) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(19973..20049) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(21090..21563) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021452.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(21638..22021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(22033..22626) product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059767.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene yabQ CDS complement(22623..22925) product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene yabP CDS complement(22984..23241) product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(23238..24707) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene mazG CDS complement(24723..26240) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(26428..26961) product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene spoVT CDS complement(27150..30683) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene mfd CDS complement(30802..31029) product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene fin CDS complement(31084..31656) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene pth CDS complement(31783..32421) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(32520..33476) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(33501..34865) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene glmU CDS 35220..35879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(35943..36233) product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene spoVG CDS complement(36364..36519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(36913..37290) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(37287..38141) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene purR CDS complement(38260..39126) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene ispE CDS complement(39313..39498) product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene sspF CDS complement(39592..39861) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(40052..40939) product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene yabG CDS complement(41152..42036) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene rsmA CDS complement(42033..42599) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene rnmV CDS complement(42905..44140) product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(44359..45132) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(45434..47386) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene metG CDS 47812..48096 product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene abrB CDS complement(48156..49025) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene rsmI CDS complement(48973..49296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(49286..50020) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(50138..50482) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412063.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene yabA CDS complement(50496..51326) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(51331..52320) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene holB CDS complement(52342..52671) product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene darA CDS complement(52684..53319) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene tmk CDS complement(53371..54819) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(55003..55197) product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene csfB sequence26 source 1..42937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..1857 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833093.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 2565..3107 product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 3104..3304 product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166303.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 3644..4135 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene purE CDS 4132..5286 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene purK CDS 5283..6578 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene purB CDS 6617..7354 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242871.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 7354..7599 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene purS CDS 7605..8288 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene purQ CDS 8272..10494 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene purL CDS 10470..11879 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene purF CDS 11892..12926 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene purM CDS 12923..13498 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088589.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene purN CDS 13495..15033 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene purH CDS 15050..16339 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene purD CDS complement(17092..17397) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812346.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 17478..19223 product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517625.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 19380..20432 product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 20449..20763 product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 21195..21725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 22016..22552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390057.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 22682..23380 product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272099.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 23396..25597 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene pcrA CDS 25628..27640 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene ligA CDS 27657..28802 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 28904..29194 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene gatC CDS 29208..30671 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene gatA CDS 30668..32098 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047680.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene gatB CDS 32648..33562 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 33690..34076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 34305..35864 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 36006..37376 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene rlmD CDS complement(37501..37926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 38611..39360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 39651..40328 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 40393..40854 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 41138..42454 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene hisD CDS 42558..42848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 sequence27 source 1..34805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..2247) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(2240..3334) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035717.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(3331..4605) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205996.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(4598..7612) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(8182..8478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(8479..8667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 8813..9112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 9249..11951 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 11984..13270 product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989868.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 13468..14223 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 15302..16228 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862008.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 16203..16949 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966742.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 17244..19556 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 19743..19973 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 19970..20257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(20386..21447) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089043.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(21558..22331) product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene thiX CDS complement(22309..23781) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(23966..24550) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(24860..25435) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(25432..25758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(25733..26488) product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246374.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 26971..27612 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(27730..28383) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 28523..29584 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 29610..30803 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898638.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 30897..32042 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(32104..33600) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(34288..34488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 sequence28 source 1..31520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(784..1293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(1290..2435) product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(2454..3857) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(3877..4554) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(4663..6504) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715399.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(6501..7175) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041856.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(7221..7376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(7709..8083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(8469..9770) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623651.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(9968..10879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(11416..13188) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216179.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(13185..14234) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776773.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(14303..15400) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776774.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(15803..16009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(16216..16836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(17064..19025) product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene yagF CDS complement(19071..19970) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 20651..21316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 21391..22902 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene opuD CDS 23048..23374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 23507..24094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(24511..24978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(25012..25179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 25563..25973 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(26052..28307) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191201.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(28329..29204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 note possible pseudo, internal stop codon CDS complement(29427..29687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(30104..31363) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene ltrA sequence29 source 1..30270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 554..940 product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(1036..1482) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene perR CDS complement(1563..2129) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(2147..2623) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene bcp CDS 2803..4089 product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011863.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene hemL CDS complement(4242..4397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 4523..5584 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765787.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(5643..7394) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(7445..7966) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983693.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(8118..8330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(8421..9167) product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene fabL CDS 9273..9446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(9462..10220) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(10217..11323) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene mutY CDS 11622..12608 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 12813..12980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(13020..13328) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(13325..14137) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene recX CDS 14242..15135 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 15366..15899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 16283..17260 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989509.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 tRNA 17343..17419 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(17500..18438) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 18811..20148 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 20646..21188 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(21200..22177) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(22195..22896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 22877..23020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 23159..23521 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970656.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(23622..25082) product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(25191..26699) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene glpK CDS complement(26710..27678) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(27678..28526) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(28489..29955) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 sequence30 source 1..30090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 102..176 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 178..269 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 298..372 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 396..471 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 480..556 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 622..697 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 701..776 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 790..865 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 877..961 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 985..1058 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1075..1148 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 1158..1232 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1234..1308 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 1315..1388 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 1403..1487 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 1588..1676 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(2318..2731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 3318..3644 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 4054..4755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 note possible pseudo, internal stop codon CDS 5134..5568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 5791..6807 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 7153..8400 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793325.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 8694..10415 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 10412..11791 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636508.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 11953..13656 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 13917..14807 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 14823..15713 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(15976..16725) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene map CDS complement(16933..17565) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(17672..18148) product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208909.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene bstA CDS 18273..19175 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 19297..19857 product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394285.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene glpP CDS 19934..20797 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548260.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 21044..21862 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene glpF CDS 21885..23375 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759995.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene glpK CDS 23553..25238 product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672833.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene glpD CDS 25195..25386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 25518..26024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 26257..27210 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 27374..28195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 28208..28489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(28592..29866) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene rpoN sequence31 source 1..21883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 583..747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 823..1506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 1892..2584 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704944.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 2597..3454 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 3500..4852 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567745.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 4869..5126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 5278..6138 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 6365..6706 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461708.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 6706..7020 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461707.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 7110..7622 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540524.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 7813..8508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 8828..9007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 9428..10684 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941116.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 10702..11514 product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 11504..11989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 12138..13124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 13331..13663 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(13725..14132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 14384..14833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 14884..15129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(15195..15470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(15470..15784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 16068..16616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(16774..17781) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 17893..19290 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939363.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 19527..19838 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 19970..21151 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246471.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 sequence32 source 1..17168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 129..278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 265..726 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003261579.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(981..1253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 1393..2760 product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 2757..3362 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016125602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 3605..4597 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene rbsR CDS 4594..5511 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132846.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene rbsK CDS 5508..5903 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716140.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene rbsD CDS 5918..7420 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene rbsA CDS 7417..8355 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 8382..9326 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759000.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene rbsB CDS complement(9407..10276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(10294..10797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(10931..11221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 11517..11759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 12146..13027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(13051..13344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(13390..13671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(13963..15873) product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene ltaP CDS 16316..16636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 sequence33 source 1..15814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964969.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 770..1780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 1791..3149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 3146..3457 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(3668..4090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 4129..4329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 5345..5638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(5973..9350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 9440..10624 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818341.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene rpoD CDS 11870..12331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 12791..13453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 13844..14200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 14673..15221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 15314..15523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 sequence34 source 1..7134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..1199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 2436..2651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 2717..2998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 3012..3518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 3527..3736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 3828..4028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 4009..4341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 4354..4944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 5001..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 5156..5422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(5582..6319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(6628..6909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 sequence35 source 1..3993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 1056..2417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 2449..3582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 3696..3932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 sequence36 source 1..2538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..1630 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene istA CDS 1627..2382 product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene istB sequence37 source 1..2443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..806) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041219237.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene istB CDS complement(803..2332) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene istA sequence38 source 1..2396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..1623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(15..1569) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence40 source 1..1525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 143..250 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 266..340 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 348..420 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence41 source 1..1435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(606..1433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 sequence42 source 1..1018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(97..172) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(178..254) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(268..344) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(353..441) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(463..535) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(561..646) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(658..730) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(734..809) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(816..891) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence43 source 1..1014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460