>Feature sequence01 765 469 gene locus_tag LOCUS_00010 765 469 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_00010 998 765 gene locus_tag LOCUS_00020 998 765 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_00020 2504 3511 gene locus_tag LOCUS_00030 gene gap 2504 3511 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196721.1 protein_id gnl|my_center|LOCUS_00030 3513 4700 gene locus_tag LOCUS_00040 3513 4700 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422650.1 protein_id gnl|my_center|LOCUS_00040 4702 5451 gene locus_tag LOCUS_00050 gene tpiA 4702 5451 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232577.1 protein_id gnl|my_center|LOCUS_00050 5462 5803 gene locus_tag LOCUS_00060 gene secG 5462 5803 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931842.1 protein_id gnl|my_center|LOCUS_00060 5748 6434 gene locus_tag LOCUS_00070 5748 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968241.1 protein_id gnl|my_center|LOCUS_00070 6439 7599 gene locus_tag LOCUS_00080 6439 7599 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096813.1 protein_id gnl|my_center|LOCUS_00080 7596 8591 gene locus_tag LOCUS_00090 7596 8591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282348.1 protein_id gnl|my_center|LOCUS_00090 9655 8588 gene locus_tag LOCUS_00100 9655 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238488.1 protein_id gnl|my_center|LOCUS_00100 10923 9655 gene locus_tag LOCUS_00110 10923 9655 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492627.1 protein_id gnl|my_center|LOCUS_00110 12733 10958 gene locus_tag LOCUS_00120 gene argS 12733 10958 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662007.1 protein_id gnl|my_center|LOCUS_00120 12968 12738 gene locus_tag LOCUS_00130 12968 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13721 12975 gene locus_tag LOCUS_00140 gene recO 13721 12975 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016451.1 protein_id gnl|my_center|LOCUS_00140 14184 13711 gene locus_tag LOCUS_00150 14184 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16556 14184 gene locus_tag LOCUS_00160 16556 14184 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097924.1 protein_id gnl|my_center|LOCUS_00160 17566 16553 gene locus_tag LOCUS_00170 17566 16553 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351423.1 protein_id gnl|my_center|LOCUS_00170 19379 17574 gene locus_tag LOCUS_00180 gene aspS 19379 17574 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683521.1 protein_id gnl|my_center|LOCUS_00180 20673 19393 gene locus_tag LOCUS_00190 gene dnaB 20673 19393 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190299.1 protein_id gnl|my_center|LOCUS_00190 21198 20752 gene locus_tag LOCUS_00200 gene rplI 21198 20752 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263864.1 protein_id gnl|my_center|LOCUS_00200 21543 21208 gene locus_tag LOCUS_00210 21543 21208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21994 21554 gene locus_tag LOCUS_00220 gene ssb 21994 21554 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262509.1 protein_id gnl|my_center|LOCUS_00220 22262 21987 gene locus_tag LOCUS_00230 gene rpsF 22262 21987 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246923.1 protein_id gnl|my_center|LOCUS_00230 22351 23142 gene locus_tag LOCUS_00240 22351 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24257 23097 gene locus_tag LOCUS_00250 24257 23097 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983041.1 protein_id gnl|my_center|LOCUS_00250 25108 24299 gene locus_tag LOCUS_00260 25108 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669877.1 protein_id gnl|my_center|LOCUS_00260 27135 25105 gene locus_tag LOCUS_00270 27135 25105 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070604.1 protein_id gnl|my_center|LOCUS_00270 27173 28429 gene locus_tag LOCUS_00280 27173 28429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959059.1 protein_id gnl|my_center|LOCUS_00280 28407 29543 gene locus_tag LOCUS_00290 28407 29543 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037901.1 protein_id gnl|my_center|LOCUS_00290 29764 29979 gene locus_tag LOCUS_00300 29764 29979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29976 30518 gene locus_tag LOCUS_00310 29976 30518 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_00310 30895 32778 gene locus_tag LOCUS_00320 30895 32778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36887 32838 gene locus_tag LOCUS_00330 36887 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37398 38186 gene locus_tag LOCUS_00340 37398 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39169 38210 gene locus_tag LOCUS_00350 39169 38210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39761 39222 gene locus_tag LOCUS_00360 39761 39222 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_00360 40958 39861 gene locus_tag LOCUS_00370 gene ychF 40958 39861 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055665.1 protein_id gnl|my_center|LOCUS_00370 41546 41010 gene locus_tag LOCUS_00380 41546 41010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42232 41543 gene locus_tag LOCUS_00390 42232 41543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43115 42222 gene locus_tag LOCUS_00400 43115 42222 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809312.1 protein_id gnl|my_center|LOCUS_00400 43732 43112 gene locus_tag LOCUS_00410 43732 43112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 44826 43747 gene locus_tag LOCUS_00420 44826 43747 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935310.1 protein_id gnl|my_center|LOCUS_00420 45041 46267 gene locus_tag LOCUS_00430 45041 46267 CDS product lipoprotein LipL46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079033.1 protein_id gnl|my_center|LOCUS_00430 46358 48379 gene locus_tag LOCUS_00440 46358 48379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50232 48376 gene locus_tag LOCUS_00450 50232 48376 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106526748.1 protein_id gnl|my_center|LOCUS_00450 50767 50234 gene locus_tag LOCUS_00460 50767 50234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51598 50915 gene locus_tag LOCUS_00470 51598 50915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53702 51687 gene locus_tag LOCUS_00480 53702 51687 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116789.1 protein_id gnl|my_center|LOCUS_00480 54127 53735 gene locus_tag LOCUS_00490 54127 53735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54715 54176 gene locus_tag LOCUS_00500 54715 54176 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687996.1 protein_id gnl|my_center|LOCUS_00500 54901 56757 gene locus_tag LOCUS_00510 54901 56757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_00510 56805 57314 gene locus_tag LOCUS_00520 56805 57314 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 protein_id gnl|my_center|LOCUS_00520 58133 57345 gene locus_tag LOCUS_00530 58133 57345 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_00530 58699 58151 gene locus_tag LOCUS_00540 58699 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59705 58917 gene locus_tag LOCUS_00550 59705 58917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 63054 60067 gene locus_tag LOCUS_00560 63054 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64045 63203 gene locus_tag LOCUS_00570 64045 63203 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586168.1 protein_id gnl|my_center|LOCUS_00570 65089 64244 gene locus_tag LOCUS_00580 65089 64244 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586163.1 protein_id gnl|my_center|LOCUS_00580 66226 67482 gene locus_tag LOCUS_00590 66226 67482 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_00590 68122 67520 gene locus_tag LOCUS_00600 68122 67520 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_00600 69081 68152 gene locus_tag LOCUS_00610 69081 68152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 69506 70354 gene locus_tag LOCUS_00620 69506 70354 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 protein_id gnl|my_center|LOCUS_00620 70396 71031 gene locus_tag LOCUS_00630 70396 71031 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_00630 71732 71028 gene locus_tag LOCUS_00640 71732 71028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74410 71732 gene locus_tag LOCUS_00650 74410 71732 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666317.1 protein_id gnl|my_center|LOCUS_00650 74603 75013 gene locus_tag LOCUS_00660 74603 75013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689175.1 protein_id gnl|my_center|LOCUS_00660 74988 75362 gene locus_tag LOCUS_00670 74988 75362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76551 75343 gene locus_tag LOCUS_00680 76551 75343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 77158 76535 gene locus_tag LOCUS_00690 77158 76535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_00690 78252 77368 gene locus_tag LOCUS_00700 78252 77368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78548 78339 gene locus_tag LOCUS_00710 78548 78339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 78777 80939 gene locus_tag LOCUS_00720 78777 80939 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_00720 80949 82730 gene locus_tag LOCUS_00730 80949 82730 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_00730 82887 83327 gene locus_tag LOCUS_00740 82887 83327 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_00740 86683 83366 gene locus_tag LOCUS_00750 gene carB 86683 83366 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137995.1 protein_id gnl|my_center|LOCUS_00750 88990 86717 gene locus_tag LOCUS_00760 88990 86717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 94656 89023 gene locus_tag LOCUS_00770 94656 89023 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015947.1 protein_id gnl|my_center|LOCUS_00770 95529 94708 gene locus_tag LOCUS_00780 95529 94708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575342.1 protein_id gnl|my_center|LOCUS_00780 96569 95532 gene locus_tag LOCUS_00790 96569 95532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081726.1 protein_id gnl|my_center|LOCUS_00790 98144 96678 gene locus_tag LOCUS_00800 98144 96678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016318.1 protein_id gnl|my_center|LOCUS_00800 98238 98510 gene locus_tag LOCUS_00810 98238 98510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 99213 98524 gene locus_tag LOCUS_00820 99213 98524 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656570.1 protein_id gnl|my_center|LOCUS_00820 100013 99210 gene locus_tag LOCUS_00830 100013 99210 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374062.1 protein_id gnl|my_center|LOCUS_00830 101532 100006 gene locus_tag LOCUS_00840 gene guaB 101532 100006 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070955.1 protein_id gnl|my_center|LOCUS_00840 101630 102781 gene locus_tag LOCUS_00850 101630 102781 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447930.1 protein_id gnl|my_center|LOCUS_00850 104711 102789 gene locus_tag LOCUS_00860 104711 102789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 106049 104766 gene locus_tag LOCUS_00870 106049 104766 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 protein_id gnl|my_center|LOCUS_00870 106271 108238 gene locus_tag LOCUS_00880 106271 108238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 108235 109371 gene locus_tag LOCUS_00890 108235 109371 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728671.1 protein_id gnl|my_center|LOCUS_00890 109465 110946 gene locus_tag LOCUS_00900 109465 110946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934691.1 protein_id gnl|my_center|LOCUS_00900 111177 110998 gene locus_tag LOCUS_00910 111177 110998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 111255 111848 gene locus_tag LOCUS_00920 gene tmk 111255 111848 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791380.1 protein_id gnl|my_center|LOCUS_00920 112756 111845 gene locus_tag LOCUS_00930 112756 111845 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_00930 113617 112778 gene locus_tag LOCUS_00940 113617 112778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 114323 113610 gene locus_tag LOCUS_00950 114323 113610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 115230 114301 gene locus_tag LOCUS_00960 115230 114301 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_00960 116576 115245 gene locus_tag LOCUS_00970 116576 115245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 117353 116598 gene locus_tag LOCUS_00980 117353 116598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 117538 118116 gene locus_tag LOCUS_00990 117538 118116 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_00990 118283 119050 gene locus_tag LOCUS_01000 118283 119050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 120225 119098 gene locus_tag LOCUS_01010 120225 119098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121401 120313 gene locus_tag LOCUS_01020 121401 120313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 122395 121418 gene locus_tag LOCUS_01030 122395 121418 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_01030 124285 122528 gene locus_tag LOCUS_01040 124285 122528 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572082.1 protein_id gnl|my_center|LOCUS_01040 125972 124440 gene locus_tag LOCUS_01050 125972 124440 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_01050 126153 126599 gene locus_tag LOCUS_01060 126153 126599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 126599 127114 gene locus_tag LOCUS_01070 126599 127114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 128675 127104 gene locus_tag LOCUS_01080 128675 127104 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984000.1 protein_id gnl|my_center|LOCUS_01080 130233 128740 gene locus_tag LOCUS_01090 130233 128740 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052446.1 protein_id gnl|my_center|LOCUS_01090 132109 130247 gene locus_tag LOCUS_01100 132109 130247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810425.1 protein_id gnl|my_center|LOCUS_01100 132950 132270 gene locus_tag LOCUS_01110 132950 132270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669416.1 protein_id gnl|my_center|LOCUS_01110 134225 132960 gene locus_tag LOCUS_01120 134225 132960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488656.1 protein_id gnl|my_center|LOCUS_01120 134392 134760 gene locus_tag LOCUS_01130 134392 134760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 134769 135287 gene locus_tag LOCUS_01140 134769 135287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 135702 137018 gene locus_tag LOCUS_01150 135702 137018 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049558.1 protein_id gnl|my_center|LOCUS_01150 137028 138509 gene locus_tag LOCUS_01160 137028 138509 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_01160 138506 139660 gene locus_tag LOCUS_01170 138506 139660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 139647 140948 gene locus_tag LOCUS_01180 139647 140948 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_01180 140945 143359 gene locus_tag LOCUS_01190 140945 143359 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983065.1 protein_id gnl|my_center|LOCUS_01190 143978 143400 gene locus_tag LOCUS_01200 143978 143400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 145155 144076 gene locus_tag LOCUS_01210 145155 144076 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_01210 145990 145157 gene locus_tag LOCUS_01220 145990 145157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 146689 146294 gene locus_tag LOCUS_01230 146689 146294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 146968 147918 gene locus_tag LOCUS_01240 146968 147918 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526565.1 protein_id gnl|my_center|LOCUS_01240 148007 148528 gene locus_tag LOCUS_01250 148007 148528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence02 >Feature sequence03 >Feature sequence04 758 201 gene locus_tag LOCUS_01260 758 201 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680200.1 protein_id gnl|my_center|LOCUS_01260 1643 870 gene locus_tag LOCUS_01270 1643 870 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_01270 2449 1721 gene locus_tag LOCUS_01280 2449 1721 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487065.1 protein_id gnl|my_center|LOCUS_01280 2448 3461 gene locus_tag LOCUS_01290 2448 3461 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409996.1 protein_id gnl|my_center|LOCUS_01290 3462 5471 gene locus_tag LOCUS_01300 gene ligA 3462 5471 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124831.1 protein_id gnl|my_center|LOCUS_01300 6107 5502 gene locus_tag LOCUS_01310 6107 5502 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821257.1 protein_id gnl|my_center|LOCUS_01310 6329 8011 gene locus_tag LOCUS_01320 6329 8011 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_01320 8757 8017 gene locus_tag LOCUS_01330 gene kdsB 8757 8017 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721859.1 protein_id gnl|my_center|LOCUS_01330 9293 8766 gene locus_tag LOCUS_01340 9293 8766 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501992.1 protein_id gnl|my_center|LOCUS_01340 10123 9293 gene locus_tag LOCUS_01350 gene motB 10123 9293 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129914.1 protein_id gnl|my_center|LOCUS_01350 10915 10133 gene locus_tag LOCUS_01360 10915 10133 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345490.1 protein_id gnl|my_center|LOCUS_01360 11140 10925 gene locus_tag LOCUS_01370 11140 10925 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601827.1 protein_id gnl|my_center|LOCUS_01370 12240 11161 gene locus_tag LOCUS_01380 12240 11161 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861276.1 protein_id gnl|my_center|LOCUS_01380 13043 12240 gene locus_tag LOCUS_01390 13043 12240 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054065.1 protein_id gnl|my_center|LOCUS_01390 13089 14087 gene locus_tag LOCUS_01400 13089 14087 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_01400 14084 14641 gene locus_tag LOCUS_01410 14084 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 14644 14940 gene locus_tag LOCUS_01420 14644 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14943 15425 gene locus_tag LOCUS_01430 14943 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801153.1 protein_id gnl|my_center|LOCUS_01430 16385 15441 gene locus_tag LOCUS_01440 16385 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 16348 17712 gene locus_tag LOCUS_01450 16348 17712 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181768.1 protein_id gnl|my_center|LOCUS_01450 17782 18780 gene locus_tag LOCUS_01460 17782 18780 CDS product putative peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083687.1 protein_id gnl|my_center|LOCUS_01460 18783 20333 gene locus_tag LOCUS_01470 18783 20333 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671644.1 protein_id gnl|my_center|LOCUS_01470 20251 21879 gene locus_tag LOCUS_01480 20251 21879 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014595.1 protein_id gnl|my_center|LOCUS_01480 22011 22910 gene locus_tag LOCUS_01490 22011 22910 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821096.1 protein_id gnl|my_center|LOCUS_01490 23578 22907 gene locus_tag LOCUS_01500 23578 22907 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405493.1 protein_id gnl|my_center|LOCUS_01500 24988 23591 gene locus_tag LOCUS_01510 24988 23591 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_01510 25284 25003 gene locus_tag LOCUS_01520 25284 25003 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_01520 25483 25932 gene locus_tag LOCUS_01530 25483 25932 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_01530 25991 26638 gene locus_tag LOCUS_01540 25991 26638 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 protein_id gnl|my_center|LOCUS_01540 26657 27133 gene locus_tag LOCUS_01550 26657 27133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 27229 28005 gene locus_tag LOCUS_01560 gene ygiD 27229 28005 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_01560 28952 28074 gene locus_tag LOCUS_01570 28952 28074 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410044.1 protein_id gnl|my_center|LOCUS_01570 29036 30751 gene locus_tag LOCUS_01580 29036 30751 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199929.1 protein_id gnl|my_center|LOCUS_01580 30856 31656 gene locus_tag LOCUS_01590 30856 31656 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_01590 31656 32561 gene locus_tag LOCUS_01600 31656 32561 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_01600 32575 33012 gene locus_tag LOCUS_01610 32575 33012 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053574.1 protein_id gnl|my_center|LOCUS_01610 35447 33027 gene locus_tag LOCUS_01620 35447 33027 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391162.1 protein_id gnl|my_center|LOCUS_01620 35671 35465 gene locus_tag LOCUS_01630 35671 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 35763 37142 gene locus_tag LOCUS_01640 35763 37142 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 protein_id gnl|my_center|LOCUS_01640 37431 38810 gene locus_tag LOCUS_01650 37431 38810 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827961.1 protein_id gnl|my_center|LOCUS_01650 38866 39432 gene locus_tag LOCUS_01660 38866 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 39446 40252 gene locus_tag LOCUS_01670 39446 40252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 40768 40313 gene locus_tag LOCUS_01680 40768 40313 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_01680 42730 40772 gene locus_tag LOCUS_01690 gene ftsH 42730 40772 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038998.1 protein_id gnl|my_center|LOCUS_01690 43323 42760 gene locus_tag LOCUS_01700 gene pth 43323 42760 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767698.1 protein_id gnl|my_center|LOCUS_01700 43974 43339 gene locus_tag LOCUS_01710 43974 43339 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081487.1 protein_id gnl|my_center|LOCUS_01710 44933 43992 gene locus_tag LOCUS_01720 44933 43992 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012708.1 protein_id gnl|my_center|LOCUS_01720 45691 44930 gene locus_tag LOCUS_01730 45691 44930 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805357.1 protein_id gnl|my_center|LOCUS_01730 45793 45718 gene locus_tag LOCUS_t00010 45793 45718 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46706 45798 gene locus_tag LOCUS_01740 46706 45798 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625236.1 protein_id gnl|my_center|LOCUS_01740 47684 46722 gene locus_tag LOCUS_01750 47684 46722 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049176.1 protein_id gnl|my_center|LOCUS_01750 48858 47686 gene locus_tag LOCUS_01760 48858 47686 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951973.1 protein_id gnl|my_center|LOCUS_01760 50337 48943 gene locus_tag LOCUS_01770 50337 48943 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328039.1 protein_id gnl|my_center|LOCUS_01770 50695 50246 gene locus_tag LOCUS_01780 50695 50246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 51213 51551 gene locus_tag LOCUS_01790 51213 51551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 52411 51548 gene locus_tag LOCUS_01800 52411 51548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 53738 52308 gene locus_tag LOCUS_01810 53738 52308 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_01810 54443 53862 gene locus_tag LOCUS_01820 54443 53862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 54931 54470 gene locus_tag LOCUS_01830 54931 54470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 56214 54928 gene locus_tag LOCUS_01840 56214 54928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 56844 56653 gene locus_tag LOCUS_01850 56844 56653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 56909 59599 gene locus_tag LOCUS_01860 56909 59599 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744010.1 protein_id gnl|my_center|LOCUS_01860 59589 60869 gene locus_tag LOCUS_01870 gene purD 59589 60869 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197375.1 protein_id gnl|my_center|LOCUS_01870 60869 61708 gene locus_tag LOCUS_01880 60869 61708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116208.1 protein_id gnl|my_center|LOCUS_01880 61764 62891 gene locus_tag LOCUS_01890 gene prfB 61764 62891 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453255.1 protein_id gnl|my_center|LOCUS_01890 62892 64400 gene locus_tag LOCUS_01900 62892 64400 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_01900 64472 65530 gene locus_tag LOCUS_01910 64472 65530 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074459.1 protein_id gnl|my_center|LOCUS_01910 67386 65527 gene locus_tag LOCUS_01920 67386 65527 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223809840.1 protein_id gnl|my_center|LOCUS_01920 69209 67398 gene locus_tag LOCUS_01930 69209 67398 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088499.1 protein_id gnl|my_center|LOCUS_01930 69811 69212 gene locus_tag LOCUS_01940 gene lepB 69811 69212 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122814.1 protein_id gnl|my_center|LOCUS_01940 69907 71259 gene locus_tag LOCUS_01950 gene thrC 69907 71259 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626010.1 protein_id gnl|my_center|LOCUS_01950 71316 72020 gene locus_tag LOCUS_01960 71316 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389276.1 protein_id gnl|my_center|LOCUS_01960 72020 73162 gene locus_tag LOCUS_01970 72020 73162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433741.1 protein_id gnl|my_center|LOCUS_01970 75644 73152 gene locus_tag LOCUS_01980 gene leuS 75644 73152 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_01980 75675 75890 gene locus_tag LOCUS_01990 75675 75890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 76309 77031 gene locus_tag LOCUS_02000 76309 77031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942282.1 protein_id gnl|my_center|LOCUS_02000 77028 79565 gene locus_tag LOCUS_02010 77028 79565 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669548.1 protein_id gnl|my_center|LOCUS_02010 80521 79625 gene locus_tag LOCUS_02020 80521 79625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867010.1 protein_id gnl|my_center|LOCUS_02020 81013 81624 gene locus_tag LOCUS_02030 81013 81624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 81626 82099 gene locus_tag LOCUS_02040 gene folK 81626 82099 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806222.1 protein_id gnl|my_center|LOCUS_02040 82074 82877 gene locus_tag LOCUS_02050 gene panB 82074 82877 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789319.1 protein_id gnl|my_center|LOCUS_02050 83986 82934 gene locus_tag LOCUS_02060 gene aroG 83986 82934 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_02060 84356 84006 gene locus_tag LOCUS_02070 84356 84006 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187969.1 protein_id gnl|my_center|LOCUS_02070 86152 84353 gene locus_tag LOCUS_02080 86152 84353 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481723.1 protein_id gnl|my_center|LOCUS_02080 86503 86342 gene locus_tag LOCUS_02090 86503 86342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288293.1 protein_id gnl|my_center|LOCUS_02090 86705 87559 gene locus_tag LOCUS_02100 86705 87559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 88004 87588 gene locus_tag LOCUS_02110 88004 87588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 88295 88735 gene locus_tag LOCUS_02120 88295 88735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 88746 89300 gene locus_tag LOCUS_02130 88746 89300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 89311 90213 gene locus_tag LOCUS_02140 89311 90213 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172821.1 protein_id gnl|my_center|LOCUS_02140 91417 90224 gene locus_tag LOCUS_02150 91417 90224 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022250.1 protein_id gnl|my_center|LOCUS_02150 91463 92116 gene locus_tag LOCUS_02160 91463 92116 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 protein_id gnl|my_center|LOCUS_02160 92348 92875 gene locus_tag LOCUS_02170 92348 92875 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674089.1 protein_id gnl|my_center|LOCUS_02170 92997 93776 gene locus_tag LOCUS_02180 92997 93776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 93980 96949 gene locus_tag LOCUS_02190 93980 96949 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_02190 98065 96932 gene locus_tag LOCUS_02200 98065 96932 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_02200 99155 98121 gene locus_tag LOCUS_02210 99155 98121 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_02210 99290 101029 gene locus_tag LOCUS_02220 99290 101029 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_02220 101026 101949 gene locus_tag LOCUS_02230 101026 101949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 103566 101953 gene locus_tag LOCUS_02240 103566 101953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 103884 103654 gene locus_tag LOCUS_02250 103884 103654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 105351 103966 gene locus_tag LOCUS_02260 gene mnmE 105351 103966 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000163.1 protein_id gnl|my_center|LOCUS_02260 106066 105344 gene locus_tag LOCUS_02270 106066 105344 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_02270 108046 106091 gene locus_tag LOCUS_02280 gene yidC 108046 106091 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390191.1 protein_id gnl|my_center|LOCUS_02280 109915 109319 gene locus_tag LOCUS_02290 109915 109319 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289673.1 protein_id gnl|my_center|LOCUS_02290 110056 110553 gene locus_tag LOCUS_02300 110056 110553 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_02300 111412 110840 gene locus_tag LOCUS_02310 111412 110840 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020833.1 protein_id gnl|my_center|LOCUS_02310 111517 112047 gene locus_tag LOCUS_02320 111517 112047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 112044 112583 gene locus_tag LOCUS_02330 112044 112583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 112580 112915 gene locus_tag LOCUS_02340 112580 112915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 114911 112923 gene locus_tag LOCUS_02350 114911 112923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 117354 114958 gene locus_tag LOCUS_02360 gene pheT 117354 114958 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777486.1 protein_id gnl|my_center|LOCUS_02360 119481 117397 gene locus_tag LOCUS_02370 119481 117397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 120715 119471 gene locus_tag LOCUS_02380 120715 119471 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591983.1 protein_id gnl|my_center|LOCUS_02380 121116 120814 gene locus_tag LOCUS_02390 121116 120814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 121291 121100 gene locus_tag LOCUS_02400 121291 121100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 123267 121423 gene locus_tag LOCUS_02410 123267 121423 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002095496.1 protein_id gnl|my_center|LOCUS_02410 123450 124985 gene locus_tag LOCUS_02420 123450 124985 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577066.1 protein_id gnl|my_center|LOCUS_02420 124975 126252 gene locus_tag LOCUS_02430 124975 126252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011185.1 protein_id gnl|my_center|LOCUS_02430 126313 128040 gene locus_tag LOCUS_02440 126313 128040 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837584.1 protein_id gnl|my_center|LOCUS_02440 128425 128790 gene locus_tag LOCUS_02450 128425 128790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 128920 129663 gene locus_tag LOCUS_02460 128920 129663 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216306.1 protein_id gnl|my_center|LOCUS_02460 129665 130897 gene locus_tag LOCUS_02470 gene ftsA 129665 130897 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294722.1 protein_id gnl|my_center|LOCUS_02470 130907 132124 gene locus_tag LOCUS_02480 gene ftsZ 130907 132124 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617710.1 protein_id gnl|my_center|LOCUS_02480 133569 132139 gene locus_tag LOCUS_02490 133569 132139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 134165 133587 gene locus_tag LOCUS_02500 134165 133587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 134972 134223 gene locus_tag LOCUS_02510 134972 134223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 134944 135471 gene locus_tag LOCUS_02520 134944 135471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 135504 136490 gene locus_tag LOCUS_02530 gene nadA 135504 136490 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_02530 136497 136988 gene locus_tag LOCUS_02540 gene ispF 136497 136988 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285625.1 protein_id gnl|my_center|LOCUS_02540 137464 136997 gene locus_tag LOCUS_02550 137464 136997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 137516 139579 gene locus_tag LOCUS_02560 137516 139579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 139569 140654 gene locus_tag LOCUS_02570 139569 140654 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143898.1 protein_id gnl|my_center|LOCUS_02570 140659 141669 gene locus_tag LOCUS_02580 140659 141669 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759810.1 protein_id gnl|my_center|LOCUS_02580 141672 142715 gene locus_tag LOCUS_02590 141672 142715 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603891.1 protein_id gnl|my_center|LOCUS_02590 142712 143701 gene locus_tag LOCUS_02600 142712 143701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127309.1 protein_id gnl|my_center|LOCUS_02600 143688 144644 gene locus_tag LOCUS_02610 143688 144644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619172.1 protein_id gnl|my_center|LOCUS_02610 144657 146720 gene locus_tag LOCUS_02620 144657 146720 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116789.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence05 3309 1534 gene locus_tag LOCUS_02630 3309 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4338 3337 gene locus_tag LOCUS_02640 4338 3337 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822893.1 protein_id gnl|my_center|LOCUS_02640 4472 5062 gene locus_tag LOCUS_02650 4472 5062 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_02650 5444 5067 gene locus_tag LOCUS_02660 5444 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6087 5518 gene locus_tag LOCUS_02670 6087 5518 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_02670 6760 6110 gene locus_tag LOCUS_02680 6760 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7317 6757 gene locus_tag LOCUS_02690 7317 6757 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_02690 7444 7698 gene locus_tag LOCUS_02700 7444 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_02700 7638 8564 gene locus_tag LOCUS_02710 7638 8564 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_02710 8530 9285 gene locus_tag LOCUS_02720 8530 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11268 9304 gene locus_tag LOCUS_02730 11268 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11495 13426 gene locus_tag LOCUS_02740 11495 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14210 13419 gene locus_tag LOCUS_02750 gene eutC 14210 13419 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114907.1 protein_id gnl|my_center|LOCUS_02750 15591 14203 gene locus_tag LOCUS_02760 15591 14203 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407936.1 protein_id gnl|my_center|LOCUS_02760 15677 17560 gene locus_tag LOCUS_02770 15677 17560 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_02770 17576 18313 gene locus_tag LOCUS_02780 17576 18313 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_02780 18444 18824 gene locus_tag LOCUS_02790 18444 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689175.1 protein_id gnl|my_center|LOCUS_02790 18842 19234 gene locus_tag LOCUS_02800 18842 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 19240 19590 gene locus_tag LOCUS_02810 19240 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 19634 22075 gene locus_tag LOCUS_02820 19634 22075 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790264.1 protein_id gnl|my_center|LOCUS_02820 22075 22581 gene locus_tag LOCUS_02830 22075 22581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 22583 23197 gene locus_tag LOCUS_02840 22583 23197 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_02840 23202 23600 gene locus_tag LOCUS_02850 23202 23600 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_02850 23597 24250 gene locus_tag LOCUS_02860 23597 24250 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776116.1 protein_id gnl|my_center|LOCUS_02860 24251 26212 gene locus_tag LOCUS_02870 24251 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 26783 26178 gene locus_tag LOCUS_02880 26783 26178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 27841 26765 gene locus_tag LOCUS_02890 27841 26765 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931520.1 protein_id gnl|my_center|LOCUS_02890 28180 27869 gene locus_tag LOCUS_02900 28180 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 30177 28195 gene locus_tag LOCUS_02910 30177 28195 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698487.1 protein_id gnl|my_center|LOCUS_02910 30921 30289 gene locus_tag LOCUS_02920 30921 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 32868 30922 gene locus_tag LOCUS_02930 32868 30922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_02930 33832 32873 gene locus_tag LOCUS_02940 33832 32873 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932069.1 protein_id gnl|my_center|LOCUS_02940 35120 33825 gene locus_tag LOCUS_02950 35120 33825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 36314 35334 gene locus_tag LOCUS_02960 36314 35334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 37858 36392 gene locus_tag LOCUS_02970 37858 36392 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_02970 39538 38027 gene locus_tag LOCUS_02980 39538 38027 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278607.1 protein_id gnl|my_center|LOCUS_02980 39729 41567 gene locus_tag LOCUS_02990 39729 41567 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203363.1 protein_id gnl|my_center|LOCUS_02990 41741 42334 gene locus_tag LOCUS_03000 41741 42334 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043335393.1 protein_id gnl|my_center|LOCUS_03000 42393 43295 gene locus_tag LOCUS_03010 42393 43295 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100327.1 protein_id gnl|my_center|LOCUS_03010 43520 44143 gene locus_tag LOCUS_03020 43520 44143 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219098.1 protein_id gnl|my_center|LOCUS_03020 45114 44335 gene locus_tag LOCUS_03030 45114 44335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 45211 46284 gene locus_tag LOCUS_03040 45211 46284 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_03040 46653 47255 gene locus_tag LOCUS_03050 46653 47255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 47307 48188 gene locus_tag LOCUS_03060 47307 48188 CDS product LIC_13355 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932722.1 protein_id gnl|my_center|LOCUS_03060 48545 49324 gene locus_tag LOCUS_03070 48545 49324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 49337 49894 gene locus_tag LOCUS_03080 49337 49894 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109025.1 protein_id gnl|my_center|LOCUS_03080 49910 50257 gene locus_tag LOCUS_03090 49910 50257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387861.1 protein_id gnl|my_center|LOCUS_03090 51432 50269 gene locus_tag LOCUS_03100 51432 50269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 51550 53061 gene locus_tag LOCUS_03110 51550 53061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 53069 54019 gene locus_tag LOCUS_03120 53069 54019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 54053 54622 gene locus_tag LOCUS_03130 54053 54622 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109025.1 protein_id gnl|my_center|LOCUS_03130 55262 54612 gene locus_tag LOCUS_03140 55262 54612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 protein_id gnl|my_center|LOCUS_03140 55359 56315 gene locus_tag LOCUS_03150 55359 56315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 56312 56752 gene locus_tag LOCUS_03160 56312 56752 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_03160 58608 56950 gene locus_tag LOCUS_03170 58608 56950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 58715 59551 gene locus_tag LOCUS_03180 58715 59551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 59935 59672 gene locus_tag LOCUS_03190 59935 59672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 60115 60567 gene locus_tag LOCUS_03200 60115 60567 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_03200 60548 60901 gene locus_tag LOCUS_03210 60548 60901 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525103.1 protein_id gnl|my_center|LOCUS_03210 61025 61363 gene locus_tag LOCUS_03220 61025 61363 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 protein_id gnl|my_center|LOCUS_03220 61360 61851 gene locus_tag LOCUS_03230 61360 61851 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_03230 61955 62377 gene locus_tag LOCUS_03240 61955 62377 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_03240 62733 62518 gene locus_tag LOCUS_03250 62733 62518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03250 63692 63306 gene locus_tag LOCUS_03260 63692 63306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 65290 64172 gene locus_tag LOCUS_03270 65290 64172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 65568 65876 gene locus_tag LOCUS_03280 65568 65876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 66153 65968 gene locus_tag LOCUS_03290 66153 65968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 66797 66573 gene locus_tag LOCUS_03300 66797 66573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 67570 66938 gene locus_tag LOCUS_03310 67570 66938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 67988 67584 gene locus_tag LOCUS_03320 67988 67584 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_03320 71401 68003 gene locus_tag LOCUS_03330 71401 68003 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558138.1 protein_id gnl|my_center|LOCUS_03330 71892 72959 gene locus_tag LOCUS_03340 gene mreC 71892 72959 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964329.1 protein_id gnl|my_center|LOCUS_03340 72956 73471 gene locus_tag LOCUS_03350 gene mreD 72956 73471 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599731.1 protein_id gnl|my_center|LOCUS_03350 73468 75405 gene locus_tag LOCUS_03360 gene mrdA 73468 75405 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900432.1 protein_id gnl|my_center|LOCUS_03360 75407 76921 gene locus_tag LOCUS_03370 gene rodA 75407 76921 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801434.1 protein_id gnl|my_center|LOCUS_03370 76921 77700 gene locus_tag LOCUS_03380 76921 77700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 77881 78645 gene locus_tag LOCUS_03390 77881 78645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 79563 78634 gene locus_tag LOCUS_03400 79563 78634 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627564.1 protein_id gnl|my_center|LOCUS_03400 79599 80174 gene locus_tag LOCUS_03410 79599 80174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 80515 80171 gene locus_tag LOCUS_03420 80515 80171 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406135.1 protein_id gnl|my_center|LOCUS_03420 80638 81360 gene locus_tag LOCUS_03430 80638 81360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660163.1 protein_id gnl|my_center|LOCUS_03430 81369 82094 gene locus_tag LOCUS_03440 81369 82094 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999543.1 protein_id gnl|my_center|LOCUS_03440 82097 83110 gene locus_tag LOCUS_03450 82097 83110 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174418.1 protein_id gnl|my_center|LOCUS_03450 83112 84074 gene locus_tag LOCUS_03460 83112 84074 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_03460 85379 84243 gene locus_tag LOCUS_03470 85379 84243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 86428 85376 gene locus_tag LOCUS_03480 86428 85376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702854.1 protein_id gnl|my_center|LOCUS_03480 86631 87317 gene locus_tag LOCUS_03490 86631 87317 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265880.1 protein_id gnl|my_center|LOCUS_03490 88694 87369 gene locus_tag LOCUS_03500 88694 87369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625279.1 protein_id gnl|my_center|LOCUS_03500 88715 89716 gene locus_tag LOCUS_03510 88715 89716 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_03510 89993 91768 gene locus_tag LOCUS_03520 89993 91768 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211616.1 protein_id gnl|my_center|LOCUS_03520 93727 91775 gene locus_tag LOCUS_03530 93727 91775 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372280.1 protein_id gnl|my_center|LOCUS_03530 93819 95189 gene locus_tag LOCUS_03540 93819 95189 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 protein_id gnl|my_center|LOCUS_03540 95207 96295 gene locus_tag LOCUS_03550 95207 96295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 97149 96340 gene locus_tag LOCUS_03560 97149 96340 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766631.1 protein_id gnl|my_center|LOCUS_03560 97288 97467 gene locus_tag LOCUS_03570 97288 97467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 97436 99157 gene locus_tag LOCUS_03580 97436 99157 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572082.1 protein_id gnl|my_center|LOCUS_03580 100809 99643 gene locus_tag LOCUS_03590 100809 99643 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_03590 101944 100856 gene locus_tag LOCUS_03600 101944 100856 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_03600 102076 102717 gene locus_tag LOCUS_03610 gene fabR 102076 102717 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163800.1 protein_id gnl|my_center|LOCUS_03610 103244 102777 gene locus_tag LOCUS_03620 103244 102777 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_03620 104030 103272 gene locus_tag LOCUS_03630 104030 103272 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_03630 104272 104736 gene locus_tag LOCUS_03640 104272 104736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 104737 105366 gene locus_tag LOCUS_03650 104737 105366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_03650 105451 105816 gene locus_tag LOCUS_03660 105451 105816 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_03660 107271 105895 gene locus_tag LOCUS_03670 107271 105895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 107189 107371 gene locus_tag LOCUS_03680 107189 107371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 109487 107805 gene locus_tag LOCUS_03690 109487 107805 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972416.1 protein_id gnl|my_center|LOCUS_03690 109621 110940 gene locus_tag LOCUS_03700 109621 110940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_03700 110950 111900 gene locus_tag LOCUS_03710 110950 111900 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_03710 111968 112525 gene locus_tag LOCUS_03720 111968 112525 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_03720 114320 112527 gene locus_tag LOCUS_03730 114320 112527 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876085.1 protein_id gnl|my_center|LOCUS_03730 115141 114743 gene locus_tag LOCUS_03740 115141 114743 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465997.1 protein_id gnl|my_center|LOCUS_03740 115205 115432 gene locus_tag LOCUS_03750 115205 115432 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141324.1 protein_id gnl|my_center|LOCUS_03750 115959 115708 gene locus_tag LOCUS_03760 115959 115708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03760 116356 115988 gene locus_tag LOCUS_03770 116356 115988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence06 3298 191 gene locus_tag LOCUS_03780 3298 191 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952670.1 protein_id gnl|my_center|LOCUS_03780 4580 3264 gene locus_tag LOCUS_03790 4580 3264 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220692.1 protein_id gnl|my_center|LOCUS_03790 5013 4627 gene locus_tag LOCUS_03800 5013 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5135 5494 gene locus_tag LOCUS_03810 5135 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5503 5862 gene locus_tag LOCUS_03820 5503 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6664 7809 gene locus_tag LOCUS_03830 6664 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9340 7865 gene locus_tag LOCUS_03840 9340 7865 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_03840 12609 9361 gene locus_tag LOCUS_03850 12609 9361 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444632.1 protein_id gnl|my_center|LOCUS_03850 13326 12622 gene locus_tag LOCUS_03860 13326 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14185 13742 gene locus_tag LOCUS_03870 14185 13742 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810437.1 protein_id gnl|my_center|LOCUS_03870 15566 14199 gene locus_tag LOCUS_03880 15566 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 16037 15606 gene locus_tag LOCUS_03890 16037 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 16415 16104 gene locus_tag LOCUS_03900 16415 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 16884 17243 gene locus_tag LOCUS_03910 16884 17243 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_03910 17274 17765 gene locus_tag LOCUS_03920 17274 17765 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_03920 17798 18250 gene locus_tag LOCUS_03930 17798 18250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_03930 18268 18894 gene locus_tag LOCUS_03940 18268 18894 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 19177 19554 gene locus_tag LOCUS_03950 19177 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03950 20989 19658 gene locus_tag LOCUS_03960 gene creD 20989 19658 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_03960 22526 21087 gene locus_tag LOCUS_03970 gene creC 22526 21087 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080011803.1 protein_id gnl|my_center|LOCUS_03970 23205 22531 gene locus_tag LOCUS_03980 23205 22531 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529920.1 protein_id gnl|my_center|LOCUS_03980 23399 27382 gene locus_tag LOCUS_03990 23399 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 27400 29388 gene locus_tag LOCUS_04000 27400 29388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29360 31528 gene locus_tag LOCUS_04010 29360 31528 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876410.1 protein_id gnl|my_center|LOCUS_04010 31518 32675 gene locus_tag LOCUS_04020 31518 32675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 32877 33626 gene locus_tag LOCUS_04030 32877 33626 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_04030 35610 33586 gene locus_tag LOCUS_04040 35610 33586 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160641.1 protein_id gnl|my_center|LOCUS_04040 35861 35685 gene locus_tag LOCUS_04050 35861 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 35921 36406 gene locus_tag LOCUS_04060 35921 36406 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_04060 36409 37242 gene locus_tag LOCUS_04070 36409 37242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 37323 37919 gene locus_tag LOCUS_04080 37323 37919 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623187.1 protein_id gnl|my_center|LOCUS_04080 38553 37969 gene locus_tag LOCUS_04090 38553 37969 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_04090 39311 38589 gene locus_tag LOCUS_04100 39311 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 40030 39446 gene locus_tag LOCUS_04110 40030 39446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008798.1 protein_id gnl|my_center|LOCUS_04110 41575 40031 gene locus_tag LOCUS_04120 41575 40031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576229.1 protein_id gnl|my_center|LOCUS_04120 41915 42175 gene locus_tag LOCUS_04130 41915 42175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 42175 42846 gene locus_tag LOCUS_04140 42175 42846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603361.1 protein_id gnl|my_center|LOCUS_04140 42843 43760 gene locus_tag LOCUS_04150 42843 43760 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834630.1 protein_id gnl|my_center|LOCUS_04150 43757 44104 gene locus_tag LOCUS_04160 43757 44104 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_04160 44147 45112 gene locus_tag LOCUS_04170 44147 45112 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821594.1 protein_id gnl|my_center|LOCUS_04170 45558 45097 gene locus_tag LOCUS_04180 45558 45097 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_04180 46130 45759 gene locus_tag LOCUS_04190 46130 45759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 46929 46135 gene locus_tag LOCUS_04200 46929 46135 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_04200 47566 48027 gene locus_tag LOCUS_04210 47566 48027 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085196.1 protein_id gnl|my_center|LOCUS_04210 48358 48927 gene locus_tag LOCUS_04220 48358 48927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 49070 49378 gene locus_tag LOCUS_04230 49070 49378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 49390 49791 gene locus_tag LOCUS_04240 49390 49791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 51326 50148 gene locus_tag LOCUS_04250 51326 50148 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020458.1 protein_id gnl|my_center|LOCUS_04250 52491 51553 gene locus_tag LOCUS_04260 52491 51553 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 protein_id gnl|my_center|LOCUS_04260 53852 52671 gene locus_tag LOCUS_04270 53852 52671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 54066 53842 gene locus_tag LOCUS_04280 54066 53842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 54262 54969 gene locus_tag LOCUS_04290 54262 54969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 55726 55100 gene locus_tag LOCUS_04300 55726 55100 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_04300 55725 57635 gene locus_tag LOCUS_04310 55725 57635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 58297 57632 gene locus_tag LOCUS_04320 58297 57632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 58943 58497 gene locus_tag LOCUS_04330 58943 58497 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_04330 58980 60626 gene locus_tag LOCUS_04340 58980 60626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 60623 61165 gene locus_tag LOCUS_04350 60623 61165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 61158 61964 gene locus_tag LOCUS_04360 61158 61964 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080449.1 protein_id gnl|my_center|LOCUS_04360 61970 63475 gene locus_tag LOCUS_04370 61970 63475 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_04370 64596 63481 gene locus_tag LOCUS_04380 64596 63481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_04380 64683 65705 gene locus_tag LOCUS_04390 gene argC 64683 65705 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808031.1 protein_id gnl|my_center|LOCUS_04390 65695 66351 gene locus_tag LOCUS_04400 65695 66351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 67530 66367 gene locus_tag LOCUS_04410 67530 66367 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273947.1 protein_id gnl|my_center|LOCUS_04410 67582 68214 gene locus_tag LOCUS_04420 67582 68214 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_04420 68211 68687 gene locus_tag LOCUS_04430 68211 68687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 68862 69761 gene locus_tag LOCUS_04440 68862 69761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 69785 70798 gene locus_tag LOCUS_04450 69785 70798 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_04450 70833 71537 gene locus_tag LOCUS_04460 70833 71537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 71537 72841 gene locus_tag LOCUS_04470 gene dctM 71537 72841 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_04470 72944 73453 gene locus_tag LOCUS_04480 72944 73453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 73505 74077 gene locus_tag LOCUS_04490 73505 74077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 74792 74097 gene locus_tag LOCUS_04500 74792 74097 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068401.1 protein_id gnl|my_center|LOCUS_04500 77370 74785 gene locus_tag LOCUS_04510 77370 74785 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588676.1 protein_id gnl|my_center|LOCUS_04510 77939 77367 gene locus_tag LOCUS_04520 gene kdpC 77939 77367 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576697.1 protein_id gnl|my_center|LOCUS_04520 79990 77939 gene locus_tag LOCUS_04530 gene kdpB 79990 77939 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078552.1 protein_id gnl|my_center|LOCUS_04530 81636 79999 gene locus_tag LOCUS_04540 gene kdpA 81636 79999 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255834.1 protein_id gnl|my_center|LOCUS_04540 82249 81716 gene locus_tag LOCUS_04550 82249 81716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893419.1 protein_id gnl|my_center|LOCUS_04550 82638 82228 gene locus_tag LOCUS_04560 82638 82228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 83108 82662 gene locus_tag LOCUS_04570 gene fliS 83108 82662 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_04570 83233 83826 gene locus_tag LOCUS_04580 gene purN 83233 83826 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212329.1 protein_id gnl|my_center|LOCUS_04580 83823 85364 gene locus_tag LOCUS_04590 gene purH 83823 85364 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614727.1 protein_id gnl|my_center|LOCUS_04590 85367 86131 gene locus_tag LOCUS_04600 85367 86131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 86094 86852 gene locus_tag LOCUS_04610 86094 86852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217817.1 protein_id gnl|my_center|LOCUS_04610 86894 87538 gene locus_tag LOCUS_04620 gene fsa 86894 87538 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424879.1 protein_id gnl|my_center|LOCUS_04620 87584 88732 gene locus_tag LOCUS_04630 87584 88732 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_04630 89780 88746 gene locus_tag LOCUS_04640 89780 88746 CDS product DUF1574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725569.1 protein_id gnl|my_center|LOCUS_04640 90595 89834 gene locus_tag LOCUS_04650 90595 89834 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053851.1 protein_id gnl|my_center|LOCUS_04650 90616 91527 gene locus_tag LOCUS_04660 gene lipA 90616 91527 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068714.1 protein_id gnl|my_center|LOCUS_04660 91586 91879 gene locus_tag LOCUS_04670 91586 91879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 93162 91981 gene locus_tag LOCUS_04680 93162 91981 CDS product lipoprotein LipL45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714030.1 protein_id gnl|my_center|LOCUS_04680 93424 94746 gene locus_tag LOCUS_04690 93424 94746 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454161.1 protein_id gnl|my_center|LOCUS_04690 94782 96860 gene locus_tag LOCUS_04700 94782 96860 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160641.1 protein_id gnl|my_center|LOCUS_04700 97202 96861 gene locus_tag LOCUS_04710 97202 96861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 97869 97270 gene locus_tag LOCUS_04720 97869 97270 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_04720 98724 97918 gene locus_tag LOCUS_04730 98724 97918 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356143.1 protein_id gnl|my_center|LOCUS_04730 98799 100202 gene locus_tag LOCUS_04740 98799 100202 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_04740 100308 100484 gene locus_tag LOCUS_04750 100308 100484 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672132.1 protein_id gnl|my_center|LOCUS_04750 100555 100794 gene locus_tag LOCUS_04760 100555 100794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876121.1 protein_id gnl|my_center|LOCUS_04760 100880 100808 gene locus_tag LOCUS_t00020 100880 100808 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 100914 101879 gene locus_tag LOCUS_04770 100914 101879 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_04770 102508 103104 gene locus_tag LOCUS_04780 gene coaE 102508 103104 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181518.1 protein_id gnl|my_center|LOCUS_04780 103101 103919 gene locus_tag LOCUS_04790 103101 103919 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659917.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence07 794 3757 gene locus_tag LOCUS_04800 794 3757 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_04800 3852 4922 gene locus_tag LOCUS_04810 3852 4922 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 protein_id gnl|my_center|LOCUS_04810 5049 6248 gene locus_tag LOCUS_04820 5049 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6253 7374 gene locus_tag LOCUS_04830 6253 7374 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035717.1 protein_id gnl|my_center|LOCUS_04830 7423 9036 gene locus_tag LOCUS_04840 7423 9036 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_04840 9244 9062 gene locus_tag LOCUS_04850 9244 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 9502 9263 gene locus_tag LOCUS_04860 9502 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 10324 9809 gene locus_tag LOCUS_04870 10324 9809 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_04870 10665 10330 gene locus_tag LOCUS_04880 10665 10330 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_04880 11704 12582 gene locus_tag LOCUS_04890 11704 12582 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887489.1 protein_id gnl|my_center|LOCUS_04890 12583 13260 gene locus_tag LOCUS_04900 12583 13260 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_04900 13479 13255 gene locus_tag LOCUS_04910 13479 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13672 13490 gene locus_tag LOCUS_04920 13672 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 14010 13789 gene locus_tag LOCUS_04930 14010 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 14964 14179 gene locus_tag LOCUS_04940 14964 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 15625 15035 gene locus_tag LOCUS_04950 15625 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 15656 16177 gene locus_tag LOCUS_04960 15656 16177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 16460 17206 gene locus_tag LOCUS_04970 16460 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 17286 19262 gene locus_tag LOCUS_04980 17286 19262 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_04980 21533 19683 gene locus_tag LOCUS_04990 21533 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 22103 23689 gene locus_tag LOCUS_05000 22103 23689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25208 23778 gene locus_tag LOCUS_05010 25208 23778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_05010 25515 25255 gene locus_tag LOCUS_05020 25515 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 26013 30701 gene locus_tag LOCUS_05030 26013 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 30801 31265 gene locus_tag LOCUS_05040 30801 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 31259 32224 gene locus_tag LOCUS_05050 31259 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 32637 33424 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctctaagagaggatataaatttctactgttgtagat 34131 34595 gene locus_tag LOCUS_05060 34131 34595 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545294.1 protein_id gnl|my_center|LOCUS_05060 35331 34651 gene locus_tag LOCUS_05070 35331 34651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_05070 35355 36944 gene locus_tag LOCUS_05080 35355 36944 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_05080 37892 36945 gene locus_tag LOCUS_05090 37892 36945 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969466.1 protein_id gnl|my_center|LOCUS_05090 38972 38007 gene locus_tag LOCUS_05100 38972 38007 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133548.1 protein_id gnl|my_center|LOCUS_05100 39416 39006 gene locus_tag LOCUS_05110 39416 39006 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_05110 40043 39453 gene locus_tag LOCUS_05120 40043 39453 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_05120 42452 40365 gene locus_tag LOCUS_05130 42452 40365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 42671 43525 gene locus_tag LOCUS_05140 42671 43525 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841164.1 protein_id gnl|my_center|LOCUS_05140 44012 43587 gene locus_tag LOCUS_05150 gene ohrR 44012 43587 CDS product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_05150 44922 44158 gene locus_tag LOCUS_05160 44922 44158 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_05160 45989 44997 gene locus_tag LOCUS_05170 45989 44997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 46632 47039 gene locus_tag LOCUS_05180 46632 47039 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053805.1 protein_id gnl|my_center|LOCUS_05180 47046 49373 gene locus_tag LOCUS_05190 47046 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 50515 49322 gene locus_tag LOCUS_05200 50515 49322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 51948 50740 gene locus_tag LOCUS_05210 51948 50740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 52618 55200 gene locus_tag LOCUS_05220 52618 55200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 56338 55223 gene locus_tag LOCUS_05230 56338 55223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 56403 57293 gene locus_tag LOCUS_05240 56403 57293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 57421 59628 gene locus_tag LOCUS_05250 57421 59628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446221.1 protein_id gnl|my_center|LOCUS_05250 60017 59682 gene locus_tag LOCUS_05260 60017 59682 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673420.1 protein_id gnl|my_center|LOCUS_05260 61308 60163 gene locus_tag LOCUS_05270 61308 60163 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455718.1 protein_id gnl|my_center|LOCUS_05270 61744 63393 gene locus_tag LOCUS_05280 61744 63393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 63409 65358 gene locus_tag LOCUS_05290 63409 65358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 65355 65747 gene locus_tag LOCUS_05300 65355 65747 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_05300 66023 65799 gene locus_tag LOCUS_05310 66023 65799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 66222 66055 gene locus_tag LOCUS_05320 66222 66055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 67296 66241 gene locus_tag LOCUS_05330 gene lpxD 67296 66241 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155198.1 protein_id gnl|my_center|LOCUS_05330 67900 67463 gene locus_tag LOCUS_05340 67900 67463 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_05340 68625 67987 gene locus_tag LOCUS_05350 68625 67987 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087013.1 protein_id gnl|my_center|LOCUS_05350 68992 70278 gene locus_tag LOCUS_05360 68992 70278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_05360 70281 70508 gene locus_tag LOCUS_05370 70281 70508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863678.1 protein_id gnl|my_center|LOCUS_05370 71354 70539 gene locus_tag LOCUS_05380 71354 70539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026144.1 protein_id gnl|my_center|LOCUS_05380 72476 71427 gene locus_tag LOCUS_05390 72476 71427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_05390 73966 72476 gene locus_tag LOCUS_05400 73966 72476 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_05400 74960 73956 gene locus_tag LOCUS_05410 74960 73956 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290040.1 protein_id gnl|my_center|LOCUS_05410 75102 75788 gene locus_tag LOCUS_05420 75102 75788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175921.1 protein_id gnl|my_center|LOCUS_05420 76150 75785 gene locus_tag LOCUS_05430 76150 75785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 77437 76184 gene locus_tag LOCUS_05440 77437 76184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612013.1 protein_id gnl|my_center|LOCUS_05440 78117 77437 gene locus_tag LOCUS_05450 78117 77437 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050532.1 protein_id gnl|my_center|LOCUS_05450 79342 78209 gene locus_tag LOCUS_05460 79342 78209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_05460 80118 79339 gene locus_tag LOCUS_05470 80118 79339 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence08 203 451 gene locus_tag LOCUS_05480 203 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 676 539 gene locus_tag LOCUS_05490 676 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1570 1322 gene locus_tag LOCUS_05500 1570 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2763 2233 gene locus_tag LOCUS_05510 2763 2233 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841462.1 protein_id gnl|my_center|LOCUS_05510 2920 4152 gene locus_tag LOCUS_05520 gene odhB 2920 4152 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110041.1 protein_id gnl|my_center|LOCUS_05520 4162 5568 gene locus_tag LOCUS_05530 gene lpdA 4162 5568 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271667.1 protein_id gnl|my_center|LOCUS_05530 5614 8373 gene locus_tag LOCUS_05540 5614 8373 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687652.1 protein_id gnl|my_center|LOCUS_05540 9069 8473 gene locus_tag LOCUS_05550 9069 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9128 10375 gene locus_tag LOCUS_05560 9128 10375 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206886.1 protein_id gnl|my_center|LOCUS_05560 11390 10656 gene locus_tag LOCUS_05570 11390 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411557.1 protein_id gnl|my_center|LOCUS_05570 12511 11393 gene locus_tag LOCUS_05580 12511 11393 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_05580 12951 12529 gene locus_tag LOCUS_05590 12951 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 13895 12948 gene locus_tag LOCUS_05600 13895 12948 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079893.1 protein_id gnl|my_center|LOCUS_05600 14336 13896 gene locus_tag LOCUS_05610 14336 13896 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229815.1 protein_id gnl|my_center|LOCUS_05610 15177 14407 gene locus_tag LOCUS_05620 15177 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008019.1 protein_id gnl|my_center|LOCUS_05620 16434 15178 gene locus_tag LOCUS_05630 16434 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 16483 18756 gene locus_tag LOCUS_05640 16483 18756 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135589017.1 protein_id gnl|my_center|LOCUS_05640 18824 20113 gene locus_tag LOCUS_05650 18824 20113 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_05650 20440 22119 gene locus_tag LOCUS_05660 20440 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 22116 22952 gene locus_tag LOCUS_05670 22116 22952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844814.1 protein_id gnl|my_center|LOCUS_05670 22957 23796 gene locus_tag LOCUS_05680 22957 23796 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280345.1 protein_id gnl|my_center|LOCUS_05680 23800 24867 gene locus_tag LOCUS_05690 23800 24867 CDS product arabinose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706056.1 protein_id gnl|my_center|LOCUS_05690 24873 26543 gene locus_tag LOCUS_05700 24873 26543 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973629.1 protein_id gnl|my_center|LOCUS_05700 27324 26557 gene locus_tag LOCUS_05710 27324 26557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 27622 27326 gene locus_tag LOCUS_05720 27622 27326 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908508.1 protein_id gnl|my_center|LOCUS_05720 27939 27754 gene locus_tag LOCUS_05730 27939 27754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 28736 27936 gene locus_tag LOCUS_05740 28736 27936 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115248.1 protein_id gnl|my_center|LOCUS_05740 28990 28790 gene locus_tag LOCUS_05750 gene rpmE 28990 28790 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845534.1 protein_id gnl|my_center|LOCUS_05750 30411 29005 gene locus_tag LOCUS_05760 gene rho 30411 29005 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_05760 31753 30560 gene locus_tag LOCUS_05770 31753 30560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 32438 31800 gene locus_tag LOCUS_05780 32438 31800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 33428 32442 gene locus_tag LOCUS_05790 33428 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949351.1 protein_id gnl|my_center|LOCUS_05790 34707 33481 gene locus_tag LOCUS_05800 34707 33481 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284165.1 protein_id gnl|my_center|LOCUS_05800 35062 34691 gene locus_tag LOCUS_05810 35062 34691 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_05810 36011 35070 gene locus_tag LOCUS_05820 gene pyrB 36011 35070 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002063873.1 protein_id gnl|my_center|LOCUS_05820 36080 36502 gene locus_tag LOCUS_05830 36080 36502 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451642.1 protein_id gnl|my_center|LOCUS_05830 37664 37068 gene locus_tag LOCUS_05840 37664 37068 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780086.1 protein_id gnl|my_center|LOCUS_05840 38536 37661 gene locus_tag LOCUS_05850 gene ubiA 38536 37661 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156605.1 protein_id gnl|my_center|LOCUS_05850 38669 39487 gene locus_tag LOCUS_05860 38669 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 40331 40035 gene locus_tag LOCUS_05870 gene rpmB 40331 40035 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113840.1 protein_id gnl|my_center|LOCUS_05870 41125 40352 gene locus_tag LOCUS_05880 41125 40352 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_05880 41162 42130 gene locus_tag LOCUS_05890 41162 42130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 43290 42388 gene locus_tag LOCUS_05900 43290 42388 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461619.1 protein_id gnl|my_center|LOCUS_05900 43430 44335 gene locus_tag LOCUS_05910 gene sppA 43430 44335 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_05910 44348 45775 gene locus_tag LOCUS_05920 44348 45775 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898568.1 protein_id gnl|my_center|LOCUS_05920 45798 46478 gene locus_tag LOCUS_05930 45798 46478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 46969 46529 gene locus_tag LOCUS_05940 46969 46529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 49637 47211 gene locus_tag LOCUS_05950 49637 47211 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835640.1 protein_id gnl|my_center|LOCUS_05950 50619 49660 gene locus_tag LOCUS_05960 50619 49660 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636970.1 protein_id gnl|my_center|LOCUS_05960 50678 51505 gene locus_tag LOCUS_05970 50678 51505 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_05970 51502 52362 gene locus_tag LOCUS_05980 51502 52362 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258776.1 protein_id gnl|my_center|LOCUS_05980 52359 53603 gene locus_tag LOCUS_05990 52359 53603 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160150.1 protein_id gnl|my_center|LOCUS_05990 54601 53807 gene locus_tag LOCUS_06000 54601 53807 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_06000 54746 55351 gene locus_tag LOCUS_06010 54746 55351 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207830.1 protein_id gnl|my_center|LOCUS_06010 55348 56403 gene locus_tag LOCUS_06020 55348 56403 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_06020 56397 57458 gene locus_tag LOCUS_06030 56397 57458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919341.1 protein_id gnl|my_center|LOCUS_06030 58751 57462 gene locus_tag LOCUS_06040 58751 57462 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_06040 58954 58814 gene locus_tag LOCUS_06050 58954 58814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 59052 60101 gene locus_tag LOCUS_06060 59052 60101 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004000.1 protein_id gnl|my_center|LOCUS_06060 60098 62071 gene locus_tag LOCUS_06070 60098 62071 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391771.1 protein_id gnl|my_center|LOCUS_06070 62068 63930 gene locus_tag LOCUS_06080 62068 63930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 65424 64117 gene locus_tag LOCUS_06090 65424 64117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 65673 66077 gene locus_tag LOCUS_06100 65673 66077 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_06100 66664 66482 gene locus_tag LOCUS_06110 66664 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 66756 68399 gene locus_tag LOCUS_06120 66756 68399 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_06120 68396 70042 gene locus_tag LOCUS_06130 68396 70042 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 protein_id gnl|my_center|LOCUS_06130 70039 70425 gene locus_tag LOCUS_06140 70039 70425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 70453 71523 gene locus_tag LOCUS_06150 70453 71523 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_06150 72173 71526 gene locus_tag LOCUS_06160 72173 71526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014162.1 protein_id gnl|my_center|LOCUS_06160 72314 72748 gene locus_tag LOCUS_06170 72314 72748 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243208.1 protein_id gnl|my_center|LOCUS_06170 72884 73984 gene locus_tag LOCUS_06180 72884 73984 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 protein_id gnl|my_center|LOCUS_06180 74011 74961 gene locus_tag LOCUS_06190 74011 74961 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 protein_id gnl|my_center|LOCUS_06190 75063 75701 gene locus_tag LOCUS_06200 75063 75701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 75904 76731 gene locus_tag LOCUS_06210 75904 76731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 76718 77437 gene locus_tag LOCUS_06220 76718 77437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 77430 77732 gene locus_tag LOCUS_06230 77430 77732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence09 618 76 gene locus_tag LOCUS_06240 618 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 718 1254 gene locus_tag LOCUS_06250 718 1254 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413244.1 protein_id gnl|my_center|LOCUS_06250 1251 1607 gene locus_tag LOCUS_06260 1251 1607 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_06260 1673 2536 gene locus_tag LOCUS_06270 1673 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834696.1 protein_id gnl|my_center|LOCUS_06270 2636 3652 gene locus_tag LOCUS_06280 2636 3652 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_06280 4277 3639 gene locus_tag LOCUS_06290 4277 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4527 4850 gene locus_tag LOCUS_06300 4527 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4958 6181 gene locus_tag LOCUS_06310 4958 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6178 7272 gene locus_tag LOCUS_06320 6178 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7272 9089 gene locus_tag LOCUS_06330 7272 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9091 9861 gene locus_tag LOCUS_06340 9091 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10883 9858 gene locus_tag LOCUS_06350 10883 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11125 10883 gene locus_tag LOCUS_06360 11125 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11535 11227 gene locus_tag LOCUS_06370 11535 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11880 11584 gene locus_tag LOCUS_06380 11880 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11913 12722 gene locus_tag LOCUS_06390 11913 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197038.1 protein_id gnl|my_center|LOCUS_06390 12795 13106 gene locus_tag LOCUS_06400 gene trxA 12795 13106 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970524.1 protein_id gnl|my_center|LOCUS_06400 13125 15278 gene locus_tag LOCUS_06410 13125 15278 CDS product cAMP/cGMP-dependent 3',5'-cyclic-AMP/GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910893.1 protein_id gnl|my_center|LOCUS_06410 15328 16458 gene locus_tag LOCUS_06420 15328 16458 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374065.1 protein_id gnl|my_center|LOCUS_06420 18909 16522 gene locus_tag LOCUS_06430 18909 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 20462 18966 gene locus_tag LOCUS_06440 gene thiC 20462 18966 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972278.1 protein_id gnl|my_center|LOCUS_06440 21139 20768 gene locus_tag LOCUS_06450 21139 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23176 21485 gene locus_tag LOCUS_06460 23176 21485 CDS product P83/100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488504.1 protein_id gnl|my_center|LOCUS_06460 23304 24401 gene locus_tag LOCUS_06470 gene serC 23304 24401 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973456.1 protein_id gnl|my_center|LOCUS_06470 24405 25040 gene locus_tag LOCUS_06480 24405 25040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 25037 25477 gene locus_tag LOCUS_06490 gene rpiB 25037 25477 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719443.1 protein_id gnl|my_center|LOCUS_06490 25492 27153 gene locus_tag LOCUS_06500 25492 27153 CDS product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069642.1 protein_id gnl|my_center|LOCUS_06500 27540 27118 gene locus_tag LOCUS_06510 27540 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 27728 27537 gene locus_tag LOCUS_06520 27728 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140951.1 protein_id gnl|my_center|LOCUS_06520 28270 27728 gene locus_tag LOCUS_06530 28270 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274050.1 protein_id gnl|my_center|LOCUS_06530 31232 28308 gene locus_tag LOCUS_06540 31232 28308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 31286 32254 gene locus_tag LOCUS_06550 31286 32254 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578515.1 protein_id gnl|my_center|LOCUS_06550 33485 32262 gene locus_tag LOCUS_06560 33485 32262 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082049.1 protein_id gnl|my_center|LOCUS_06560 35179 33482 gene locus_tag LOCUS_06570 35179 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973373.1 protein_id gnl|my_center|LOCUS_06570 35260 35916 gene locus_tag LOCUS_06580 35260 35916 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973506.1 protein_id gnl|my_center|LOCUS_06580 36367 35906 gene locus_tag LOCUS_06590 36367 35906 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075144.1 protein_id gnl|my_center|LOCUS_06590 36481 37248 gene locus_tag LOCUS_06600 36481 37248 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_06600 37245 37961 gene locus_tag LOCUS_06610 37245 37961 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767160.1 protein_id gnl|my_center|LOCUS_06610 38379 41444 gene locus_tag LOCUS_06620 38379 41444 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_06620 41894 41571 gene locus_tag LOCUS_06630 41894 41571 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_06630 41959 43317 gene locus_tag LOCUS_06640 41959 43317 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792443.1 protein_id gnl|my_center|LOCUS_06640 43282 43355 gene locus_tag LOCUS_t00030 43282 43355 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44215 43433 gene locus_tag LOCUS_06650 44215 43433 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225344.1 protein_id gnl|my_center|LOCUS_06650 44961 44239 gene locus_tag LOCUS_06660 44961 44239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 45654 45010 gene locus_tag LOCUS_06670 45654 45010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 45846 46451 gene locus_tag LOCUS_06680 45846 46451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_06680 47521 46520 gene locus_tag LOCUS_06690 47521 46520 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_06690 47662 48072 gene locus_tag LOCUS_06700 47662 48072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 48975 48160 gene locus_tag LOCUS_06710 48975 48160 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463536.1 protein_id gnl|my_center|LOCUS_06710 49188 49868 gene locus_tag LOCUS_06720 49188 49868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 49960 51216 gene locus_tag LOCUS_06730 49960 51216 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675686.1 protein_id gnl|my_center|LOCUS_06730 51216 52646 gene locus_tag LOCUS_06740 51216 52646 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898580.1 protein_id gnl|my_center|LOCUS_06740 53335 52745 gene locus_tag LOCUS_06750 53335 52745 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_06750 54547 53390 gene locus_tag LOCUS_06760 54547 53390 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_06760 55440 54544 gene locus_tag LOCUS_06770 55440 54544 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763025.1 protein_id gnl|my_center|LOCUS_06770 56531 55437 gene locus_tag LOCUS_06780 gene pheA 56531 55437 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281293.1 protein_id gnl|my_center|LOCUS_06780 57214 56528 gene locus_tag LOCUS_06790 gene scpB 57214 56528 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439024.1 protein_id gnl|my_center|LOCUS_06790 57964 57218 gene locus_tag LOCUS_06800 57964 57218 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426654.1 protein_id gnl|my_center|LOCUS_06800 58332 57970 gene locus_tag LOCUS_06810 58332 57970 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101124.1 protein_id gnl|my_center|LOCUS_06810 59410 58334 gene locus_tag LOCUS_06820 59410 58334 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612786.1 protein_id gnl|my_center|LOCUS_06820 62628 59410 gene locus_tag LOCUS_06830 62628 59410 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907369.1 protein_id gnl|my_center|LOCUS_06830 63147 62644 gene locus_tag LOCUS_06840 63147 62644 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200285.1 protein_id gnl|my_center|LOCUS_06840 63764 63183 gene locus_tag LOCUS_06850 63764 63183 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776292.1 protein_id gnl|my_center|LOCUS_06850 64078 63761 gene locus_tag LOCUS_06860 64078 63761 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365849.1 protein_id gnl|my_center|LOCUS_06860 64778 64080 gene locus_tag LOCUS_06870 64778 64080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 65192 64839 gene locus_tag LOCUS_06880 gene rplT 65192 64839 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136837.1 protein_id gnl|my_center|LOCUS_06880 65396 65196 gene locus_tag LOCUS_06890 gene rpmI 65396 65196 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125262.1 protein_id gnl|my_center|LOCUS_06890 65968 65411 gene locus_tag LOCUS_06900 gene infC 65968 65411 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189133.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence10 305 943 gene locus_tag LOCUS_06910 305 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2341 947 gene locus_tag LOCUS_06920 2341 947 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002109366.1 protein_id gnl|my_center|LOCUS_06920 3495 2515 gene locus_tag LOCUS_06930 3495 2515 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_06930 4563 3514 gene locus_tag LOCUS_06940 4563 3514 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_06940 4741 5061 gene locus_tag LOCUS_06950 4741 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5155 5712 gene locus_tag LOCUS_06960 5155 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242795.1 protein_id gnl|my_center|LOCUS_06960 6753 5722 gene locus_tag LOCUS_06970 gene thrB 6753 5722 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095032.1 protein_id gnl|my_center|LOCUS_06970 6952 7824 gene locus_tag LOCUS_06980 6952 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230454.1 protein_id gnl|my_center|LOCUS_06980 9013 7829 gene locus_tag LOCUS_06990 9013 7829 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_06990 9906 9247 gene locus_tag LOCUS_07000 gene arsH 9906 9247 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969023.1 protein_id gnl|my_center|LOCUS_07000 10133 9918 gene locus_tag LOCUS_07010 10133 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 10629 10201 gene locus_tag LOCUS_07020 10629 10201 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_07020 10973 10629 gene locus_tag LOCUS_07030 10973 10629 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_07030 11082 11783 gene locus_tag LOCUS_07040 11082 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12053 13516 gene locus_tag LOCUS_07050 12053 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339988.1 protein_id gnl|my_center|LOCUS_07050 14859 13513 gene locus_tag LOCUS_07060 14859 13513 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146178.1 protein_id gnl|my_center|LOCUS_07060 14973 15791 gene locus_tag LOCUS_07070 14973 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16202 16963 gene locus_tag LOCUS_07080 16202 16963 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_07080 16974 17933 gene locus_tag LOCUS_07090 16974 17933 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_07090 18024 18542 gene locus_tag LOCUS_07100 18024 18542 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874918.1 protein_id gnl|my_center|LOCUS_07100 18546 20513 gene locus_tag LOCUS_07110 18546 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016926.1 protein_id gnl|my_center|LOCUS_07110 20539 21507 gene locus_tag LOCUS_07120 gene trpS 20539 21507 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221812.1 protein_id gnl|my_center|LOCUS_07120 21631 23535 gene locus_tag LOCUS_07130 21631 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 23483 24349 gene locus_tag LOCUS_07140 gene rsmA 23483 24349 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098504.1 protein_id gnl|my_center|LOCUS_07140 24371 25627 gene locus_tag LOCUS_07150 24371 25627 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_07150 25882 26667 gene locus_tag LOCUS_07160 25882 26667 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824202.1 protein_id gnl|my_center|LOCUS_07160 26672 27490 gene locus_tag LOCUS_07170 26672 27490 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176746.1 protein_id gnl|my_center|LOCUS_07170 27510 28208 gene locus_tag LOCUS_07180 27510 28208 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687475.1 protein_id gnl|my_center|LOCUS_07180 28248 28871 gene locus_tag LOCUS_07190 28248 28871 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067493.1 protein_id gnl|my_center|LOCUS_07190 28896 29825 gene locus_tag LOCUS_07200 28896 29825 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270455.1 protein_id gnl|my_center|LOCUS_07200 31840 29822 gene locus_tag LOCUS_07210 31840 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 32045 33439 gene locus_tag LOCUS_07220 32045 33439 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_07220 34606 33485 gene locus_tag LOCUS_07230 34606 33485 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050199.1 protein_id gnl|my_center|LOCUS_07230 34691 34987 gene locus_tag LOCUS_07240 34691 34987 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433083.1 protein_id gnl|my_center|LOCUS_07240 34987 35349 gene locus_tag LOCUS_07250 34987 35349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 35755 35333 gene locus_tag LOCUS_07260 35755 35333 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_07260 37000 35756 gene locus_tag LOCUS_07270 37000 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 38576 37002 gene locus_tag LOCUS_07280 38576 37002 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898176.1 protein_id gnl|my_center|LOCUS_07280 40468 38573 gene locus_tag LOCUS_07290 40468 38573 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_07290 40584 41189 gene locus_tag LOCUS_07300 40584 41189 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466471.1 protein_id gnl|my_center|LOCUS_07300 41211 42662 gene locus_tag LOCUS_07310 41211 42662 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067908.1 protein_id gnl|my_center|LOCUS_07310 45851 42873 gene locus_tag LOCUS_07320 45851 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 46281 45844 gene locus_tag LOCUS_07330 46281 45844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 46626 46285 gene locus_tag LOCUS_07340 46626 46285 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_07340 47549 46626 gene locus_tag LOCUS_07350 47549 46626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 48804 47623 gene locus_tag LOCUS_07360 48804 47623 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_07360 50120 48822 gene locus_tag LOCUS_07370 50120 48822 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_07370 50261 50689 gene locus_tag LOCUS_07380 50261 50689 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905581.1 protein_id gnl|my_center|LOCUS_07380 51134 50739 gene locus_tag LOCUS_07390 51134 50739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 51422 52603 gene locus_tag LOCUS_07400 51422 52603 CDS product LeuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806758.1 protein_id gnl|my_center|LOCUS_07400 52649 54361 gene locus_tag LOCUS_07410 52649 54361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 54441 56189 gene locus_tag LOCUS_07420 54441 56189 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_07420 57692 56229 gene locus_tag LOCUS_07430 57692 56229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 59203 57692 gene locus_tag LOCUS_07440 59203 57692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence11 <1 554 gene locus_tag LOCUS_07450 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937781.1:IS481-like element ISDvu4 family transposase 889 590 gene locus_tag LOCUS_07460 889 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1877 876 gene locus_tag LOCUS_07470 1877 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3006 1867 gene locus_tag LOCUS_07480 3006 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4091 4825 gene locus_tag LOCUS_07490 4091 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5665 4805 gene locus_tag LOCUS_07500 5665 4805 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943783.1 protein_id gnl|my_center|LOCUS_07500 5784 6146 gene locus_tag LOCUS_07510 5784 6146 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165331.1 protein_id gnl|my_center|LOCUS_07510 6146 7351 gene locus_tag LOCUS_07520 6146 7351 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656232.1 protein_id gnl|my_center|LOCUS_07520 7355 7975 gene locus_tag LOCUS_07530 7355 7975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069832.1 protein_id gnl|my_center|LOCUS_07530 7968 8855 gene locus_tag LOCUS_07540 7968 8855 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347675.1 protein_id gnl|my_center|LOCUS_07540 8861 11203 gene locus_tag LOCUS_07550 8861 11203 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965203.1 protein_id gnl|my_center|LOCUS_07550 11688 11200 gene locus_tag LOCUS_07560 11688 11200 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972415.1 protein_id gnl|my_center|LOCUS_07560 12810 11698 gene locus_tag LOCUS_07570 12810 11698 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838056.1 protein_id gnl|my_center|LOCUS_07570 13544 12807 gene locus_tag LOCUS_07580 13544 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14473 13541 gene locus_tag LOCUS_07590 14473 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15293 14496 gene locus_tag LOCUS_07600 gene flgG 15293 14496 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257272.1 protein_id gnl|my_center|LOCUS_07600 15804 15367 gene locus_tag LOCUS_07610 gene dut 15804 15367 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689546.1 protein_id gnl|my_center|LOCUS_07610 17015 15801 gene locus_tag LOCUS_07620 17015 15801 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157779.1 protein_id gnl|my_center|LOCUS_07620 19219 17129 gene locus_tag LOCUS_07630 gene pnp 19219 17129 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149893.1 protein_id gnl|my_center|LOCUS_07630 19491 19225 gene locus_tag LOCUS_07640 gene rpsO 19491 19225 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562102.1 protein_id gnl|my_center|LOCUS_07640 20452 19517 gene locus_tag LOCUS_07650 gene truB 20452 19517 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082025.1 protein_id gnl|my_center|LOCUS_07650 21333 20512 gene locus_tag LOCUS_07660 21333 20512 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257844.1 protein_id gnl|my_center|LOCUS_07660 21611 21330 gene locus_tag LOCUS_07670 21611 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 22696 22271 gene locus_tag LOCUS_07680 22696 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 25414 22709 gene locus_tag LOCUS_07690 25414 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 26812 25430 gene locus_tag LOCUS_07700 gene nusA 26812 25430 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279228.1 protein_id gnl|my_center|LOCUS_07700 27353 26817 gene locus_tag LOCUS_07710 gene rimP 27353 26817 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172333.1 protein_id gnl|my_center|LOCUS_07710 27427 28548 gene locus_tag LOCUS_07720 27427 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243475.1 protein_id gnl|my_center|LOCUS_07720 28549 30021 gene locus_tag LOCUS_07730 28549 30021 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403120.1 protein_id gnl|my_center|LOCUS_07730 30021 30641 gene locus_tag LOCUS_07740 30021 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508745.1 protein_id gnl|my_center|LOCUS_07740 31648 30893 gene locus_tag LOCUS_07750 31648 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 32403 31645 gene locus_tag LOCUS_07760 32403 31645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 32826 32455 gene locus_tag LOCUS_07770 32826 32455 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278386.1 protein_id gnl|my_center|LOCUS_07770 32856 33692 gene locus_tag LOCUS_07780 32856 33692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 33707 33778 gene locus_tag LOCUS_t00040 33707 33778 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35108 33783 gene locus_tag LOCUS_07790 35108 33783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 35711 36688 gene locus_tag LOCUS_07800 35711 36688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 40311 37087 gene locus_tag LOCUS_07810 40311 37087 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_07810 41369 40335 gene locus_tag LOCUS_07820 41369 40335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 42730 41417 gene locus_tag LOCUS_07830 42730 41417 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_07830 43725 42733 gene locus_tag LOCUS_07840 43725 42733 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_07840 45230 43722 gene locus_tag LOCUS_07850 45230 43722 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_07850 45954 46235 gene locus_tag LOCUS_07860 45954 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 46312 48000 gene locus_tag LOCUS_07870 46312 48000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 48026 49426 gene locus_tag LOCUS_07880 48026 49426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 <50064 49511 gene locus_tag LOCUS_07890 <50064 49511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937781.1:IS481-like element ISDvu4 family transposase >Feature sequence12 1572 583 gene locus_tag LOCUS_07900 1572 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2906 1998 gene locus_tag LOCUS_07910 2906 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3274 4839 gene locus_tag LOCUS_07920 3274 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5647 4841 gene locus_tag LOCUS_07930 5647 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5766 6617 gene locus_tag LOCUS_07940 5766 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6614 7882 gene locus_tag LOCUS_07950 6614 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113892.1 protein_id gnl|my_center|LOCUS_07950 8262 7879 gene locus_tag LOCUS_07960 8262 7879 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_07960 8447 8262 gene locus_tag LOCUS_07970 8447 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 8756 9142 gene locus_tag LOCUS_07980 8756 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 10391 9171 gene locus_tag LOCUS_07990 10391 9171 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_07990 11499 10447 gene locus_tag LOCUS_08000 11499 10447 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_08000 11849 12985 gene locus_tag LOCUS_08010 11849 12985 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112240.1 protein_id gnl|my_center|LOCUS_08010 12973 13959 gene locus_tag LOCUS_08020 12973 13959 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_08020 15257 13962 gene locus_tag LOCUS_08030 15257 13962 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244294.1 protein_id gnl|my_center|LOCUS_08030 15495 16232 gene locus_tag LOCUS_08040 15495 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 16516 16202 gene locus_tag LOCUS_08050 16516 16202 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388230.1 protein_id gnl|my_center|LOCUS_08050 16579 17364 gene locus_tag LOCUS_08060 16579 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18539 17367 gene locus_tag LOCUS_08070 18539 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 19644 18550 gene locus_tag LOCUS_08080 19644 18550 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982414.1 protein_id gnl|my_center|LOCUS_08080 19806 21062 gene locus_tag LOCUS_08090 19806 21062 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228155.1 protein_id gnl|my_center|LOCUS_08090 21066 23414 gene locus_tag LOCUS_08100 21066 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446221.1 protein_id gnl|my_center|LOCUS_08100 23659 23480 gene locus_tag LOCUS_08110 23659 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 24038 23814 gene locus_tag LOCUS_08120 24038 23814 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08120 24787 24155 gene locus_tag LOCUS_08130 24787 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854084.1 protein_id gnl|my_center|LOCUS_08130 24786 25823 gene locus_tag LOCUS_08140 24786 25823 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_08140 26706 25813 gene locus_tag LOCUS_08150 26706 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 27728 26799 gene locus_tag LOCUS_08160 27728 26799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 27830 28258 gene locus_tag LOCUS_08170 27830 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 28255 29028 gene locus_tag LOCUS_08180 28255 29028 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_08180 29032 30366 gene locus_tag LOCUS_08190 29032 30366 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_08190 31315 30476 gene locus_tag LOCUS_08200 31315 30476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 31236 31553 gene locus_tag LOCUS_08210 31236 31553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 33818 31686 gene locus_tag LOCUS_08220 33818 31686 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102225.1 protein_id gnl|my_center|LOCUS_08220 35042 33822 gene locus_tag LOCUS_08230 35042 33822 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972951.1 protein_id gnl|my_center|LOCUS_08230 35273 36130 gene locus_tag LOCUS_08240 35273 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 36127 37680 gene locus_tag LOCUS_08250 gene gltX 36127 37680 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076468.1 protein_id gnl|my_center|LOCUS_08250 37792 38385 gene locus_tag LOCUS_08260 37792 38385 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205720.1 protein_id gnl|my_center|LOCUS_08260 38387 39514 gene locus_tag LOCUS_08270 38387 39514 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_08270 39492 42263 gene locus_tag LOCUS_08280 gene polA 39492 42263 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825981.1 protein_id gnl|my_center|LOCUS_08280 42780 43679 gene locus_tag LOCUS_08290 42780 43679 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016758384.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence13 <1 1032 gene locus_tag LOCUS_08300 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947782.1:IS4-like element ISLpn5 family transposase 1336 4305 gene locus_tag LOCUS_08310 1336 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4302 5699 gene locus_tag LOCUS_08320 4302 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5699 6748 gene locus_tag LOCUS_08330 5699 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6806 7312 gene locus_tag LOCUS_08340 6806 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 7501 7316 gene locus_tag LOCUS_08350 7501 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8792 7548 gene locus_tag LOCUS_08360 8792 7548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_08360 9055 9993 gene locus_tag LOCUS_08370 9055 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974887.1 protein_id gnl|my_center|LOCUS_08370 10219 12558 gene locus_tag LOCUS_08380 10219 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12600 13343 gene locus_tag LOCUS_08390 gene map 12600 13343 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_08390 14342 13347 gene locus_tag LOCUS_08400 14342 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15145 14351 gene locus_tag LOCUS_08410 15145 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15839 15285 gene locus_tag LOCUS_08420 15839 15285 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_08420 15953 16558 gene locus_tag LOCUS_08430 15953 16558 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539242.1 protein_id gnl|my_center|LOCUS_08430 16676 18691 gene locus_tag LOCUS_08440 16676 18691 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777808.1 protein_id gnl|my_center|LOCUS_08440 18691 19383 gene locus_tag LOCUS_08450 18691 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 19507 21573 gene locus_tag LOCUS_08460 19507 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124993.1 protein_id gnl|my_center|LOCUS_08460 21570 21947 gene locus_tag LOCUS_08470 21570 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 23221 21992 gene locus_tag LOCUS_08480 gene lpxB 23221 21992 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212586.1 protein_id gnl|my_center|LOCUS_08480 24047 23190 gene locus_tag LOCUS_08490 gene lpxI 24047 23190 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517125.1 protein_id gnl|my_center|LOCUS_08490 24375 24058 gene locus_tag LOCUS_08500 24375 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 25838 24390 gene locus_tag LOCUS_08510 25838 24390 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231967.1 protein_id gnl|my_center|LOCUS_08510 27406 25862 gene locus_tag LOCUS_08520 27406 25862 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428155.1 protein_id gnl|my_center|LOCUS_08520 28335 27445 gene locus_tag LOCUS_08530 gene sucD 28335 27445 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279904.1 protein_id gnl|my_center|LOCUS_08530 29514 28345 gene locus_tag LOCUS_08540 gene sucC 29514 28345 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690686.1 protein_id gnl|my_center|LOCUS_08540 31477 30077 gene locus_tag LOCUS_08550 31477 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 32410 31682 gene locus_tag LOCUS_08560 32410 31682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 32941 32528 gene locus_tag LOCUS_08570 32941 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 33779 33054 gene locus_tag LOCUS_08580 33779 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 34375 35574 gene locus_tag LOCUS_08590 34375 35574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113497.1 protein_id gnl|my_center|LOCUS_08590 35775 37721 gene locus_tag LOCUS_08600 35775 37721 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_08600 38032 39735 gene locus_tag LOCUS_08610 38032 39735 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 protein_id gnl|my_center|LOCUS_08610 39979 39800 gene locus_tag LOCUS_08620 39979 39800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 40870 41685 gene locus_tag LOCUS_08630 40870 41685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 41678 42148 gene locus_tag LOCUS_08640 41678 42148 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_08640 44102 42156 gene locus_tag LOCUS_08650 44102 42156 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_08650 44970 44206 gene locus_tag LOCUS_08660 44970 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 45725 44982 gene locus_tag LOCUS_08670 45725 44982 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_08670 46820 45792 gene locus_tag LOCUS_08680 46820 45792 CDS product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 protein_id gnl|my_center|LOCUS_08680 47149 46817 gene locus_tag LOCUS_08690 47149 46817 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_08690 47801 47172 gene locus_tag LOCUS_08700 47801 47172 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_08700 49062 47923 gene locus_tag LOCUS_08710 49062 47923 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157564.1 protein_id gnl|my_center|LOCUS_08710 49373 50932 gene locus_tag LOCUS_08720 49373 50932 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_08720 51545 50955 gene locus_tag LOCUS_08730 51545 50955 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_08730 51674 52561 gene locus_tag LOCUS_08740 51674 52561 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113146.1 protein_id gnl|my_center|LOCUS_08740 52568 53803 gene locus_tag LOCUS_08750 52568 53803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 53805 54470 gene locus_tag LOCUS_08760 53805 54470 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 protein_id gnl|my_center|LOCUS_08760 54560 54949 gene locus_tag LOCUS_08770 54560 54949 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_08770 54951 55250 gene locus_tag LOCUS_08780 54951 55250 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_08780 55687 55247 gene locus_tag LOCUS_08790 55687 55247 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655409.1 protein_id gnl|my_center|LOCUS_08790 55865 56491 gene locus_tag LOCUS_08800 55865 56491 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372824.1 protein_id gnl|my_center|LOCUS_08800 56488 57921 gene locus_tag LOCUS_08810 56488 57921 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088214.1 protein_id gnl|my_center|LOCUS_08810 58043 58663 gene locus_tag LOCUS_08820 58043 58663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 58741 59376 gene locus_tag LOCUS_08830 58741 59376 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_08830 60587 59736 gene locus_tag LOCUS_08840 gene purU 60587 59736 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166151.1 protein_id gnl|my_center|LOCUS_08840 60767 61666 gene locus_tag LOCUS_08850 gene rfbA 60767 61666 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_08850 61673 62242 gene locus_tag LOCUS_08860 gene rfbC 61673 62242 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_08860 62235 63092 gene locus_tag LOCUS_08870 gene rfbD 62235 63092 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 protein_id gnl|my_center|LOCUS_08870 63044 64102 gene locus_tag LOCUS_08880 63044 64102 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_08880 64105 65115 gene locus_tag LOCUS_08890 gene rfbB 64105 65115 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_08890 65531 65833 gene locus_tag LOCUS_08900 65531 65833 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_08900 65823 66167 gene locus_tag LOCUS_08910 65823 66167 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_08910 66383 66736 gene locus_tag LOCUS_08920 66383 66736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 66737 67693 gene locus_tag LOCUS_08930 66737 67693 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_08930 67737 68552 gene locus_tag LOCUS_08940 67737 68552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_08940 68610 69260 gene locus_tag LOCUS_08950 gene lpcA 68610 69260 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 protein_id gnl|my_center|LOCUS_08950 69272 70873 gene locus_tag LOCUS_08960 69272 70873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 70860 71423 gene locus_tag LOCUS_08970 70860 71423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 71437 72684 gene locus_tag LOCUS_08980 71437 72684 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088166.1 protein_id gnl|my_center|LOCUS_08980 72693 73439 gene locus_tag LOCUS_08990 72693 73439 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_08990 73587 74750 gene locus_tag LOCUS_09000 73587 74750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 74747 75481 gene locus_tag LOCUS_09010 74747 75481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_09010 75504 76004 gene locus_tag LOCUS_09020 75504 76004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 76006 76530 gene locus_tag LOCUS_09030 76006 76530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 76570 77550 gene locus_tag LOCUS_09040 76570 77550 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_09040 77592 78584 gene locus_tag LOCUS_09050 77592 78584 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_09050 78589 79689 gene locus_tag LOCUS_09060 78589 79689 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 protein_id gnl|my_center|LOCUS_09060 79700 80800 gene locus_tag LOCUS_09070 79700 80800 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_09070 80804 82438 gene locus_tag LOCUS_09080 80804 82438 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776640.1 protein_id gnl|my_center|LOCUS_09080 82445 83245 gene locus_tag LOCUS_09090 82445 83245 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424609.1 protein_id gnl|my_center|LOCUS_09090 83252 84178 gene locus_tag LOCUS_09100 83252 84178 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002733687.1 protein_id gnl|my_center|LOCUS_09100 84214 85008 gene locus_tag LOCUS_09110 84214 85008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479984.1 protein_id gnl|my_center|LOCUS_09110 85005 85397 gene locus_tag LOCUS_09120 85005 85397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715958.1 protein_id gnl|my_center|LOCUS_09120 85401 85829 gene locus_tag LOCUS_09130 85401 85829 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088863.1 protein_id gnl|my_center|LOCUS_09130 85836 86501 gene locus_tag LOCUS_09140 85836 86501 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517243.1 protein_id gnl|my_center|LOCUS_09140 86741 87517 gene locus_tag LOCUS_09150 86741 87517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 88705 88496 gene locus_tag LOCUS_09160 88705 88496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 89110 88817 gene locus_tag LOCUS_09170 89110 88817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 89427 90212 gene locus_tag LOCUS_09180 89427 90212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 90216 91409 gene locus_tag LOCUS_09190 gene lhgO 90216 91409 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_09190 91442 92926 gene locus_tag LOCUS_09200 91442 92926 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163445.1 protein_id gnl|my_center|LOCUS_09200 92938 93648 gene locus_tag LOCUS_09210 92938 93648 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774263.1 protein_id gnl|my_center|LOCUS_09210 93666 94652 gene locus_tag LOCUS_09220 93666 94652 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_09220 94660 95805 gene locus_tag LOCUS_09230 94660 95805 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459668.1 protein_id gnl|my_center|LOCUS_09230 95802 96962 gene locus_tag LOCUS_09240 gene neuC 95802 96962 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_09240 96959 98041 gene locus_tag LOCUS_09250 gene neuB 96959 98041 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403381.1 protein_id gnl|my_center|LOCUS_09250 98054 98689 gene locus_tag LOCUS_09260 98054 98689 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_09260 98695 99744 gene locus_tag LOCUS_09270 98695 99744 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_09270 99723 100664 gene locus_tag LOCUS_09280 99723 100664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088736.1 protein_id gnl|my_center|LOCUS_09280 100646 101368 gene locus_tag LOCUS_09290 100646 101368 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_09290 101355 102125 gene locus_tag LOCUS_09300 101355 102125 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_09300 102141 103265 gene locus_tag LOCUS_09310 gene pseA 102141 103265 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_09310 103259 103885 gene locus_tag LOCUS_09320 gene hisH 103259 103885 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932163.1 protein_id gnl|my_center|LOCUS_09320 103968 104663 gene locus_tag LOCUS_09330 gene hisF 103968 104663 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_09330 104680 105348 gene locus_tag LOCUS_09340 104680 105348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 105356 105868 gene locus_tag LOCUS_09350 105356 105868 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707815.1 protein_id gnl|my_center|LOCUS_09350 105870 106475 gene locus_tag LOCUS_09360 105870 106475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 106472 107146 gene locus_tag LOCUS_09370 106472 107146 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707813.1 protein_id gnl|my_center|LOCUS_09370 107143 109545 gene locus_tag LOCUS_09380 107143 109545 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189188201.1 protein_id gnl|my_center|LOCUS_09380 109575 110558 gene locus_tag LOCUS_09390 109575 110558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 110537 111235 gene locus_tag LOCUS_09400 110537 111235 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254447.1 protein_id gnl|my_center|LOCUS_09400 111236 112039 gene locus_tag LOCUS_09410 111236 112039 CDS product CTP:phosphoglutamine cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858404.1 protein_id gnl|my_center|LOCUS_09410 112056 113822 gene locus_tag LOCUS_09420 112056 113822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 113831 115213 gene locus_tag LOCUS_09430 113831 115213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787359.1 protein_id gnl|my_center|LOCUS_09430 115278 116339 gene locus_tag LOCUS_09440 115278 116339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 116342 117352 gene locus_tag LOCUS_09450 116342 117352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 117342 118040 gene locus_tag LOCUS_09460 117342 118040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 118037 119764 gene locus_tag LOCUS_09470 118037 119764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 119751 120668 gene locus_tag LOCUS_09480 119751 120668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 120694 121137 gene locus_tag LOCUS_09490 120694 121137 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_09490 121134 122513 gene locus_tag LOCUS_09500 121134 122513 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202145.1 protein_id gnl|my_center|LOCUS_09500 122523 123503 gene locus_tag LOCUS_09510 122523 123503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 123487 124593 gene locus_tag LOCUS_09520 123487 124593 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_09520 125974 126408 gene locus_tag LOCUS_09530 125974 126408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 126413 127195 gene locus_tag LOCUS_09540 gene rfbF 126413 127195 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_09540 127177 128289 gene locus_tag LOCUS_09550 gene rfbG 127177 128289 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_09550 128912 128742 gene locus_tag LOCUS_09560 128912 128742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 129401 129928 gene locus_tag LOCUS_09570 129401 129928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 130027 130224 gene locus_tag LOCUS_09580 130027 130224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 130214 131845 gene locus_tag LOCUS_09590 gene rfbH 130214 131845 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_09590 131873 133702 gene locus_tag LOCUS_09600 gene ilvB 131873 133702 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_09600 133709 134599 gene locus_tag LOCUS_09610 133709 134599 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552044.1 protein_id gnl|my_center|LOCUS_09610 134603 135610 gene locus_tag LOCUS_09620 gene dmpG 134603 135610 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749470.1 protein_id gnl|my_center|LOCUS_09620 135621 136664 gene locus_tag LOCUS_09630 135621 136664 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_09630 136684 137721 gene locus_tag LOCUS_09640 136684 137721 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_09640 137700 138638 gene locus_tag LOCUS_09650 137700 138638 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_09650 138669 140309 gene locus_tag LOCUS_09660 138669 140309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 140303 142390 gene locus_tag LOCUS_09670 140303 142390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 142419 144683 gene locus_tag LOCUS_09680 142419 144683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 144827 146095 gene locus_tag LOCUS_09690 144827 146095 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_09690 146182 147312 gene locus_tag LOCUS_09700 146182 147312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 147383 148348 gene locus_tag LOCUS_09710 147383 148348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 148386 149354 gene locus_tag LOCUS_09720 148386 149354 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_09720 149341 150051 gene locus_tag LOCUS_09730 149341 150051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 150094 150933 gene locus_tag LOCUS_09740 150094 150933 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_09740 150980 151828 gene locus_tag LOCUS_09750 150980 151828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 152054 153685 gene locus_tag LOCUS_09760 152054 153685 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_09760 153705 154478 gene locus_tag LOCUS_09770 153705 154478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 154475 155410 gene locus_tag LOCUS_09780 154475 155410 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878673.1 protein_id gnl|my_center|LOCUS_09780 156465 155398 gene locus_tag LOCUS_09790 156465 155398 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202150.1 protein_id gnl|my_center|LOCUS_09790 156748 157809 gene locus_tag LOCUS_09800 156748 157809 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_09800 157821 158882 gene locus_tag LOCUS_09810 157821 158882 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_09810 158885 159643 gene locus_tag LOCUS_09820 158885 159643 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_09820 159640 160992 gene locus_tag LOCUS_09830 159640 160992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 161801 161064 gene locus_tag LOCUS_09840 161801 161064 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_09840 161972 162874 gene locus_tag LOCUS_09850 161972 162874 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675255.1 protein_id gnl|my_center|LOCUS_09850 162871 164568 gene locus_tag LOCUS_09860 162871 164568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 165533 164571 gene locus_tag LOCUS_09870 165533 164571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_09870 165702 165487 gene locus_tag LOCUS_09880 165702 165487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 165632 166438 gene locus_tag LOCUS_09890 165632 166438 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_09890 167931 166441 gene locus_tag LOCUS_09900 167931 166441 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231203.1 protein_id gnl|my_center|LOCUS_09900 168050 169192 gene locus_tag LOCUS_09910 168050 169192 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_09910 169298 170707 gene locus_tag LOCUS_09920 169298 170707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 172157 170751 gene locus_tag LOCUS_09930 172157 170751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005189.1 protein_id gnl|my_center|LOCUS_09930 172357 174129 gene locus_tag LOCUS_09940 172357 174129 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695320.1 protein_id gnl|my_center|LOCUS_09940 174152 175399 gene locus_tag LOCUS_09950 174152 175399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 175405 176448 gene locus_tag LOCUS_09960 175405 176448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 176456 178447 gene locus_tag LOCUS_09970 176456 178447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 178444 180759 gene locus_tag LOCUS_09980 178444 180759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_09980 180764 181795 gene locus_tag LOCUS_09990 180764 181795 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_09990 181788 183068 gene locus_tag LOCUS_10000 181788 183068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 183081 184055 gene locus_tag LOCUS_10010 gene rfaD 183081 184055 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074785.1 protein_id gnl|my_center|LOCUS_10010 184360 184061 gene locus_tag LOCUS_10020 184360 184061 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031888.1 protein_id gnl|my_center|LOCUS_10020 185293 184526 gene locus_tag LOCUS_10030 185293 184526 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351753.1 protein_id gnl|my_center|LOCUS_10030 186316 185621 gene locus_tag LOCUS_10040 186316 185621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129800.1 protein_id gnl|my_center|LOCUS_10040 186533 186604 gene locus_tag LOCUS_t00050 186533 186604 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 186611 186684 gene locus_tag LOCUS_t00060 186611 186684 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 186729 186917 gene locus_tag LOCUS_10050 gene secE 186729 186917 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869352.1 protein_id gnl|my_center|LOCUS_10050 186938 187492 gene locus_tag LOCUS_10060 gene nusG 186938 187492 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536871.1 protein_id gnl|my_center|LOCUS_10060 187525 187953 gene locus_tag LOCUS_10070 gene rplK 187525 187953 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729204.1 protein_id gnl|my_center|LOCUS_10070 187973 188665 gene locus_tag LOCUS_10080 gene rplA 187973 188665 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188789.1 protein_id gnl|my_center|LOCUS_10080 188677 189207 gene locus_tag LOCUS_10090 gene rplJ 188677 189207 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013204.1 protein_id gnl|my_center|LOCUS_10090 189252 189629 gene locus_tag LOCUS_10100 gene rplL 189252 189629 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102400.1 protein_id gnl|my_center|LOCUS_10100 189761 193447 gene locus_tag LOCUS_10110 gene rpoB 189761 193447 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274330.1 protein_id gnl|my_center|LOCUS_10110 193465 197763 gene locus_tag LOCUS_10120 gene rpoC 193465 197763 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256473.1 protein_id gnl|my_center|LOCUS_10120 197880 198254 gene locus_tag LOCUS_10130 gene rpsL 197880 198254 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142358.1 protein_id gnl|my_center|LOCUS_10130 198271 198744 gene locus_tag LOCUS_10140 gene rpsG 198271 198744 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091209.1 protein_id gnl|my_center|LOCUS_10140 198808 200700 gene locus_tag LOCUS_10150 198808 200700 CDS product elongation factor G-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166546.1 protein_id gnl|my_center|LOCUS_10150 200750 201955 gene locus_tag LOCUS_10160 gene tuf 200750 201955 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040571.1 protein_id gnl|my_center|LOCUS_10160 201961 202269 gene locus_tag LOCUS_10170 gene rpsJ 201961 202269 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918607.1 protein_id gnl|my_center|LOCUS_10170 202282 202905 gene locus_tag LOCUS_10180 gene rplC 202282 202905 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051846.1 protein_id gnl|my_center|LOCUS_10180 202914 203552 gene locus_tag LOCUS_10190 gene rplD 202914 203552 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647275.1 protein_id gnl|my_center|LOCUS_10190 203557 203862 gene locus_tag LOCUS_10200 203557 203862 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053134.1 protein_id gnl|my_center|LOCUS_10200 203865 204701 gene locus_tag LOCUS_10210 gene rplB 203865 204701 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511542.1 protein_id gnl|my_center|LOCUS_10210 204715 204993 gene locus_tag LOCUS_10220 gene rpsS 204715 204993 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124500.1 protein_id gnl|my_center|LOCUS_10220 205002 205352 gene locus_tag LOCUS_10230 gene rplV 205002 205352 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387530.1 protein_id gnl|my_center|LOCUS_10230 205356 206036 gene locus_tag LOCUS_10240 gene rpsC 205356 206036 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529953.1 protein_id gnl|my_center|LOCUS_10240 206059 206472 gene locus_tag LOCUS_10250 gene rplP 206059 206472 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950835.1 protein_id gnl|my_center|LOCUS_10250 206469 206741 gene locus_tag LOCUS_10260 206469 206741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 206745 207014 gene locus_tag LOCUS_10270 gene rpsQ 206745 207014 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123883.1 protein_id gnl|my_center|LOCUS_10270 207011 207403 gene locus_tag LOCUS_10280 gene rplN 207011 207403 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615917.1 protein_id gnl|my_center|LOCUS_10280 207405 207788 gene locus_tag LOCUS_10290 gene rplX 207405 207788 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096782.1 protein_id gnl|my_center|LOCUS_10290 207791 208342 gene locus_tag LOCUS_10300 gene rplE 207791 208342 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741297.1 protein_id gnl|my_center|LOCUS_10300 208353 208538 gene locus_tag LOCUS_10310 208353 208538 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002153498.1 protein_id gnl|my_center|LOCUS_10310 208561 208959 gene locus_tag LOCUS_10320 gene rpsH 208561 208959 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062824.1 protein_id gnl|my_center|LOCUS_10320 208984 209523 gene locus_tag LOCUS_10330 gene rplF 208984 209523 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086547.1 protein_id gnl|my_center|LOCUS_10330 209533 209901 gene locus_tag LOCUS_10340 gene rplR 209533 209901 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567189.1 protein_id gnl|my_center|LOCUS_10340 209903 210409 gene locus_tag LOCUS_10350 gene rpsE 209903 210409 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331210.1 protein_id gnl|my_center|LOCUS_10350 210423 210602 gene locus_tag LOCUS_10360 gene rpmD 210423 210602 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874457.1 protein_id gnl|my_center|LOCUS_10360 210607 211146 gene locus_tag LOCUS_10370 gene rplO 210607 211146 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712192.1 protein_id gnl|my_center|LOCUS_10370 211150 212529 gene locus_tag LOCUS_10380 gene secY 211150 212529 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958241.1 protein_id gnl|my_center|LOCUS_10380 212532 213095 gene locus_tag LOCUS_10390 212532 213095 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_10390 213145 213324 gene locus_tag LOCUS_10400 gene infA 213145 213324 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_10400 213453 213833 gene locus_tag LOCUS_10410 gene rpsM 213453 213833 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090769.1 protein_id gnl|my_center|LOCUS_10410 213845 214258 gene locus_tag LOCUS_10420 gene rpsK 213845 214258 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752686.1 protein_id gnl|my_center|LOCUS_10420 214279 214911 gene locus_tag LOCUS_10430 gene rpsD 214279 214911 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135260.1 protein_id gnl|my_center|LOCUS_10430 214944 215921 gene locus_tag LOCUS_10440 214944 215921 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054108.1 protein_id gnl|my_center|LOCUS_10440 215923 216432 gene locus_tag LOCUS_10450 gene rplQ 215923 216432 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042618.1 protein_id gnl|my_center|LOCUS_10450 218554 216539 gene locus_tag LOCUS_10460 218554 216539 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229482.1 protein_id gnl|my_center|LOCUS_10460 218675 219703 gene locus_tag LOCUS_10470 218675 219703 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075198.1 protein_id gnl|my_center|LOCUS_10470 219712 220986 gene locus_tag LOCUS_10480 219712 220986 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111751.1 protein_id gnl|my_center|LOCUS_10480 221066 221139 gene locus_tag LOCUS_t00070 221066 221139 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 221158 221232 gene locus_tag LOCUS_t00080 221158 221232 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 222125 221211 gene locus_tag LOCUS_10490 222125 221211 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082135.1 protein_id gnl|my_center|LOCUS_10490 223005 222091 gene locus_tag LOCUS_10500 223005 222091 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403254.1 protein_id gnl|my_center|LOCUS_10500 223080 223847 gene locus_tag LOCUS_10510 223080 223847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 223939 225435 gene locus_tag LOCUS_10520 223939 225435 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_10520 225472 227535 gene locus_tag LOCUS_10530 225472 227535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 227751 227530 gene locus_tag LOCUS_10540 227751 227530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 229074 228058 gene locus_tag LOCUS_10550 229074 228058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015340.1 protein_id gnl|my_center|LOCUS_10550 229179 229703 gene locus_tag LOCUS_10560 229179 229703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 229693 230349 gene locus_tag LOCUS_10570 229693 230349 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770652.1 protein_id gnl|my_center|LOCUS_10570 230403 231101 gene locus_tag LOCUS_10580 gene ccsA 230403 231101 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702045.1 protein_id gnl|my_center|LOCUS_10580 231108 232247 gene locus_tag LOCUS_10590 231108 232247 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075445.1 protein_id gnl|my_center|LOCUS_10590 232244 233107 gene locus_tag LOCUS_10600 232244 233107 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070066.1 protein_id gnl|my_center|LOCUS_10600 233083 233331 gene locus_tag LOCUS_10610 gene purS 233083 233331 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275007.1 protein_id gnl|my_center|LOCUS_10610 233328 233984 gene locus_tag LOCUS_10620 gene purQ 233328 233984 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686200.1 protein_id gnl|my_center|LOCUS_10620 234036 235319 gene locus_tag LOCUS_10630 234036 235319 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_10630 235440 236678 gene locus_tag LOCUS_10640 235440 236678 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 protein_id gnl|my_center|LOCUS_10640 236774 237526 gene locus_tag LOCUS_10650 gene sufC 236774 237526 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_10650 237527 238711 gene locus_tag LOCUS_10660 gene sufD 237527 238711 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147970.1 protein_id gnl|my_center|LOCUS_10660 238712 239023 gene locus_tag LOCUS_10670 238712 239023 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_10670 239033 240277 gene locus_tag LOCUS_10680 239033 240277 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010075.1 protein_id gnl|my_center|LOCUS_10680 240261 240671 gene locus_tag LOCUS_10690 240261 240671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 240681 241004 gene locus_tag LOCUS_10700 240681 241004 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888483.1 protein_id gnl|my_center|LOCUS_10700 241013 242773 gene locus_tag LOCUS_10710 gene ggt 241013 242773 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809980.1 protein_id gnl|my_center|LOCUS_10710 242776 244377 gene locus_tag LOCUS_10720 gene gshA 242776 244377 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849965.1 protein_id gnl|my_center|LOCUS_10720 244377 245381 gene locus_tag LOCUS_10730 gene gshAB 244377 245381 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191099.1 protein_id gnl|my_center|LOCUS_10730 245620 245378 gene locus_tag LOCUS_10740 245620 245378 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780840.1 protein_id gnl|my_center|LOCUS_10740 245931 245623 gene locus_tag LOCUS_10750 gene grxD 245931 245623 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058137.1 protein_id gnl|my_center|LOCUS_10750 246157 245933 gene locus_tag LOCUS_10760 246157 245933 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150944.1 protein_id gnl|my_center|LOCUS_10760 246831 246160 gene locus_tag LOCUS_10770 246831 246160 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968488.1 protein_id gnl|my_center|LOCUS_10770 247124 246852 gene locus_tag LOCUS_10780 247124 246852 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_10780 247878 247108 gene locus_tag LOCUS_10790 247878 247108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053844.1 protein_id gnl|my_center|LOCUS_10790 248810 247878 gene locus_tag LOCUS_10800 248810 247878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666552.1 protein_id gnl|my_center|LOCUS_10800 249847 248816 gene locus_tag LOCUS_10810 249847 248816 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013216.1 protein_id gnl|my_center|LOCUS_10810 251232 249847 gene locus_tag LOCUS_10820 251232 249847 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_10820 251531 252679 gene locus_tag LOCUS_10830 251531 252679 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_10830 253532 252741 gene locus_tag LOCUS_10840 253532 252741 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_10840 254555 253548 gene locus_tag LOCUS_10850 254555 253548 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815524.1 protein_id gnl|my_center|LOCUS_10850 254768 255664 gene locus_tag LOCUS_10860 254768 255664 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 protein_id gnl|my_center|LOCUS_10860 256352 255654 gene locus_tag LOCUS_10870 256352 255654 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267461.1 protein_id gnl|my_center|LOCUS_10870 256741 256451 gene locus_tag LOCUS_10880 256741 256451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 257739 256999 gene locus_tag LOCUS_10890 257739 256999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_10890 259025 257796 gene locus_tag LOCUS_10900 gene serA 259025 257796 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982325.1 protein_id gnl|my_center|LOCUS_10900 259084 259635 gene locus_tag LOCUS_10910 259084 259635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701520.1 protein_id gnl|my_center|LOCUS_10910 261485 259986 gene locus_tag LOCUS_10920 gene lysS 261485 259986 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004512.1 protein_id gnl|my_center|LOCUS_10920 262118 261486 gene locus_tag LOCUS_10930 262118 261486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115765.1 protein_id gnl|my_center|LOCUS_10930 262228 262309 gene locus_tag LOCUS_t00090 262228 262309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 262932 264626 gene locus_tag LOCUS_10940 262932 264626 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773754.1 protein_id gnl|my_center|LOCUS_10940 265509 264835 gene locus_tag LOCUS_10950 265509 264835 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636905.1 protein_id gnl|my_center|LOCUS_10950 265616 265692 gene locus_tag LOCUS_t00100 265616 265692 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 266780 265761 gene locus_tag LOCUS_10960 gene fliG 266780 265761 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412659.1 protein_id gnl|my_center|LOCUS_10960 266912 267121 gene locus_tag LOCUS_10970 266912 267121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372884.1 protein_id gnl|my_center|LOCUS_10970 268534 267203 gene locus_tag LOCUS_10980 268534 267203 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062320.1 protein_id gnl|my_center|LOCUS_10980 269512 268538 gene locus_tag LOCUS_10990 269512 268538 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_10990 270499 269513 gene locus_tag LOCUS_11000 gene pdhA 270499 269513 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_11000 270610 271893 gene locus_tag LOCUS_11010 270610 271893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869088.1 protein_id gnl|my_center|LOCUS_11010 272204 271941 gene locus_tag LOCUS_11020 272204 271941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 273375 272299 gene locus_tag LOCUS_11030 gene fbp 273375 272299 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110726.1 protein_id gnl|my_center|LOCUS_11030 273401 274234 gene locus_tag LOCUS_11040 273401 274234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 274320 274538 gene locus_tag LOCUS_11050 274320 274538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 274560 275015 gene locus_tag LOCUS_11060 274560 275015 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058095.1 protein_id gnl|my_center|LOCUS_11060 275026 276849 gene locus_tag LOCUS_11070 gene dnaG 275026 276849 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066267.1 protein_id gnl|my_center|LOCUS_11070 276865 278637 gene locus_tag LOCUS_11080 gene rpoD 276865 278637 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429410.1 protein_id gnl|my_center|LOCUS_11080 278746 279807 gene locus_tag LOCUS_11090 278746 279807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 281416 279812 gene locus_tag LOCUS_11100 281416 279812 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165153.1 protein_id gnl|my_center|LOCUS_11100 281509 282735 gene locus_tag LOCUS_11110 gene tyrS 281509 282735 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354445.1 protein_id gnl|my_center|LOCUS_11110 282797 283987 gene locus_tag LOCUS_11120 282797 283987 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947641.1 protein_id gnl|my_center|LOCUS_11120 284010 284384 gene locus_tag LOCUS_11130 284010 284384 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114916.1 protein_id gnl|my_center|LOCUS_11130 287699 284439 gene locus_tag LOCUS_11140 287699 284439 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_11140 288534 287731 gene locus_tag LOCUS_11150 288534 287731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 288468 288393 gene locus_tag LOCUS_t00110 288468 288393 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 288541 288852 gene locus_tag LOCUS_11160 288541 288852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004280.1 protein_id gnl|my_center|LOCUS_11160 288858 291605 gene locus_tag LOCUS_11170 288858 291605 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612757.1 protein_id gnl|my_center|LOCUS_11170 291602 291943 gene locus_tag LOCUS_11180 291602 291943 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406879.1 protein_id gnl|my_center|LOCUS_11180 291992 293644 gene locus_tag LOCUS_11190 291992 293644 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973770.1 protein_id gnl|my_center|LOCUS_11190 293648 296404 gene locus_tag LOCUS_11200 293648 296404 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564921.1 protein_id gnl|my_center|LOCUS_11200 297460 296405 gene locus_tag LOCUS_11210 297460 296405 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_11210 297975 297457 gene locus_tag LOCUS_11220 297975 297457 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599744.1 protein_id gnl|my_center|LOCUS_11220 298472 297993 gene locus_tag LOCUS_11230 298472 297993 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_11230 300969 298483 gene locus_tag LOCUS_11240 300969 298483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 303156 301030 gene locus_tag LOCUS_11250 303156 301030 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_11250 303526 303158 gene locus_tag LOCUS_11260 303526 303158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 303900 303535 gene locus_tag LOCUS_11270 303900 303535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821665.1 protein_id gnl|my_center|LOCUS_11270 305108 303897 gene locus_tag LOCUS_11280 305108 303897 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402080.1 protein_id gnl|my_center|LOCUS_11280 307817 305280 gene locus_tag LOCUS_11290 307817 305280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 308773 307826 gene locus_tag LOCUS_11300 gene ispH 308773 307826 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890370.1 protein_id gnl|my_center|LOCUS_11300 309016 309864 gene locus_tag LOCUS_11310 309016 309864 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586158.1 protein_id gnl|my_center|LOCUS_11310 311237 309927 gene locus_tag LOCUS_11320 311237 309927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 311665 312912 gene locus_tag LOCUS_11330 gene ilvA 311665 312912 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 protein_id gnl|my_center|LOCUS_11330 313581 312955 gene locus_tag LOCUS_11340 gene metW 313581 312955 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_11340 314722 313574 gene locus_tag LOCUS_11350 314722 313574 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005981.1 protein_id gnl|my_center|LOCUS_11350 316040 314736 gene locus_tag LOCUS_11360 316040 314736 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_11360 316208 317791 gene locus_tag LOCUS_11370 316208 317791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166984.1 protein_id gnl|my_center|LOCUS_11370 318517 317756 gene locus_tag LOCUS_11380 318517 317756 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_11380 318949 318518 gene locus_tag LOCUS_11390 318949 318518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 319868 319038 gene locus_tag LOCUS_11400 319868 319038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775825.1 protein_id gnl|my_center|LOCUS_11400 321239 319989 gene locus_tag LOCUS_11410 321239 319989 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098167.1 protein_id gnl|my_center|LOCUS_11410 321324 321839 gene locus_tag LOCUS_11420 gene fliN 321324 321839 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503771.1 protein_id gnl|my_center|LOCUS_11420 321851 322297 gene locus_tag LOCUS_11430 321851 322297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905693.1 protein_id gnl|my_center|LOCUS_11430 322358 323041 gene locus_tag LOCUS_11440 322358 323041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 323285 323746 gene locus_tag LOCUS_11450 323285 323746 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_11450 324752 323820 gene locus_tag LOCUS_11460 324752 323820 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447378.1 protein_id gnl|my_center|LOCUS_11460 325681 324755 gene locus_tag LOCUS_11470 325681 324755 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272390.1 protein_id gnl|my_center|LOCUS_11470 326251 325790 gene locus_tag LOCUS_11480 326251 325790 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883779.1 protein_id gnl|my_center|LOCUS_11480 326350 326790 gene locus_tag LOCUS_11490 326350 326790 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_11490 326787 328223 gene locus_tag LOCUS_11500 gene argH 326787 328223 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136475.1 protein_id gnl|my_center|LOCUS_11500 328216 329100 gene locus_tag LOCUS_11510 328216 329100 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_11510 329097 329693 gene locus_tag LOCUS_11520 329097 329693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141650.1 protein_id gnl|my_center|LOCUS_11520 329788 330744 gene locus_tag LOCUS_11530 329788 330744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621805.1 protein_id gnl|my_center|LOCUS_11530 330741 331766 gene locus_tag LOCUS_11540 gene fliM 330741 331766 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_11540 331784 333133 gene locus_tag LOCUS_11550 331784 333133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 333362 333138 gene locus_tag LOCUS_11560 333362 333138 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201605.1 protein_id gnl|my_center|LOCUS_11560 333616 333359 gene locus_tag LOCUS_11570 333616 333359 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_11570 334019 333618 gene locus_tag LOCUS_11580 gene queF 334019 333618 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_11580 334062 335873 gene locus_tag LOCUS_11590 gene guaA 334062 335873 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_11590 336285 335875 gene locus_tag LOCUS_11600 336285 335875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632834.1 protein_id gnl|my_center|LOCUS_11600 336427 336500 gene locus_tag LOCUS_t00120 336427 336500 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 336560 336645 gene locus_tag LOCUS_t00130 336560 336645 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 338146 336659 gene locus_tag LOCUS_11610 338146 336659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 338589 339422 gene locus_tag LOCUS_11620 338589 339422 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_11620 339406 340167 gene locus_tag LOCUS_11630 339406 340167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500892.1 protein_id gnl|my_center|LOCUS_11630 340157 340744 gene locus_tag LOCUS_11640 gene gmhA 340157 340744 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_11640 340748 341524 gene locus_tag LOCUS_11650 340748 341524 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089498.1 protein_id gnl|my_center|LOCUS_11650 341598 343007 gene locus_tag LOCUS_11660 341598 343007 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268051.1 protein_id gnl|my_center|LOCUS_11660 343057 343863 gene locus_tag LOCUS_11670 343057 343863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 343943 345337 gene locus_tag LOCUS_11680 gene leuC 343943 345337 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855526.1 protein_id gnl|my_center|LOCUS_11680 345348 345974 gene locus_tag LOCUS_11690 gene leuD 345348 345974 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_11690 345986 346366 gene locus_tag LOCUS_11700 345986 346366 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673420.1 protein_id gnl|my_center|LOCUS_11700 346371 347372 gene locus_tag LOCUS_11710 346371 347372 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459126.1 protein_id gnl|my_center|LOCUS_11710 348506 347421 gene locus_tag LOCUS_11720 348506 347421 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_11720 349050 348511 gene locus_tag LOCUS_11730 349050 348511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 349493 349047 gene locus_tag LOCUS_11740 349493 349047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 351347 349623 gene locus_tag LOCUS_11750 351347 349623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 351480 353189 gene locus_tag LOCUS_11760 gene recN 351480 353189 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920921.1 protein_id gnl|my_center|LOCUS_11760 353407 353258 gene locus_tag LOCUS_11770 353407 353258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 353421 353885 gene locus_tag LOCUS_11780 353421 353885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 353892 354323 gene locus_tag LOCUS_11790 353892 354323 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672100.1 protein_id gnl|my_center|LOCUS_11790 354391 357204 gene locus_tag LOCUS_11800 354391 357204 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580979.1 protein_id gnl|my_center|LOCUS_11800 357204 359393 gene locus_tag LOCUS_11810 357204 359393 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378421.1 protein_id gnl|my_center|LOCUS_11810 359446 359889 gene locus_tag LOCUS_11820 359446 359889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 359897 360781 gene locus_tag LOCUS_11830 359897 360781 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084702.1 protein_id gnl|my_center|LOCUS_11830 360775 361911 gene locus_tag LOCUS_11840 360775 361911 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225795.1 protein_id gnl|my_center|LOCUS_11840 362300 361887 gene locus_tag LOCUS_11850 362300 361887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 362405 362821 gene locus_tag LOCUS_11860 362405 362821 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267308.1 protein_id gnl|my_center|LOCUS_11860 362966 364900 gene locus_tag LOCUS_11870 362966 364900 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829697.1 protein_id gnl|my_center|LOCUS_11870 365075 365659 gene locus_tag LOCUS_11880 365075 365659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 366178 365663 gene locus_tag LOCUS_11890 366178 365663 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938166.1 protein_id gnl|my_center|LOCUS_11890 366395 367351 gene locus_tag LOCUS_11900 gene rfaE1 366395 367351 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291586.1 protein_id gnl|my_center|LOCUS_11900 367348 367836 gene locus_tag LOCUS_11910 gene rfaE2 367348 367836 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364507.1 protein_id gnl|my_center|LOCUS_11910 367902 369524 gene locus_tag LOCUS_11920 367902 369524 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091728.1 protein_id gnl|my_center|LOCUS_11920 369526 370374 gene locus_tag LOCUS_11930 gene kdsA 369526 370374 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056080.1 protein_id gnl|my_center|LOCUS_11930 370489 370932 gene locus_tag LOCUS_11940 370489 370932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 370929 372317 gene locus_tag LOCUS_11950 370929 372317 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621222.1 protein_id gnl|my_center|LOCUS_11950 372364 373071 gene locus_tag LOCUS_11960 gene lptB 372364 373071 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_11960 373124 374497 gene locus_tag LOCUS_11970 gene rpoN 373124 374497 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_11970 374501 375463 gene locus_tag LOCUS_11980 gene hprK 374501 375463 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_11980 375438 375716 gene locus_tag LOCUS_11990 375438 375716 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658909.1 protein_id gnl|my_center|LOCUS_11990 375703 377526 gene locus_tag LOCUS_12000 375703 377526 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997519.1 protein_id gnl|my_center|LOCUS_12000 377532 378890 gene locus_tag LOCUS_12010 377532 378890 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688483.1 protein_id gnl|my_center|LOCUS_12010 378894 379715 gene locus_tag LOCUS_12020 378894 379715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358369.1 protein_id gnl|my_center|LOCUS_12020 379723 381681 gene locus_tag LOCUS_12030 gene priA 379723 381681 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000641110.1 protein_id gnl|my_center|LOCUS_12030 381726 382679 gene locus_tag LOCUS_12040 gene fmt 381726 382679 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690652.1 protein_id gnl|my_center|LOCUS_12040 382676 383695 gene locus_tag LOCUS_12050 382676 383695 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071115.1 protein_id gnl|my_center|LOCUS_12050 383700 384347 gene locus_tag LOCUS_12060 gene rpe 383700 384347 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702819.1 protein_id gnl|my_center|LOCUS_12060 384407 384664 gene locus_tag LOCUS_12070 gene rpsP 384407 384664 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240010.1 protein_id gnl|my_center|LOCUS_12070 384680 384910 gene locus_tag LOCUS_12080 384680 384910 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391865.1 protein_id gnl|my_center|LOCUS_12080 384900 385439 gene locus_tag LOCUS_12090 gene rimM 384900 385439 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159892.1 protein_id gnl|my_center|LOCUS_12090 385429 386082 gene locus_tag LOCUS_12100 gene trmD 385429 386082 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671159.1 protein_id gnl|my_center|LOCUS_12100 386091 386537 gene locus_tag LOCUS_12110 gene rplS 386091 386537 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072661.1 protein_id gnl|my_center|LOCUS_12110 386651 387229 gene locus_tag LOCUS_12120 386651 387229 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114916.1 protein_id gnl|my_center|LOCUS_12120 387213 387866 gene locus_tag LOCUS_12130 387213 387866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 387863 388123 gene locus_tag LOCUS_12140 387863 388123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 388158 389342 gene locus_tag LOCUS_12150 388158 389342 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712870.1 protein_id gnl|my_center|LOCUS_12150 389350 389694 gene locus_tag LOCUS_12160 389350 389694 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_12160 389797 389997 gene locus_tag LOCUS_12170 389797 389997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836436.1 protein_id gnl|my_center|LOCUS_12170 391480 389999 gene locus_tag LOCUS_12180 391480 389999 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798677.1 protein_id gnl|my_center|LOCUS_12180 391659 391982 gene locus_tag LOCUS_12190 391659 391982 CDS product type II secretion system-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004758673.1 protein_id gnl|my_center|LOCUS_12190 391994 392980 gene locus_tag LOCUS_12200 391994 392980 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267376.1 protein_id gnl|my_center|LOCUS_12200 393011 393925 gene locus_tag LOCUS_12210 393011 393925 CDS product general secretion pathway protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991320.1 protein_id gnl|my_center|LOCUS_12210 393927 395702 gene locus_tag LOCUS_12220 gene gspD 393927 395702 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017090.1 protein_id gnl|my_center|LOCUS_12220 395699 397375 gene locus_tag LOCUS_12230 gene gspE 395699 397375 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_12230 397382 398608 gene locus_tag LOCUS_12240 397382 398608 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029466.1 protein_id gnl|my_center|LOCUS_12240 398628 399101 gene locus_tag LOCUS_12250 gene gspG 398628 399101 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054085.1 protein_id gnl|my_center|LOCUS_12250 399102 399740 gene locus_tag LOCUS_12260 399102 399740 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865319.1 protein_id gnl|my_center|LOCUS_12260 399667 400236 gene locus_tag LOCUS_12270 399667 400236 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632227.1 protein_id gnl|my_center|LOCUS_12270 400236 400868 gene locus_tag LOCUS_12280 400236 400868 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053413.1 protein_id gnl|my_center|LOCUS_12280 400888 401931 gene locus_tag LOCUS_12290 400888 401931 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771807.1 protein_id gnl|my_center|LOCUS_12290 401935 403554 gene locus_tag LOCUS_12300 401935 403554 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471275.1 protein_id gnl|my_center|LOCUS_12300 403554 404078 gene locus_tag LOCUS_12310 403554 404078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459773.1 protein_id gnl|my_center|LOCUS_12310 404081 405076 gene locus_tag LOCUS_12320 404081 405076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 408859 405212 gene locus_tag LOCUS_12330 408859 405212 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_12330 409086 409161 gene locus_tag LOCUS_t00140 409086 409161 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 409325 410029 gene locus_tag LOCUS_12340 409325 410029 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_12340 410180 410503 gene locus_tag LOCUS_12350 410180 410503 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_12350 410510 410974 gene locus_tag LOCUS_12360 410510 410974 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_12360 410981 411352 gene locus_tag LOCUS_12370 410981 411352 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_12370 411442 412017 gene locus_tag LOCUS_12380 411442 412017 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_12380 412431 412045 gene locus_tag LOCUS_12390 412431 412045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 412865 412428 gene locus_tag LOCUS_12400 412865 412428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 413266 412865 gene locus_tag LOCUS_12410 413266 412865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 413652 414491 gene locus_tag LOCUS_12420 413652 414491 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346255.1 protein_id gnl|my_center|LOCUS_12420 414848 416389 gene locus_tag LOCUS_12430 414848 416389 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615749.1 protein_id gnl|my_center|LOCUS_12430 416831 416364 gene locus_tag LOCUS_12440 416831 416364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 417674 416838 gene locus_tag LOCUS_12450 417674 416838 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_12450 417888 417664 gene locus_tag LOCUS_12460 417888 417664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 418129 418818 gene locus_tag LOCUS_12470 418129 418818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_12470 418837 420762 gene locus_tag LOCUS_12480 418837 420762 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_12480 420764 421507 gene locus_tag LOCUS_12490 420764 421507 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_12490 422577 421627 gene locus_tag LOCUS_12500 422577 421627 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12500 423538 422582 gene locus_tag LOCUS_12510 423538 422582 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050843.1 protein_id gnl|my_center|LOCUS_12510 425408 423603 gene locus_tag LOCUS_12520 gene lepA 425408 423603 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280999.1 protein_id gnl|my_center|LOCUS_12520 425533 426834 gene locus_tag LOCUS_12530 gene eno 425533 426834 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018115.1 protein_id gnl|my_center|LOCUS_12530 426837 427298 gene locus_tag LOCUS_12540 426837 427298 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631735.1 protein_id gnl|my_center|LOCUS_12540 427300 427908 gene locus_tag LOCUS_12550 427300 427908 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_12550 427901 428920 gene locus_tag LOCUS_12560 427901 428920 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093472.1 protein_id gnl|my_center|LOCUS_12560 428940 430325 gene locus_tag LOCUS_12570 428940 430325 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_12570 430329 431702 gene locus_tag LOCUS_12580 430329 431702 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_12580 431702 432250 gene locus_tag LOCUS_12590 431702 432250 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088908.1 protein_id gnl|my_center|LOCUS_12590 432251 432829 gene locus_tag LOCUS_12600 432251 432829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 433632 432880 gene locus_tag LOCUS_12610 433632 432880 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797975.1 protein_id gnl|my_center|LOCUS_12610 433995 433639 gene locus_tag LOCUS_12620 433995 433639 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602531.1 protein_id gnl|my_center|LOCUS_12620 434072 434386 gene locus_tag LOCUS_12630 434072 434386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865509.1 protein_id gnl|my_center|LOCUS_12630 434418 435938 gene locus_tag LOCUS_12640 434418 435938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810942.1 protein_id gnl|my_center|LOCUS_12640 436030 436449 gene locus_tag LOCUS_12650 436030 436449 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969787.1 protein_id gnl|my_center|LOCUS_12650 436564 438156 gene locus_tag LOCUS_12660 436564 438156 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_12660 438271 440271 gene locus_tag LOCUS_12670 438271 440271 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082083.1 protein_id gnl|my_center|LOCUS_12670 440268 441140 gene locus_tag LOCUS_12680 440268 441140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009261.1 protein_id gnl|my_center|LOCUS_12680 441906 441103 gene locus_tag LOCUS_12690 441906 441103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531352.1 protein_id gnl|my_center|LOCUS_12690 443269 441965 gene locus_tag LOCUS_12700 gene asnS 443269 441965 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005296.1 protein_id gnl|my_center|LOCUS_12700 443325 444182 gene locus_tag LOCUS_12710 gene folD 443325 444182 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070308.1 protein_id gnl|my_center|LOCUS_12710 444185 445153 gene locus_tag LOCUS_12720 444185 445153 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007972.1 protein_id gnl|my_center|LOCUS_12720 445159 446613 gene locus_tag LOCUS_12730 gene cysS 445159 446613 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_12730 446595 447362 gene locus_tag LOCUS_12740 gene rlmB 446595 447362 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060589244.1 protein_id gnl|my_center|LOCUS_12740 447374 448459 gene locus_tag LOCUS_12750 447374 448459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804872.1 protein_id gnl|my_center|LOCUS_12750 450215 448479 gene locus_tag LOCUS_12760 450215 448479 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_12760 450979 450212 gene locus_tag LOCUS_12770 gene hisF 450979 450212 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067921.1 protein_id gnl|my_center|LOCUS_12770 452453 450981 gene locus_tag LOCUS_12780 gene gatA 452453 450981 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002775.1 protein_id gnl|my_center|LOCUS_12780 452734 452450 gene locus_tag LOCUS_12790 452734 452450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 454155 452749 gene locus_tag LOCUS_12800 454155 452749 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_12800 457088 454155 gene locus_tag LOCUS_12810 457088 454155 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131037.1 protein_id gnl|my_center|LOCUS_12810 457330 457725 gene locus_tag LOCUS_12820 457330 457725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 458818 457727 gene locus_tag LOCUS_12830 458818 457727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 458913 460910 gene locus_tag LOCUS_12840 458913 460910 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982183.1 protein_id gnl|my_center|LOCUS_12840 460958 461524 gene locus_tag LOCUS_12850 460958 461524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 462354 461575 gene locus_tag LOCUS_12860 462354 461575 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_12860 464484 462385 gene locus_tag LOCUS_12870 464484 462385 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 protein_id gnl|my_center|LOCUS_12870 464551 464763 gene locus_tag LOCUS_12880 464551 464763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553425.1 protein_id gnl|my_center|LOCUS_12880 464872 465195 gene locus_tag LOCUS_12890 464872 465195 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406135.1 protein_id gnl|my_center|LOCUS_12890 466785 465202 gene locus_tag LOCUS_12900 466785 465202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 468212 466782 gene locus_tag LOCUS_12910 468212 466782 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749356.1 protein_id gnl|my_center|LOCUS_12910 468377 469441 gene locus_tag LOCUS_12920 468377 469441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 470785 469442 gene locus_tag LOCUS_12930 470785 469442 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928215.1 protein_id gnl|my_center|LOCUS_12930 472056 470845 gene locus_tag LOCUS_12940 472056 470845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_12940 472851 472060 gene locus_tag LOCUS_12950 472851 472060 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_12950 473073 474965 gene locus_tag LOCUS_12960 473073 474965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807168.1 protein_id gnl|my_center|LOCUS_12960 474968 475675 gene locus_tag LOCUS_12970 474968 475675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135390.1 protein_id gnl|my_center|LOCUS_12970 476247 475678 gene locus_tag LOCUS_12980 476247 475678 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873141.1 protein_id gnl|my_center|LOCUS_12980 477912 476263 gene locus_tag LOCUS_12990 477912 476263 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961616.1 protein_id gnl|my_center|LOCUS_12990 479000 477909 gene locus_tag LOCUS_13000 479000 477909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_13000 479037 480425 gene locus_tag LOCUS_13010 479037 480425 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841153.1 protein_id gnl|my_center|LOCUS_13010 480463 480963 gene locus_tag LOCUS_13020 gene purE 480463 480963 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093510.1 protein_id gnl|my_center|LOCUS_13020 480988 482103 gene locus_tag LOCUS_13030 480988 482103 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926285.1 protein_id gnl|my_center|LOCUS_13030 483546 482104 gene locus_tag LOCUS_13040 gene murC 483546 482104 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377539.1 protein_id gnl|my_center|LOCUS_13040 484635 483550 gene locus_tag LOCUS_13050 484635 483550 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836517.1 protein_id gnl|my_center|LOCUS_13050 485774 484632 gene locus_tag LOCUS_13060 485774 484632 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606798.1 protein_id gnl|my_center|LOCUS_13060 486891 485779 gene locus_tag LOCUS_13070 gene mraY 486891 485779 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500387.1 protein_id gnl|my_center|LOCUS_13070 488428 486902 gene locus_tag LOCUS_13080 488428 486902 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782604.1 protein_id gnl|my_center|LOCUS_13080 488781 488425 gene locus_tag LOCUS_13090 488781 488425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 489701 488778 gene locus_tag LOCUS_13100 gene rsmH 489701 488778 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445614.1 protein_id gnl|my_center|LOCUS_13100 489763 490287 gene locus_tag LOCUS_13110 489763 490287 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390240.1 protein_id gnl|my_center|LOCUS_13110 491141 490284 gene locus_tag LOCUS_13120 491141 490284 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002145390.1 protein_id gnl|my_center|LOCUS_13120 491212 491961 gene locus_tag LOCUS_13130 491212 491961 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690058.1 protein_id gnl|my_center|LOCUS_13130 492604 491963 gene locus_tag LOCUS_13140 492604 491963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017889.1 protein_id gnl|my_center|LOCUS_13140 494070 492643 gene locus_tag LOCUS_13150 494070 492643 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_13150 495906 494086 gene locus_tag LOCUS_13160 495906 494086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 497119 496064 gene locus_tag LOCUS_13170 497119 496064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 497173 497598 gene locus_tag LOCUS_13180 497173 497598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216953.1 protein_id gnl|my_center|LOCUS_13180 497675 499120 gene locus_tag LOCUS_13190 497675 499120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 499392 500204 gene locus_tag LOCUS_13200 499392 500204 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_13200 500651 500205 gene locus_tag LOCUS_13210 500651 500205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 500879 502822 gene locus_tag LOCUS_13220 500879 502822 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_13220 503078 503449 gene locus_tag LOCUS_13230 503078 503449 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388817.1 protein_id gnl|my_center|LOCUS_13230 505305 503503 gene locus_tag LOCUS_13240 gene typA 505305 503503 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405892.1 protein_id gnl|my_center|LOCUS_13240 505420 505728 gene locus_tag LOCUS_13250 gene rplU 505420 505728 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270913.1 protein_id gnl|my_center|LOCUS_13250 505729 506052 gene locus_tag LOCUS_13260 505729 506052 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619377.1 protein_id gnl|my_center|LOCUS_13260 506064 506321 gene locus_tag LOCUS_13270 gene rpmA 506064 506321 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_13270 506406 507425 gene locus_tag LOCUS_13280 gene obgE 506406 507425 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443450.1 protein_id gnl|my_center|LOCUS_13280 507415 508290 gene locus_tag LOCUS_13290 gene proB 507415 508290 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801906.1 protein_id gnl|my_center|LOCUS_13290 508287 509546 gene locus_tag LOCUS_13300 508287 509546 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658464.1 protein_id gnl|my_center|LOCUS_13300 509549 510142 gene locus_tag LOCUS_13310 gene nadD 509549 510142 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016925.1 protein_id gnl|my_center|LOCUS_13310 510145 510741 gene locus_tag LOCUS_13320 gene yqeK 510145 510741 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174866.1 protein_id gnl|my_center|LOCUS_13320 510743 511897 gene locus_tag LOCUS_13330 510743 511897 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133081.1 protein_id gnl|my_center|LOCUS_13330 511899 512264 gene locus_tag LOCUS_13340 gene rsfS 511899 512264 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070122.1 protein_id gnl|my_center|LOCUS_13340 514323 512251 gene locus_tag LOCUS_13350 514323 512251 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984949.1 protein_id gnl|my_center|LOCUS_13350 514492 516144 gene locus_tag LOCUS_13360 514492 516144 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291493.1 protein_id gnl|my_center|LOCUS_13360 516144 517325 gene locus_tag LOCUS_13370 516144 517325 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683294.1 protein_id gnl|my_center|LOCUS_13370 517491 518252 gene locus_tag LOCUS_13380 517491 518252 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908875.1 protein_id gnl|my_center|LOCUS_13380 518663 518253 gene locus_tag LOCUS_13390 518663 518253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 520059 518743 gene locus_tag LOCUS_13400 520059 518743 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205134.1 protein_id gnl|my_center|LOCUS_13400 521123 520056 gene locus_tag LOCUS_13410 521123 520056 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_13410 522223 521120 gene locus_tag LOCUS_13420 522223 521120 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287368.1 protein_id gnl|my_center|LOCUS_13420 522301 522771 gene locus_tag LOCUS_13430 gene bfr 522301 522771 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_13430 522930 523916 gene locus_tag LOCUS_13440 522930 523916 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181054.1 protein_id gnl|my_center|LOCUS_13440 523927 525084 gene locus_tag LOCUS_13450 523927 525084 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016360.1 protein_id gnl|my_center|LOCUS_13450 525081 525422 gene locus_tag LOCUS_13460 525081 525422 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194243.1 protein_id gnl|my_center|LOCUS_13460 526116 525406 gene locus_tag LOCUS_13470 526116 525406 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190719.1 protein_id gnl|my_center|LOCUS_13470 527092 526100 gene locus_tag LOCUS_13480 527092 526100 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038596.1 protein_id gnl|my_center|LOCUS_13480 528290 527070 gene locus_tag LOCUS_13490 528290 527070 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097878.1 protein_id gnl|my_center|LOCUS_13490 528344 529018 gene locus_tag LOCUS_13500 528344 529018 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215708.1 protein_id gnl|my_center|LOCUS_13500 529089 529886 gene locus_tag LOCUS_13510 529089 529886 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112541.1 protein_id gnl|my_center|LOCUS_13510 529947 531158 gene locus_tag LOCUS_13520 529947 531158 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239790.1 protein_id gnl|my_center|LOCUS_13520 532392 531292 gene locus_tag LOCUS_13530 gene mqnC 532392 531292 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146501.1 protein_id gnl|my_center|LOCUS_13530 532519 534603 gene locus_tag LOCUS_13540 532519 534603 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_13540 536568 534979 gene locus_tag LOCUS_13550 536568 534979 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207220.1 protein_id gnl|my_center|LOCUS_13550 536705 538738 gene locus_tag LOCUS_13560 536705 538738 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545443.1 protein_id gnl|my_center|LOCUS_13560 538797 540737 gene locus_tag LOCUS_13570 538797 540737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 541302 540688 gene locus_tag LOCUS_13580 541302 540688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 541735 541310 gene locus_tag LOCUS_13590 541735 541310 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665953.1 protein_id gnl|my_center|LOCUS_13590 541821 542645 gene locus_tag LOCUS_13600 541821 542645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682938.1 protein_id gnl|my_center|LOCUS_13600 543473 542646 gene locus_tag LOCUS_13610 543473 542646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078824.1 protein_id gnl|my_center|LOCUS_13610 545173 543548 gene locus_tag LOCUS_13620 545173 543548 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651428.1 protein_id gnl|my_center|LOCUS_13620 546461 545166 gene locus_tag LOCUS_13630 gene miaB 546461 545166 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_13630 546637 547245 gene locus_tag LOCUS_13640 546637 547245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 548380 547238 gene locus_tag LOCUS_13650 548380 547238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 549821 548388 gene locus_tag LOCUS_13660 549821 548388 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 protein_id gnl|my_center|LOCUS_13660 551025 549856 gene locus_tag LOCUS_13670 551025 549856 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_13670 551082 553661 gene locus_tag LOCUS_13680 551082 553661 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464922.1 protein_id gnl|my_center|LOCUS_13680 554507 553680 gene locus_tag LOCUS_13690 554507 553680 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070489.1 protein_id gnl|my_center|LOCUS_13690 555234 554542 gene locus_tag LOCUS_13700 555234 554542 CDS product lipoprotein LipL31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742261.1 protein_id gnl|my_center|LOCUS_13700 558756 555304 gene locus_tag LOCUS_13710 gene mfd 558756 555304 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654016.1 protein_id gnl|my_center|LOCUS_13710 559617 558766 gene locus_tag LOCUS_13720 gene panC 559617 558766 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634432.1 protein_id gnl|my_center|LOCUS_13720 560909 559614 gene locus_tag LOCUS_13730 gene hisD 560909 559614 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007465.1 protein_id gnl|my_center|LOCUS_13730 562154 560955 gene locus_tag LOCUS_13740 562154 560955 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267213.1 protein_id gnl|my_center|LOCUS_13740 564267 562144 gene locus_tag LOCUS_13750 564267 562144 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876410.1 protein_id gnl|my_center|LOCUS_13750 567095 564276 gene locus_tag LOCUS_13760 567095 564276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 567146 567916 gene locus_tag LOCUS_13770 567146 567916 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002068111.1 protein_id gnl|my_center|LOCUS_13770 567948 568925 gene locus_tag LOCUS_13780 567948 568925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 569473 568943 gene locus_tag LOCUS_13790 569473 568943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274115.1 protein_id gnl|my_center|LOCUS_13790 571037 569634 gene locus_tag LOCUS_13800 gene mgtE 571037 569634 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_13800 571220 571792 gene locus_tag LOCUS_13810 571220 571792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 571782 572837 gene locus_tag LOCUS_13820 571782 572837 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802062.1 protein_id gnl|my_center|LOCUS_13820 572834 573796 gene locus_tag LOCUS_13830 572834 573796 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340844.1 protein_id gnl|my_center|LOCUS_13830 574764 573793 gene locus_tag LOCUS_13840 574764 573793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 577697 574761 gene locus_tag LOCUS_13850 gene uvrA 577697 574761 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156251.1 protein_id gnl|my_center|LOCUS_13850 577874 579433 gene locus_tag LOCUS_13860 gene sppA 577874 579433 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489490.1 protein_id gnl|my_center|LOCUS_13860 580450 579437 gene locus_tag LOCUS_13870 580450 579437 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293686.1 protein_id gnl|my_center|LOCUS_13870 581915 580455 gene locus_tag LOCUS_13880 581915 580455 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929871.1 protein_id gnl|my_center|LOCUS_13880 582209 582919 gene locus_tag LOCUS_13890 582209 582919 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070937.1 protein_id gnl|my_center|LOCUS_13890 582933 583706 gene locus_tag LOCUS_13900 582933 583706 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_13900 584085 583726 gene locus_tag LOCUS_13910 584085 583726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 584289 585302 gene locus_tag LOCUS_13920 584289 585302 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_13920 585356 585700 gene locus_tag LOCUS_13930 585356 585700 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_13930 585697 586071 gene locus_tag LOCUS_13940 585697 586071 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666507.1 protein_id gnl|my_center|LOCUS_13940 586078 587799 gene locus_tag LOCUS_13950 586078 587799 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050379.1 protein_id gnl|my_center|LOCUS_13950 588775 589293 gene locus_tag LOCUS_13960 588775 589293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 589297 590814 gene locus_tag LOCUS_13970 589297 590814 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116258.1 protein_id gnl|my_center|LOCUS_13970 590820 591905 gene locus_tag LOCUS_13980 gene hisC 590820 591905 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 protein_id gnl|my_center|LOCUS_13980 591995 592408 gene locus_tag LOCUS_13990 591995 592408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_13990 592875 592477 gene locus_tag LOCUS_14000 592875 592477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 593329 592886 gene locus_tag LOCUS_14010 593329 592886 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833896.1 protein_id gnl|my_center|LOCUS_14010 593481 593942 gene locus_tag LOCUS_14020 593481 593942 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023796.1 protein_id gnl|my_center|LOCUS_14020 593944 594474 gene locus_tag LOCUS_14030 593944 594474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 596780 594516 gene locus_tag LOCUS_14040 gene clpA 596780 594516 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982061.1 protein_id gnl|my_center|LOCUS_14040 597115 596780 gene locus_tag LOCUS_14050 gene clpS 597115 596780 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279894.1 protein_id gnl|my_center|LOCUS_14050 598202 597105 gene locus_tag LOCUS_14060 598202 597105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376590.1 protein_id gnl|my_center|LOCUS_14060 601457 598308 gene locus_tag LOCUS_14070 601457 598308 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_14070 602120 601482 gene locus_tag LOCUS_14080 602120 601482 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142687.1 protein_id gnl|my_center|LOCUS_14080 602185 602655 gene locus_tag LOCUS_14090 602185 602655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 602660 603781 gene locus_tag LOCUS_14100 602660 603781 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572375.1 protein_id gnl|my_center|LOCUS_14100 603774 605057 gene locus_tag LOCUS_14110 gene xseA 603774 605057 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390226.1 protein_id gnl|my_center|LOCUS_14110 605060 605332 gene locus_tag LOCUS_14120 605060 605332 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230450.1 protein_id gnl|my_center|LOCUS_14120 605339 606742 gene locus_tag LOCUS_14130 605339 606742 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_14130 607760 606708 gene locus_tag LOCUS_14140 607760 606708 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_14140 607806 609218 gene locus_tag LOCUS_14150 607806 609218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489983.1 protein_id gnl|my_center|LOCUS_14150 609344 609991 gene locus_tag LOCUS_14160 609344 609991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_14160 610000 610788 gene locus_tag LOCUS_14170 610000 610788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_14170 610823 611596 gene locus_tag LOCUS_14180 610823 611596 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087254.1 protein_id gnl|my_center|LOCUS_14180 611848 612753 gene locus_tag LOCUS_14190 gene lpxC 611848 612753 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_14190 612815 614545 gene locus_tag LOCUS_14200 gene ptsP 612815 614545 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621277.1 protein_id gnl|my_center|LOCUS_14200 615908 614604 gene locus_tag LOCUS_14210 615908 614604 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383078.1 protein_id gnl|my_center|LOCUS_14210 616444 615884 gene locus_tag LOCUS_14220 616444 615884 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708720.1 protein_id gnl|my_center|LOCUS_14220 616651 617523 gene locus_tag LOCUS_14230 616651 617523 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586159.1 protein_id gnl|my_center|LOCUS_14230 617627 618361 gene locus_tag LOCUS_14240 617627 618361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 618775 618458 gene locus_tag LOCUS_14250 618775 618458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 618867 620222 gene locus_tag LOCUS_14260 618867 620222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 621175 620219 gene locus_tag LOCUS_14270 621175 620219 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787928.1 protein_id gnl|my_center|LOCUS_14270 621967 621197 gene locus_tag LOCUS_14280 621967 621197 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692259.1 protein_id gnl|my_center|LOCUS_14280 622063 622437 gene locus_tag LOCUS_14290 622063 622437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 622444 623940 gene locus_tag LOCUS_14300 622444 623940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 623976 625850 gene locus_tag LOCUS_14310 623976 625850 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_14310 628475 625869 gene locus_tag LOCUS_14320 gene pepN 628475 625869 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043025.1 protein_id gnl|my_center|LOCUS_14320 628800 628519 gene locus_tag LOCUS_14330 628800 628519 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958057.1 protein_id gnl|my_center|LOCUS_14330 628946 630592 gene locus_tag LOCUS_14340 628946 630592 CDS product REC domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348938.1 protein_id gnl|my_center|LOCUS_14340 630589 631707 gene locus_tag LOCUS_14350 630589 631707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 634169 631704 gene locus_tag LOCUS_14360 634169 631704 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983065.1 protein_id gnl|my_center|LOCUS_14360 634284 634583 gene locus_tag LOCUS_14370 634284 634583 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808563.1 protein_id gnl|my_center|LOCUS_14370 635480 634605 gene locus_tag LOCUS_14380 635480 634605 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_14380 635586 636989 gene locus_tag LOCUS_14390 gene leuC 635586 636989 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855526.1 protein_id gnl|my_center|LOCUS_14390 636986 637606 gene locus_tag LOCUS_14400 gene leuD 636986 637606 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480538.1 protein_id gnl|my_center|LOCUS_14400 637884 637657 gene locus_tag LOCUS_14410 637884 637657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 638700 638035 gene locus_tag LOCUS_14420 638700 638035 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_14420 639164 638730 gene locus_tag LOCUS_14430 639164 638730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14430 639451 639987 gene locus_tag LOCUS_14440 639451 639987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 641577 639967 gene locus_tag LOCUS_14450 gene xylB 641577 639967 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_14450 641706 642929 gene locus_tag LOCUS_14460 641706 642929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_14460 643434 645209 gene locus_tag LOCUS_14470 643434 645209 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739012.1 protein_id gnl|my_center|LOCUS_14470 647291 645219 gene locus_tag LOCUS_14480 647291 645219 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027599.1 protein_id gnl|my_center|LOCUS_14480 647505 648149 gene locus_tag LOCUS_14490 647505 648149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 648283 648927 gene locus_tag LOCUS_14500 648283 648927 CDS product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104309.1 protein_id gnl|my_center|LOCUS_14500 649214 648936 gene locus_tag LOCUS_14510 649214 648936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 652371 649378 gene locus_tag LOCUS_14520 652371 649378 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583365.1 protein_id gnl|my_center|LOCUS_14520 655454 652368 gene locus_tag LOCUS_14530 655454 652368 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844282.1 protein_id gnl|my_center|LOCUS_14530 656962 655451 gene locus_tag LOCUS_14540 656962 655451 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584332.1 protein_id gnl|my_center|LOCUS_14540 657646 656966 gene locus_tag LOCUS_14550 657646 656966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 658174 657650 gene locus_tag LOCUS_14560 658174 657650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 658955 658269 gene locus_tag LOCUS_14570 658955 658269 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071785.1 protein_id gnl|my_center|LOCUS_14570 660570 658960 gene locus_tag LOCUS_14580 660570 658960 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222562.1 protein_id gnl|my_center|LOCUS_14580 662151 660712 gene locus_tag LOCUS_14590 662151 660712 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824683.1 protein_id gnl|my_center|LOCUS_14590 662859 663521 gene locus_tag LOCUS_14600 662859 663521 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581670.1 protein_id gnl|my_center|LOCUS_14600 664034 664234 gene locus_tag LOCUS_14610 664034 664234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 664239 665366 gene locus_tag LOCUS_14620 664239 665366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734588.1 protein_id gnl|my_center|LOCUS_14620 666519 665368 gene locus_tag LOCUS_14630 666519 665368 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231431.1 protein_id gnl|my_center|LOCUS_14630 666639 668081 gene locus_tag LOCUS_14640 666639 668081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 669327 668671 gene locus_tag LOCUS_14650 669327 668671 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358596.1 protein_id gnl|my_center|LOCUS_14650 669413 670882 gene locus_tag LOCUS_14660 669413 670882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 670913 671569 gene locus_tag LOCUS_14670 670913 671569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 671566 672216 gene locus_tag LOCUS_14680 671566 672216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 673244 672213 gene locus_tag LOCUS_14690 673244 672213 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_14690 674023 673388 gene locus_tag LOCUS_14700 gene degU 674023 673388 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 protein_id gnl|my_center|LOCUS_14700 677121 674038 gene locus_tag LOCUS_14710 677121 674038 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_14710 677711 679180 gene locus_tag LOCUS_14720 677711 679180 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367388.1 protein_id gnl|my_center|LOCUS_14720 679775 679185 gene locus_tag LOCUS_14730 679775 679185 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268942.1 protein_id gnl|my_center|LOCUS_14730 680404 679799 gene locus_tag LOCUS_14740 680404 679799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 680828 680385 gene locus_tag LOCUS_14750 680828 680385 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 protein_id gnl|my_center|LOCUS_14750 681072 680830 gene locus_tag LOCUS_14760 681072 680830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 682074 681073 gene locus_tag LOCUS_14770 gene moaA 682074 681073 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881434.1 protein_id gnl|my_center|LOCUS_14770 682151 683224 gene locus_tag LOCUS_14780 gene moeB 682151 683224 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_14780 685377 683221 gene locus_tag LOCUS_14790 685377 683221 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_14790 686834 685473 gene locus_tag LOCUS_14800 686834 685473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_14800 688241 687048 gene locus_tag LOCUS_14810 688241 687048 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135617729.1 protein_id gnl|my_center|LOCUS_14810 689152 688238 gene locus_tag LOCUS_14820 gene moaCB 689152 688238 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_14820 689953 689162 gene locus_tag LOCUS_14830 689953 689162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 690339 689959 gene locus_tag LOCUS_14840 690339 689959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14840 692469 690349 gene locus_tag LOCUS_14850 gene nirB 692469 690349 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 692872 692483 gene locus_tag LOCUS_14860 692872 692483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 693295 696795 gene locus_tag LOCUS_14870 693295 696795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 696995 697261 gene locus_tag LOCUS_14880 696995 697261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991776.1 protein_id gnl|my_center|LOCUS_14880 697748 698938 gene locus_tag LOCUS_14890 697748 698938 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_14890 698967 700058 gene locus_tag LOCUS_14900 698967 700058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 700105 700539 gene locus_tag LOCUS_14910 700105 700539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 700554 701042 gene locus_tag LOCUS_14920 700554 701042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 701462 701127 gene locus_tag LOCUS_14930 701462 701127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 703253 702009 gene locus_tag LOCUS_14940 703253 702009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_14940 703853 703272 gene locus_tag LOCUS_14950 703853 703272 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_14950 704038 704481 gene locus_tag LOCUS_14960 gene soxR 704038 704481 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_14960 705454 704537 gene locus_tag LOCUS_14970 705454 704537 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_14970 706324 705494 gene locus_tag LOCUS_14980 706324 705494 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 protein_id gnl|my_center|LOCUS_14980 707001 706612 gene locus_tag LOCUS_14990 707001 706612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 707688 707110 gene locus_tag LOCUS_15000 707688 707110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049763.1 protein_id gnl|my_center|LOCUS_15000 708540 707740 gene locus_tag LOCUS_15010 708540 707740 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_15010 709552 708563 gene locus_tag LOCUS_15020 709552 708563 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_15020 710650 709592 gene locus_tag LOCUS_15030 710650 709592 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_15030 710844 711788 gene locus_tag LOCUS_15040 710844 711788 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213786.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence14 194 661 gene locus_tag LOCUS_15050 194 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1078 767 gene locus_tag LOCUS_15060 1078 767 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_15060 1906 1235 gene locus_tag LOCUS_15070 1906 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1944 2576 gene locus_tag LOCUS_15080 1944 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3090 4289 gene locus_tag LOCUS_15090 3090 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4286 4600 gene locus_tag LOCUS_15100 4286 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5067 4597 gene locus_tag LOCUS_15110 5067 4597 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116457.1 protein_id gnl|my_center|LOCUS_15110 5178 5777 gene locus_tag LOCUS_15120 5178 5777 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_15120 6354 5800 gene locus_tag LOCUS_15130 6354 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6912 7625 gene locus_tag LOCUS_15140 6912 7625 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890311.1 protein_id gnl|my_center|LOCUS_15140 7622 8170 gene locus_tag LOCUS_15150 7622 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8701 9195 gene locus_tag LOCUS_15160 8701 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 9208 10494 gene locus_tag LOCUS_15170 9208 10494 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_15170 10540 10800 gene locus_tag LOCUS_15180 10540 10800 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004496206.1 protein_id gnl|my_center|LOCUS_15180 10778 11194 gene locus_tag LOCUS_15190 10778 11194 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_15190 13120 11201 gene locus_tag LOCUS_15200 13120 11201 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_15200 13569 13123 gene locus_tag LOCUS_15210 13569 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13726 14937 gene locus_tag LOCUS_15220 13726 14937 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 protein_id gnl|my_center|LOCUS_15220 14973 15899 gene locus_tag LOCUS_15230 14973 15899 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625202.1 protein_id gnl|my_center|LOCUS_15230 18001 15896 gene locus_tag LOCUS_15240 gene mdoH 18001 15896 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298322.1 protein_id gnl|my_center|LOCUS_15240 18393 17998 gene locus_tag LOCUS_15250 18393 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 19954 18371 gene locus_tag LOCUS_15260 19954 18371 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_15260 21685 20000 gene locus_tag LOCUS_15270 21685 20000 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230747.1 protein_id gnl|my_center|LOCUS_15270 21788 23266 gene locus_tag LOCUS_15280 21788 23266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 23267 25054 gene locus_tag LOCUS_15290 23267 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 25067 25957 gene locus_tag LOCUS_15300 25067 25957 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_15300 25959 27011 gene locus_tag LOCUS_15310 25959 27011 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753043.1 protein_id gnl|my_center|LOCUS_15310 27812 27015 gene locus_tag LOCUS_15320 27812 27015 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922156.1 protein_id gnl|my_center|LOCUS_15320 29063 28038 gene locus_tag LOCUS_15330 29063 28038 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_15330 29844 29065 gene locus_tag LOCUS_15340 29844 29065 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491112.1 protein_id gnl|my_center|LOCUS_15340 30854 29841 gene locus_tag LOCUS_15350 30854 29841 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 protein_id gnl|my_center|LOCUS_15350 31711 30836 gene locus_tag LOCUS_15360 31711 30836 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_15360 31838 32575 gene locus_tag LOCUS_15370 31838 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 32681 33544 gene locus_tag LOCUS_15380 32681 33544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 33565 34167 gene locus_tag LOCUS_15390 33565 34167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 34193 34357 gene locus_tag LOCUS_15400 34193 34357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 34403 36979 gene locus_tag LOCUS_15410 34403 36979 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_15410 37101 37772 gene locus_tag LOCUS_15420 37101 37772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 38076 37792 gene locus_tag LOCUS_15430 38076 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 38886 40637 gene locus_tag LOCUS_15440 38886 40637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 41135 40824 gene locus_tag LOCUS_15450 41135 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 41300 43033 gene locus_tag LOCUS_15460 41300 43033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence15 6036 115 gene locus_tag LOCUS_15470 6036 115 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833420.1 protein_id gnl|my_center|LOCUS_15470 6120 7025 gene locus_tag LOCUS_15480 6120 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7026 8417 gene locus_tag LOCUS_15490 7026 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032052.1 protein_id gnl|my_center|LOCUS_15490 8414 9004 gene locus_tag LOCUS_15500 8414 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9640 10242 gene locus_tag LOCUS_15510 9640 10242 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_15510 11136 10483 gene locus_tag LOCUS_15520 11136 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11406 11825 gene locus_tag LOCUS_15530 11406 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11835 13001 gene locus_tag LOCUS_15540 11835 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 13024 17217 gene locus_tag LOCUS_15550 13024 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 17229 19166 gene locus_tag LOCUS_15560 17229 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 19173 22820 gene locus_tag LOCUS_15570 19173 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 protein_id gnl|my_center|LOCUS_15570 22834 24906 gene locus_tag LOCUS_15580 22834 24906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 25296 27467 gene locus_tag LOCUS_15590 25296 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 28047 27532 gene locus_tag LOCUS_15600 28047 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 28811 28194 gene locus_tag LOCUS_15610 28811 28194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 29083 31131 gene locus_tag LOCUS_15620 gene cerN 29083 31131 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_15620 31708 31190 gene locus_tag LOCUS_15630 31708 31190 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895908.1 protein_id gnl|my_center|LOCUS_15630 31886 32470 gene locus_tag LOCUS_15640 31886 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 32535 35282 gene locus_tag LOCUS_15650 gene ileS 32535 35282 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005314.1 protein_id gnl|my_center|LOCUS_15650 35323 35664 gene locus_tag LOCUS_15660 35323 35664 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_15660 37339 35720 gene locus_tag LOCUS_15670 gene murJ 37339 35720 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063338.1 protein_id gnl|my_center|LOCUS_15670 38303 37371 gene locus_tag LOCUS_15680 38303 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 39297 38308 gene locus_tag LOCUS_15690 39297 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence16 387 2333 gene locus_tag LOCUS_15700 387 2333 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483790.1 protein_id gnl|my_center|LOCUS_15700 2894 2304 gene locus_tag LOCUS_15710 2894 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3294 2926 gene locus_tag LOCUS_15720 3294 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3397 4425 gene locus_tag LOCUS_15730 3397 4425 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_15730 6318 4405 gene locus_tag LOCUS_15740 6318 4405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_15740 6370 6630 gene locus_tag LOCUS_15750 6370 6630 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457916.1 protein_id gnl|my_center|LOCUS_15750 6709 7434 gene locus_tag LOCUS_15760 gene tatC 6709 7434 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165498.1 protein_id gnl|my_center|LOCUS_15760 7424 8533 gene locus_tag LOCUS_15770 7424 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9276 8776 gene locus_tag LOCUS_15780 9276 8776 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_15780 10863 9583 gene locus_tag LOCUS_15790 gene clpX 10863 9583 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085747.1 protein_id gnl|my_center|LOCUS_15790 11477 10878 gene locus_tag LOCUS_15800 gene clpP 11477 10878 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111455.1 protein_id gnl|my_center|LOCUS_15800 12824 11481 gene locus_tag LOCUS_15810 gene tig 12824 11481 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384982.1 protein_id gnl|my_center|LOCUS_15810 13008 12937 gene locus_tag LOCUS_t00150 13008 12937 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13766 13074 gene locus_tag LOCUS_15820 gene tenA 13766 13074 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403111.1 protein_id gnl|my_center|LOCUS_15820 14703 14053 gene locus_tag LOCUS_15830 14703 14053 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_15830 16138 15017 gene locus_tag LOCUS_15840 16138 15017 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_15840 16299 18065 gene locus_tag LOCUS_15850 16299 18065 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621166.1 protein_id gnl|my_center|LOCUS_15850 18606 18097 gene locus_tag LOCUS_15860 18606 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 19796 18654 gene locus_tag LOCUS_15870 19796 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 19843 21147 gene locus_tag LOCUS_15880 gene murA 19843 21147 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257925.1 protein_id gnl|my_center|LOCUS_15880 21148 21825 gene locus_tag LOCUS_15890 21148 21825 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080163.1 protein_id gnl|my_center|LOCUS_15890 22054 22368 gene locus_tag LOCUS_15900 22054 22368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802848.1 protein_id gnl|my_center|LOCUS_15900 22546 23331 gene locus_tag LOCUS_15910 22546 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 23450 24814 gene locus_tag LOCUS_15920 gene fliI 23450 24814 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570583.1 protein_id gnl|my_center|LOCUS_15920 25141 25740 gene locus_tag LOCUS_15930 gene fliJ 25141 25740 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819760.1 protein_id gnl|my_center|LOCUS_15930 25744 26400 gene locus_tag LOCUS_15940 25744 26400 CDS product flagellar protein FlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157730.1 protein_id gnl|my_center|LOCUS_15940 26948 26355 gene locus_tag LOCUS_15950 26948 26355 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010664.1 protein_id gnl|my_center|LOCUS_15950 27226 26945 gene locus_tag LOCUS_15960 27226 26945 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077420.1 protein_id gnl|my_center|LOCUS_15960 28180 27239 gene locus_tag LOCUS_15970 28180 27239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418449.1 protein_id gnl|my_center|LOCUS_15970 28524 28237 gene locus_tag LOCUS_15980 28524 28237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 30528 28537 gene locus_tag LOCUS_15990 30528 28537 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535110.1 protein_id gnl|my_center|LOCUS_15990 31338 30538 gene locus_tag LOCUS_16000 gene whiG 31338 30538 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_16000 31916 31443 gene locus_tag LOCUS_16010 31916 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053201.1 protein_id gnl|my_center|LOCUS_16010 32845 31922 gene locus_tag LOCUS_16020 32845 31922 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371638.1 protein_id gnl|my_center|LOCUS_16020 34235 32886 gene locus_tag LOCUS_16030 gene flhF 34235 32886 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393528.1 protein_id gnl|my_center|LOCUS_16030 35304 35158 gene locus_tag LOCUS_16040 35304 35158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 35929 35525 gene locus_tag LOCUS_16050 35929 35525 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_16050 36859 36536 gene locus_tag LOCUS_16060 36859 36536 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_16060 37101 36853 gene locus_tag LOCUS_16070 37101 36853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 37520 38089 gene locus_tag LOCUS_16080 37520 38089 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240088.1 protein_id gnl|my_center|LOCUS_16080 38719 38315 gene locus_tag LOCUS_16090 38719 38315 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_16090 38946 38716 gene locus_tag LOCUS_16100 38946 38716 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence17 1227 298 gene locus_tag LOCUS_16110 1227 298 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_16110 1678 1337 gene locus_tag LOCUS_16120 1678 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2062 2916 gene locus_tag LOCUS_16130 2062 2916 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_16130 3008 3568 gene locus_tag LOCUS_16140 gene pyrE 3008 3568 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913344.1 protein_id gnl|my_center|LOCUS_16140 3565 4326 gene locus_tag LOCUS_16150 3565 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5228 4323 gene locus_tag LOCUS_16160 5228 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275305.1 protein_id gnl|my_center|LOCUS_16160 5864 5268 gene locus_tag LOCUS_16170 5864 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 7752 5818 gene locus_tag LOCUS_16180 7752 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 8435 7749 gene locus_tag LOCUS_16190 8435 7749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184524.1 protein_id gnl|my_center|LOCUS_16190 8511 8807 gene locus_tag LOCUS_16200 8511 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 8845 10575 gene locus_tag LOCUS_16210 8845 10575 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636544.1 protein_id gnl|my_center|LOCUS_16210 10575 11459 gene locus_tag LOCUS_16220 10575 11459 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402671.1 protein_id gnl|my_center|LOCUS_16220 11468 12079 gene locus_tag LOCUS_16230 11468 12079 CDS product formate hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536349.1 protein_id gnl|my_center|LOCUS_16230 12076 13293 gene locus_tag LOCUS_16240 12076 13293 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048143.1 protein_id gnl|my_center|LOCUS_16240 13286 14710 gene locus_tag LOCUS_16250 13286 14710 CDS product metal (Ni/Fe) hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258168.1 protein_id gnl|my_center|LOCUS_16250 14707 15525 gene locus_tag LOCUS_16260 14707 15525 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835439.1 protein_id gnl|my_center|LOCUS_16260 15531 16763 gene locus_tag LOCUS_16270 15531 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 17607 16765 gene locus_tag LOCUS_16280 17607 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 18829 17705 gene locus_tag LOCUS_16290 18829 17705 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162390.1 protein_id gnl|my_center|LOCUS_16290 20202 18889 gene locus_tag LOCUS_16300 20202 18889 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884774.1 protein_id gnl|my_center|LOCUS_16300 20249 22315 gene locus_tag LOCUS_16310 20249 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 23031 22312 gene locus_tag LOCUS_16320 23031 22312 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_16320 23420 23034 gene locus_tag LOCUS_16330 23420 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 24610 23672 gene locus_tag LOCUS_16340 24610 23672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 25594 24614 gene locus_tag LOCUS_16350 25594 24614 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_16350 25886 27277 gene locus_tag LOCUS_16360 gene amt 25886 27277 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_16360 27299 27643 gene locus_tag LOCUS_16370 27299 27643 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_16370 28678 27797 gene locus_tag LOCUS_16380 28678 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 28846 29703 gene locus_tag LOCUS_16390 28846 29703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_16390 29688 30299 gene locus_tag LOCUS_16400 29688 30299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074910.1 protein_id gnl|my_center|LOCUS_16400 30512 30793 gene locus_tag LOCUS_16410 30512 30793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 30850 31533 gene locus_tag LOCUS_16420 30850 31533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 31526 31963 gene locus_tag LOCUS_16430 31526 31963 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199454.1 protein_id gnl|my_center|LOCUS_16430 32025 33938 gene locus_tag LOCUS_16440 gene thrS 32025 33938 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284473.1 protein_id gnl|my_center|LOCUS_16440 34366 35478 gene locus_tag LOCUS_16450 34366 35478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence18 1910 2761 gene locus_tag LOCUS_16460 1910 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2977 3207 gene locus_tag LOCUS_16470 2977 3207 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_16470 3207 3605 gene locus_tag LOCUS_16480 3207 3605 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_16480 3759 3995 gene locus_tag LOCUS_16490 3759 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3996 4397 gene locus_tag LOCUS_16500 3996 4397 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_16500 5758 4439 gene locus_tag LOCUS_16510 gene eat 5758 4439 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766903.1 protein_id gnl|my_center|LOCUS_16510 6121 6507 gene locus_tag LOCUS_16520 6121 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809191.1 protein_id gnl|my_center|LOCUS_16520 8220 6625 gene locus_tag LOCUS_16530 gene pckA 8220 6625 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148872.1 protein_id gnl|my_center|LOCUS_16530 8354 9721 gene locus_tag LOCUS_16540 gene glgA 8354 9721 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_16540 9900 9772 gene locus_tag LOCUS_16550 9900 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10241 11656 gene locus_tag LOCUS_16560 10241 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11754 13139 gene locus_tag LOCUS_16570 11754 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 14070 13174 gene locus_tag LOCUS_16580 14070 13174 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_16580 14198 15055 gene locus_tag LOCUS_16590 14198 15055 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_16590 15146 15520 gene locus_tag LOCUS_16600 15146 15520 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241135.1 protein_id gnl|my_center|LOCUS_16600 15521 16354 gene locus_tag LOCUS_16610 15521 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 16825 16400 gene locus_tag LOCUS_16620 16825 16400 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719965.1 protein_id gnl|my_center|LOCUS_16620 17477 16845 gene locus_tag LOCUS_16630 17477 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 17543 18004 gene locus_tag LOCUS_16640 17543 18004 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_16640 18401 19201 gene locus_tag LOCUS_16650 18401 19201 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463536.1 protein_id gnl|my_center|LOCUS_16650 19637 19278 gene locus_tag LOCUS_16660 19637 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 19787 20029 gene locus_tag LOCUS_16670 19787 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 20239 20535 gene locus_tag LOCUS_16680 20239 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 20582 21079 gene locus_tag LOCUS_16690 20582 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 22292 21303 gene locus_tag LOCUS_16700 gene arsS 22292 21303 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986518.1 protein_id gnl|my_center|LOCUS_16700 22659 22321 gene locus_tag LOCUS_16710 22659 22321 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_16710 24269 22779 gene locus_tag LOCUS_16720 24269 22779 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049411.1 protein_id gnl|my_center|LOCUS_16720 27349 24269 gene locus_tag LOCUS_16730 27349 24269 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947422.1 protein_id gnl|my_center|LOCUS_16730 27327 27551 gene locus_tag LOCUS_16740 27327 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 28385 27609 gene locus_tag LOCUS_16750 28385 27609 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947682.1 protein_id gnl|my_center|LOCUS_16750 30433 28385 gene locus_tag LOCUS_16760 30433 28385 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_16760 30714 30502 gene locus_tag LOCUS_16770 30714 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499820.1 protein_id gnl|my_center|LOCUS_16770 30880 31110 gene locus_tag LOCUS_16780 30880 31110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167091.1 protein_id gnl|my_center|LOCUS_16780 31205 32854 gene locus_tag LOCUS_16790 31205 32854 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200401.1 protein_id gnl|my_center|LOCUS_16790 33100 33852 gene locus_tag LOCUS_16800 33100 33852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 33924 34313 gene locus_tag LOCUS_16810 33924 34313 CDS product YvaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080905.1 protein_id gnl|my_center|LOCUS_16810 34603 34310 gene locus_tag LOCUS_16820 34603 34310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 35027 34614 gene locus_tag LOCUS_16830 35027 34614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence19 900 265 gene locus_tag LOCUS_16840 900 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 845 2284 gene locus_tag LOCUS_16850 845 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777604.1 protein_id gnl|my_center|LOCUS_16850 3168 2281 gene locus_tag LOCUS_16860 3168 2281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188441.1 protein_id gnl|my_center|LOCUS_16860 4606 3242 gene locus_tag LOCUS_16870 4606 3242 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675217.1 protein_id gnl|my_center|LOCUS_16870 6056 4596 gene locus_tag LOCUS_16880 6056 4596 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039575.1 protein_id gnl|my_center|LOCUS_16880 6945 6049 gene locus_tag LOCUS_16890 6945 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588742.1 protein_id gnl|my_center|LOCUS_16890 7093 7941 gene locus_tag LOCUS_16900 7093 7941 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983600.1 protein_id gnl|my_center|LOCUS_16900 7998 8465 gene locus_tag LOCUS_16910 7998 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 8467 9309 gene locus_tag LOCUS_16920 8467 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 9805 9398 gene locus_tag LOCUS_16930 9805 9398 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_16930 10408 9854 gene locus_tag LOCUS_16940 10408 9854 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_16940 12296 10551 gene locus_tag LOCUS_16950 12296 10551 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_16950 12523 12320 gene locus_tag LOCUS_16960 gene csrA 12523 12320 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_16960 13024 12563 gene locus_tag LOCUS_16970 gene fliW 13024 12563 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_16970 14306 13038 gene locus_tag LOCUS_16980 14306 13038 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223330.1 protein_id gnl|my_center|LOCUS_16980 16221 14308 gene locus_tag LOCUS_16990 gene flgK 16221 14308 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535890.1 protein_id gnl|my_center|LOCUS_16990 16740 16234 gene locus_tag LOCUS_17000 16740 16234 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806831.1 protein_id gnl|my_center|LOCUS_17000 17329 17042 gene locus_tag LOCUS_17010 17329 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802848.1 protein_id gnl|my_center|LOCUS_17010 17590 17913 gene locus_tag LOCUS_17020 17590 17913 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_17020 17922 18536 gene locus_tag LOCUS_17030 17922 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747363.1 protein_id gnl|my_center|LOCUS_17030 19179 18523 gene locus_tag LOCUS_17040 gene aat 19179 18523 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651373.1 protein_id gnl|my_center|LOCUS_17040 19387 20565 gene locus_tag LOCUS_17050 19387 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 20562 20942 gene locus_tag LOCUS_17060 20562 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 21032 21508 gene locus_tag LOCUS_17070 21032 21508 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_17070 21501 21851 gene locus_tag LOCUS_17080 21501 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 21964 22251 gene locus_tag LOCUS_17090 21964 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 22333 23010 gene locus_tag LOCUS_17100 22333 23010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_17100 23003 24367 gene locus_tag LOCUS_17110 23003 24367 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254665.1 protein_id gnl|my_center|LOCUS_17110 24398 25573 gene locus_tag LOCUS_17120 gene argJ 24398 25573 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123874.1 protein_id gnl|my_center|LOCUS_17120 25570 26844 gene locus_tag LOCUS_17130 25570 26844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955956.1 protein_id gnl|my_center|LOCUS_17130 26841 29210 gene locus_tag LOCUS_17140 26841 29210 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244388.1 protein_id gnl|my_center|LOCUS_17140 29382 30116 gene locus_tag LOCUS_17150 29382 30116 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_17150 30174 31112 gene locus_tag LOCUS_17160 30174 31112 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744700.1 protein_id gnl|my_center|LOCUS_17160 31109 32233 gene locus_tag LOCUS_17170 31109 32233 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence20 2242 383 gene locus_tag LOCUS_17180 gene uvrC 2242 383 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114128.1 protein_id gnl|my_center|LOCUS_17180 2356 2886 gene locus_tag LOCUS_17190 gene lepB 2356 2886 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091635.1 protein_id gnl|my_center|LOCUS_17190 2891 3805 gene locus_tag LOCUS_17200 2891 3805 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108007.1 protein_id gnl|my_center|LOCUS_17200 3802 4779 gene locus_tag LOCUS_17210 3802 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4783 5265 gene locus_tag LOCUS_17220 4783 5265 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763232.1 protein_id gnl|my_center|LOCUS_17220 5328 7052 gene locus_tag LOCUS_17230 5328 7052 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_17230 7151 7618 gene locus_tag LOCUS_17240 7151 7618 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_17240 7615 9654 gene locus_tag LOCUS_17250 7615 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 9666 11435 gene locus_tag LOCUS_17260 9666 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 12952 11483 gene locus_tag LOCUS_17270 12952 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 13865 13131 gene locus_tag LOCUS_17280 13865 13131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114678736.1 protein_id gnl|my_center|LOCUS_17280 15301 13862 gene locus_tag LOCUS_17290 15301 13862 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202873.1 protein_id gnl|my_center|LOCUS_17290 15716 15321 gene locus_tag LOCUS_17300 15716 15321 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_17300 16744 15719 gene locus_tag LOCUS_17310 16744 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 17174 16737 gene locus_tag LOCUS_17320 17174 16737 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_17320 20057 17190 gene locus_tag LOCUS_17330 20057 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 21689 20127 gene locus_tag LOCUS_17340 21689 20127 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043663.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence21 801 1691 gene locus_tag LOCUS_17350 801 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2928 2032 gene locus_tag LOCUS_17360 2928 2032 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016758384.1 protein_id gnl|my_center|LOCUS_17360 3845 4681 gene locus_tag LOCUS_17370 3845 4681 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559672.1 protein_id gnl|my_center|LOCUS_17370 5376 4789 gene locus_tag LOCUS_17380 5376 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177673.1 protein_id gnl|my_center|LOCUS_17380 6200 5484 gene locus_tag LOCUS_17390 6200 5484 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 protein_id gnl|my_center|LOCUS_17390 6297 6602 gene locus_tag LOCUS_17400 6297 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6653 7069 gene locus_tag LOCUS_17410 6653 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 7086 8567 gene locus_tag LOCUS_17420 7086 8567 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393930.1 protein_id gnl|my_center|LOCUS_17420 8667 9842 gene locus_tag LOCUS_17430 8667 9842 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_17430 10582 9839 gene locus_tag LOCUS_17440 10582 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 11547 10579 gene locus_tag LOCUS_17450 11547 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11597 12343 gene locus_tag LOCUS_17460 11597 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 12340 13464 gene locus_tag LOCUS_17470 12340 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13467 14366 gene locus_tag LOCUS_17480 13467 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 15107 16642 gene locus_tag LOCUS_17490 15107 16642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_17490 17876 16629 gene locus_tag LOCUS_17500 17876 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 18544 19290 gene locus_tag LOCUS_17510 18544 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 19360 20034 gene locus_tag LOCUS_17520 19360 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 20146 20376 gene locus_tag LOCUS_17530 20146 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 20601 20945 gene locus_tag LOCUS_17540 20601 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 21003 21194 gene locus_tag LOCUS_17550 21003 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 21667 21305 gene locus_tag LOCUS_17560 21667 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence22 978 388 gene locus_tag LOCUS_17570 978 388 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099241.1 protein_id gnl|my_center|LOCUS_17570 1495 1163 gene locus_tag LOCUS_17580 1495 1163 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_17580 1557 2945 gene locus_tag LOCUS_17590 gene murD 1557 2945 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671544.1 protein_id gnl|my_center|LOCUS_17590 3057 3419 gene locus_tag LOCUS_17600 3057 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4244 3510 gene locus_tag LOCUS_17610 4244 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6232 4241 gene locus_tag LOCUS_17620 6232 4241 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_17620 9673 7319 gene locus_tag LOCUS_17630 9673 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11168 9774 gene locus_tag LOCUS_17640 gene flgE 11168 9774 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_17640 11787 11206 gene locus_tag LOCUS_17650 11787 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 13482 11803 gene locus_tag LOCUS_17660 13482 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence23 1414 461 gene locus_tag LOCUS_17670 1414 461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228200.1 protein_id gnl|my_center|LOCUS_17670 1604 2581 gene locus_tag LOCUS_17680 1604 2581 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114421.1 protein_id gnl|my_center|LOCUS_17680 3383 2784 gene locus_tag LOCUS_17690 3383 2784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089643.1 protein_id gnl|my_center|LOCUS_17690 3639 4043 gene locus_tag LOCUS_17700 3639 4043 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_17700 4040 5083 gene locus_tag LOCUS_17710 4040 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5497 8751 gene locus_tag LOCUS_17720 5497 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8761 9498 gene locus_tag LOCUS_17730 8761 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9678 9493 gene locus_tag LOCUS_17740 9678 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 9656 10690 gene locus_tag LOCUS_17750 9656 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 10704 11135 gene locus_tag LOCUS_17760 10704 11135 CDS product bacitracin resistance protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007616.1 protein_id gnl|my_center|LOCUS_17760 11270 11635 gene locus_tag LOCUS_17770 11270 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence24 295 939 gene locus_tag LOCUS_17780 295 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1658 879 gene locus_tag LOCUS_17790 1658 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2827 1973 gene locus_tag LOCUS_17800 2827 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 4027 2924 gene locus_tag LOCUS_17810 4027 2924 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_17810 6004 4403 gene locus_tag LOCUS_17820 gene nadB 6004 4403 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137375.1 protein_id gnl|my_center|LOCUS_17820 7836 6001 gene locus_tag LOCUS_17830 7836 6001 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053693.1 protein_id gnl|my_center|LOCUS_17830 7949 8884 gene locus_tag LOCUS_17840 7949 8884 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129545.1 protein_id gnl|my_center|LOCUS_17840 9620 8853 gene locus_tag LOCUS_17850 9620 8853 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865287.1 protein_id gnl|my_center|LOCUS_17850 9693 10214 gene locus_tag LOCUS_17860 9693 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 10332 11219 gene locus_tag LOCUS_17870 gene miaA 10332 11219 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143821.1 protein_id gnl|my_center|LOCUS_17870 11248 11499 gene locus_tag LOCUS_17880 gene hfq 11248 11499 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274793.1 protein_id gnl|my_center|LOCUS_17880 11565 12635 gene locus_tag LOCUS_17890 11565 12635 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070779.1 protein_id gnl|my_center|LOCUS_17890 12866 13537 gene locus_tag LOCUS_17900 12866 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534539.1 protein_id gnl|my_center|LOCUS_17900 13559 14038 gene locus_tag LOCUS_17910 13559 14038 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093551.1 protein_id gnl|my_center|LOCUS_17910 14054 14791 gene locus_tag LOCUS_17920 14054 14791 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465176.1 protein_id gnl|my_center|LOCUS_17920 15467 14763 gene locus_tag LOCUS_17930 15467 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163651.1 protein_id gnl|my_center|LOCUS_17930 15565 17628 gene locus_tag LOCUS_17940 15565 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278782.1 protein_id gnl|my_center|LOCUS_17940 18115 17612 gene locus_tag LOCUS_17950 18115 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859768.1 protein_id gnl|my_center|LOCUS_17950 18351 18166 gene locus_tag LOCUS_17960 18351 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 19535 18402 gene locus_tag LOCUS_17970 gene pgsW 19535 18402 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078607.1 protein_id gnl|my_center|LOCUS_17970 19990 19532 gene locus_tag LOCUS_17980 gene pgsC 19990 19532 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_17980 21110 19983 gene locus_tag LOCUS_17990 21110 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21286 23682 gene locus_tag LOCUS_18000 21286 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 24010 23672 gene locus_tag LOCUS_18010 gene spoIIAA 24010 23672 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_18010 26130 24055 gene locus_tag LOCUS_18020 26130 24055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 27787 26138 gene locus_tag LOCUS_18030 gene gpmI 27787 26138 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_18030 28436 29428 gene locus_tag LOCUS_18040 28436 29428 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_18040 29878 29477 gene locus_tag LOCUS_18050 29878 29477 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_18050 31398 29875 gene locus_tag LOCUS_18060 31398 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18060 31432 32361 gene locus_tag LOCUS_18070 31432 32361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598572.1 protein_id gnl|my_center|LOCUS_18070 32358 33089 gene locus_tag LOCUS_18080 32358 33089 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 protein_id gnl|my_center|LOCUS_18080 33094 34950 gene locus_tag LOCUS_18090 33094 34950 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849195.1 protein_id gnl|my_center|LOCUS_18090 34947 36035 gene locus_tag LOCUS_18100 34947 36035 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832922.1 protein_id gnl|my_center|LOCUS_18100 36151 36651 gene locus_tag LOCUS_18110 36151 36651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559687.1 protein_id gnl|my_center|LOCUS_18110 36648 38042 gene locus_tag LOCUS_18120 36648 38042 CDS product Mur ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708409.1 protein_id gnl|my_center|LOCUS_18120 38039 39064 gene locus_tag LOCUS_18130 gene pheS 38039 39064 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_18130 40724 39198 gene locus_tag LOCUS_18140 40724 39198 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070397.1 protein_id gnl|my_center|LOCUS_18140 41537 40740 gene locus_tag LOCUS_18150 41537 40740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433586.1 protein_id gnl|my_center|LOCUS_18150 42541 41534 gene locus_tag LOCUS_18160 42541 41534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932425.1 protein_id gnl|my_center|LOCUS_18160 42822 42538 gene locus_tag LOCUS_18170 42822 42538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 42946 43224 gene locus_tag LOCUS_18180 gene rpsT 42946 43224 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274025.1 protein_id gnl|my_center|LOCUS_18180 43380 43452 gene locus_tag LOCUS_t00160 43380 43452 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43549 44925 gene locus_tag LOCUS_18190 gene glmM 43549 44925 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092954.1 protein_id gnl|my_center|LOCUS_18190 44910 46745 gene locus_tag LOCUS_18200 gene glmS 44910 46745 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_18200 46844 47791 gene locus_tag LOCUS_18210 46844 47791 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127234.1 protein_id gnl|my_center|LOCUS_18210 47795 48709 gene locus_tag LOCUS_18220 47795 48709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 48712 50313 gene locus_tag LOCUS_18230 48712 50313 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402517.1 protein_id gnl|my_center|LOCUS_18230 50359 50712 gene locus_tag LOCUS_18240 50359 50712 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_18240 51260 50709 gene locus_tag LOCUS_18250 51260 50709 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_18250 51393 52568 gene locus_tag LOCUS_18260 51393 52568 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798837.1 protein_id gnl|my_center|LOCUS_18260 52569 53594 gene locus_tag LOCUS_18270 gene ruvB 52569 53594 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129835.1 protein_id gnl|my_center|LOCUS_18270 53575 54483 gene locus_tag LOCUS_18280 53575 54483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361891.1 protein_id gnl|my_center|LOCUS_18280 54529 54756 gene locus_tag LOCUS_18290 54529 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 54753 55001 gene locus_tag LOCUS_18300 54753 55001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 55471 55160 gene locus_tag LOCUS_18310 55471 55160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 protein_id gnl|my_center|LOCUS_18310 56567 55476 gene locus_tag LOCUS_18320 56567 55476 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_18320 57166 56726 gene locus_tag LOCUS_18330 57166 56726 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084286.1 protein_id gnl|my_center|LOCUS_18330 57512 57150 gene locus_tag LOCUS_18340 57512 57150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 58519 57509 gene locus_tag LOCUS_18350 58519 57509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 58590 58769 gene locus_tag LOCUS_18360 58590 58769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146757.1 protein_id gnl|my_center|LOCUS_18360 58771 59316 gene locus_tag LOCUS_18370 58771 59316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799361.1 protein_id gnl|my_center|LOCUS_18370 59313 59909 gene locus_tag LOCUS_18380 gene rlmJ 59313 59909 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698127.1 protein_id gnl|my_center|LOCUS_18380 59906 62053 gene locus_tag LOCUS_18390 gene pbpC 59906 62053 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002102274.1 protein_id gnl|my_center|LOCUS_18390 62063 62479 gene locus_tag LOCUS_18400 62063 62479 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125898.1 protein_id gnl|my_center|LOCUS_18400 62502 63794 gene locus_tag LOCUS_18410 62502 63794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 63791 64933 gene locus_tag LOCUS_18420 63791 64933 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276589.1 protein_id gnl|my_center|LOCUS_18420 66633 65179 gene locus_tag LOCUS_18430 66633 65179 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_18430 67387 66635 gene locus_tag LOCUS_18440 67387 66635 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_18440 67443 67943 gene locus_tag LOCUS_18450 67443 67943 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898860.1 protein_id gnl|my_center|LOCUS_18450 67993 69429 gene locus_tag LOCUS_18460 67993 69429 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898533.1 protein_id gnl|my_center|LOCUS_18460 69441 70526 gene locus_tag LOCUS_18470 69441 70526 CDS product DUF1574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489551.1 protein_id gnl|my_center|LOCUS_18470 71144 70512 gene locus_tag LOCUS_18480 71144 70512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 72167 71172 gene locus_tag LOCUS_18490 72167 71172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 74068 72167 gene locus_tag LOCUS_18500 74068 72167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 75928 74075 gene locus_tag LOCUS_18510 75928 74075 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069043.1 protein_id gnl|my_center|LOCUS_18510 77381 76038 gene locus_tag LOCUS_18520 77381 76038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831279.1 protein_id gnl|my_center|LOCUS_18520 77950 77378 gene locus_tag LOCUS_18530 77950 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 78797 77997 gene locus_tag LOCUS_18540 gene truA 78797 77997 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010667.1 protein_id gnl|my_center|LOCUS_18540 79583 78801 gene locus_tag LOCUS_18550 79583 78801 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127192.1 protein_id gnl|my_center|LOCUS_18550 79824 80942 gene locus_tag LOCUS_18560 79824 80942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825590.1 protein_id gnl|my_center|LOCUS_18560 81132 81854 gene locus_tag LOCUS_18570 81132 81854 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068702.1 protein_id gnl|my_center|LOCUS_18570 81901 82566 gene locus_tag LOCUS_18580 81901 82566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262393.1 protein_id gnl|my_center|LOCUS_18580 84944 82572 gene locus_tag LOCUS_18590 84944 82572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 85057 85374 gene locus_tag LOCUS_18600 85057 85374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 85977 85354 gene locus_tag LOCUS_18610 85977 85354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 87958 85979 gene locus_tag LOCUS_18620 87958 85979 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487747.1 protein_id gnl|my_center|LOCUS_18620 88052 89497 gene locus_tag LOCUS_18630 88052 89497 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623974.1 protein_id gnl|my_center|LOCUS_18630 89494 89985 gene locus_tag LOCUS_18640 89494 89985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 90073 91599 gene locus_tag LOCUS_18650 90073 91599 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713980.1 protein_id gnl|my_center|LOCUS_18650 91613 92290 gene locus_tag LOCUS_18660 91613 92290 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760764.1 protein_id gnl|my_center|LOCUS_18660 92422 93954 gene locus_tag LOCUS_18670 92422 93954 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713980.1 protein_id gnl|my_center|LOCUS_18670 93968 94645 gene locus_tag LOCUS_18680 93968 94645 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760764.1 protein_id gnl|my_center|LOCUS_18680 94799 95530 gene locus_tag LOCUS_18690 94799 95530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689734.1 protein_id gnl|my_center|LOCUS_18690 96057 95638 gene locus_tag LOCUS_18700 96057 95638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 96771 96136 gene locus_tag LOCUS_18710 gene yihA 96771 96136 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001313.1 protein_id gnl|my_center|LOCUS_18710 97766 96768 gene locus_tag LOCUS_18720 97766 96768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 98092 97775 gene locus_tag LOCUS_18730 98092 97775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 100017 98089 gene locus_tag LOCUS_18740 100017 98089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 100268 102385 gene locus_tag LOCUS_18750 100268 102385 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974395.1 protein_id gnl|my_center|LOCUS_18750 103437 102646 gene locus_tag LOCUS_18760 gene thiD 103437 102646 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_18760 103781 103434 gene locus_tag LOCUS_18770 103781 103434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 103916 104755 gene locus_tag LOCUS_18780 103916 104755 CDS product DUF455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_18780 104925 105980 gene locus_tag LOCUS_18790 104925 105980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 106447 106854 gene locus_tag LOCUS_18800 106447 106854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721123.1 protein_id gnl|my_center|LOCUS_18800 106922 108139 gene locus_tag LOCUS_18810 106922 108139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 111499 108215 gene locus_tag LOCUS_18820 111499 108215 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620776.1 protein_id gnl|my_center|LOCUS_18820 112242 111499 gene locus_tag LOCUS_18830 112242 111499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170991.1 protein_id gnl|my_center|LOCUS_18830 113249 112245 gene locus_tag LOCUS_18840 113249 112245 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690698.1 protein_id gnl|my_center|LOCUS_18840 114656 113256 gene locus_tag LOCUS_18850 114656 113256 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718042.1 protein_id gnl|my_center|LOCUS_18850 114589 114759 gene locus_tag LOCUS_18860 114589 114759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 117875 116283 gene locus_tag LOCUS_18870 117875 116283 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_18870 119311 117893 gene locus_tag LOCUS_18880 119311 117893 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070251.1 protein_id gnl|my_center|LOCUS_18880 121400 119322 gene locus_tag LOCUS_18890 gene ppk1 121400 119322 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045686.1 protein_id gnl|my_center|LOCUS_18890 121493 123412 gene locus_tag LOCUS_18900 gene fliD 121493 123412 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110738.1 protein_id gnl|my_center|LOCUS_18900 123414 124373 gene locus_tag LOCUS_18910 123414 124373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409256.1 protein_id gnl|my_center|LOCUS_18910 124395 125138 gene locus_tag LOCUS_18920 124395 125138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173175.1 protein_id gnl|my_center|LOCUS_18920 125769 125164 gene locus_tag LOCUS_18930 125769 125164 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_18930 126809 125958 gene locus_tag LOCUS_18940 126809 125958 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082180.1 protein_id gnl|my_center|LOCUS_18940 126934 127776 gene locus_tag LOCUS_18950 gene dapF 126934 127776 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_18950 128520 127798 gene locus_tag LOCUS_18960 128520 127798 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410308.1 protein_id gnl|my_center|LOCUS_18960 128821 128525 gene locus_tag LOCUS_18970 128821 128525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113793.1 protein_id gnl|my_center|LOCUS_18970 129150 129632 gene locus_tag LOCUS_18980 129150 129632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 129980 129738 gene locus_tag LOCUS_18990 129980 129738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 130392 130117 gene locus_tag LOCUS_19000 130392 130117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 131815 130439 gene locus_tag LOCUS_19010 131815 130439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_19010 134151 131866 gene locus_tag LOCUS_19020 134151 131866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 135426 134242 gene locus_tag LOCUS_19030 135426 134242 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_19030 138466 135416 gene locus_tag LOCUS_19040 138466 135416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 138871 139944 gene locus_tag LOCUS_19050 138871 139944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 140569 140126 gene locus_tag LOCUS_19060 140569 140126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054119.1 protein_id gnl|my_center|LOCUS_19060 141839 140571 gene locus_tag LOCUS_19070 141839 140571 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280808.1 protein_id gnl|my_center|LOCUS_19070 143165 141855 gene locus_tag LOCUS_19080 143165 141855 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206943.1 protein_id gnl|my_center|LOCUS_19080 143877 143578 gene locus_tag LOCUS_19090 143877 143578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 144562 144005 gene locus_tag LOCUS_19100 144562 144005 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941689.1 protein_id gnl|my_center|LOCUS_19100 145915 144680 gene locus_tag LOCUS_19110 145915 144680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970213.1 protein_id gnl|my_center|LOCUS_19110 145978 147090 gene locus_tag LOCUS_19120 145978 147090 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_19120 147087 147695 gene locus_tag LOCUS_19130 147087 147695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 147697 148212 gene locus_tag LOCUS_19140 147697 148212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 148302 149159 gene locus_tag LOCUS_19150 148302 149159 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_19150 149160 149891 gene locus_tag LOCUS_19160 149160 149891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646910.1 protein_id gnl|my_center|LOCUS_19160 150430 149915 gene locus_tag LOCUS_19170 150430 149915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 150845 150420 gene locus_tag LOCUS_19180 150845 150420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 152812 150845 gene locus_tag LOCUS_19190 152812 150845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 154543 152828 gene locus_tag LOCUS_19200 154543 152828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 155139 154621 gene locus_tag LOCUS_19210 155139 154621 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674089.1 protein_id gnl|my_center|LOCUS_19210 155305 155772 gene locus_tag LOCUS_19220 155305 155772 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771927.1 protein_id gnl|my_center|LOCUS_19220 158368 156281 gene locus_tag LOCUS_19230 158368 156281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 162115 158375 gene locus_tag LOCUS_19240 162115 158375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 163161 162166 gene locus_tag LOCUS_19250 163161 162166 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_19250 164035 163154 gene locus_tag LOCUS_19260 164035 163154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_19260 164132 164605 gene locus_tag LOCUS_19270 164132 164605 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657853.1 protein_id gnl|my_center|LOCUS_19270 164621 165496 gene locus_tag LOCUS_19280 164621 165496 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_19280 165515 168148 gene locus_tag LOCUS_19290 165515 168148 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783265.1 protein_id gnl|my_center|LOCUS_19290 168150 169094 gene locus_tag LOCUS_19300 168150 169094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 169088 169576 gene locus_tag LOCUS_19310 169088 169576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 169660 169579 gene locus_tag LOCUS_t00170 169660 169579 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 169744 169670 gene locus_tag LOCUS_t00180 169744 169670 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 169945 170223 gene locus_tag LOCUS_19320 169945 170223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 170233 171045 gene locus_tag LOCUS_19330 170233 171045 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_19330 171095 171988 gene locus_tag LOCUS_19340 171095 171988 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_19340 171992 172945 gene locus_tag LOCUS_19350 171992 172945 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868877.1 protein_id gnl|my_center|LOCUS_19350 175156 172949 gene locus_tag LOCUS_19360 175156 172949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 175918 175175 gene locus_tag LOCUS_19370 175918 175175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820066.1 protein_id gnl|my_center|LOCUS_19370 175985 177793 gene locus_tag LOCUS_19380 175985 177793 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002749.1 protein_id gnl|my_center|LOCUS_19380 177854 178393 gene locus_tag LOCUS_19390 177854 178393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 178396 179991 gene locus_tag LOCUS_19400 178396 179991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 179988 180938 gene locus_tag LOCUS_19410 179988 180938 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945844.1 protein_id gnl|my_center|LOCUS_19410 181566 180943 gene locus_tag LOCUS_19420 181566 180943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_19420 181565 182422 gene locus_tag LOCUS_19430 gene mazG 181565 182422 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_19430 183231 182464 gene locus_tag LOCUS_19440 183231 182464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19440 183957 183244 gene locus_tag LOCUS_19450 183957 183244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19450 183905 184846 gene locus_tag LOCUS_19460 183905 184846 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_19460 184830 185858 gene locus_tag LOCUS_19470 184830 185858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483742.1 protein_id gnl|my_center|LOCUS_19470 185855 186253 gene locus_tag LOCUS_19480 185855 186253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 186354 187376 gene locus_tag LOCUS_19490 186354 187376 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701174.1 protein_id gnl|my_center|LOCUS_19490 187528 188439 gene locus_tag LOCUS_19500 187528 188439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730933.1 protein_id gnl|my_center|LOCUS_19500 188666 189136 gene locus_tag LOCUS_19510 188666 189136 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_19510 189146 189550 gene locus_tag LOCUS_19520 189146 189550 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626110.1 protein_id gnl|my_center|LOCUS_19520 189951 189547 gene locus_tag LOCUS_19530 189951 189547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 190460 190083 gene locus_tag LOCUS_19540 190460 190083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 190470 191444 gene locus_tag LOCUS_19550 gene queG 190470 191444 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572974.1 protein_id gnl|my_center|LOCUS_19550 192072 191416 gene locus_tag LOCUS_19560 gene thiE 192072 191416 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 protein_id gnl|my_center|LOCUS_19560 192841 192041 gene locus_tag LOCUS_19570 gene thiM 192841 192041 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263206.1 protein_id gnl|my_center|LOCUS_19570 193260 192865 gene locus_tag LOCUS_19580 193260 192865 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_19580 194350 193595 gene locus_tag LOCUS_19590 gene map 194350 193595 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200692.1 protein_id gnl|my_center|LOCUS_19590 194559 194356 gene locus_tag LOCUS_19600 194559 194356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_19600 197819 194577 gene locus_tag LOCUS_19610 197819 194577 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510661.1 protein_id gnl|my_center|LOCUS_19610 197945 198859 gene locus_tag LOCUS_19620 197945 198859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536752.1 protein_id gnl|my_center|LOCUS_19620 198861 199586 gene locus_tag LOCUS_19630 198861 199586 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_19630 199583 201208 gene locus_tag LOCUS_19640 199583 201208 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623945.1 protein_id gnl|my_center|LOCUS_19640 201211 202188 gene locus_tag LOCUS_19650 201211 202188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 202804 202169 gene locus_tag LOCUS_19660 202804 202169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219378.1 protein_id gnl|my_center|LOCUS_19660 203487 202840 gene locus_tag LOCUS_19670 203487 202840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 204743 203487 gene locus_tag LOCUS_19680 204743 203487 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_19680 204790 205551 gene locus_tag LOCUS_19690 gene lmtA 204790 205551 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_19690 206262 207173 gene locus_tag LOCUS_19700 206262 207173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 207183 207440 gene locus_tag LOCUS_19710 207183 207440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 207878 207579 gene locus_tag LOCUS_19720 207878 207579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 208476 207889 gene locus_tag LOCUS_19730 208476 207889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 208552 209466 gene locus_tag LOCUS_19740 208552 209466 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690042.1 protein_id gnl|my_center|LOCUS_19740 209530 209937 gene locus_tag LOCUS_19750 209530 209937 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086272.1 protein_id gnl|my_center|LOCUS_19750 210263 210613 gene locus_tag LOCUS_19760 210263 210613 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287684.1 protein_id gnl|my_center|LOCUS_19760 210672 211952 gene locus_tag LOCUS_19770 210672 211952 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288561.1 protein_id gnl|my_center|LOCUS_19770 211974 214094 gene locus_tag LOCUS_19780 211974 214094 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160641.1 protein_id gnl|my_center|LOCUS_19780 214978 214103 gene locus_tag LOCUS_19790 214978 214103 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942124.1 protein_id gnl|my_center|LOCUS_19790 215654 214989 gene locus_tag LOCUS_19800 215654 214989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016106.1 protein_id gnl|my_center|LOCUS_19800 216557 215703 gene locus_tag LOCUS_19810 gene cyoE 216557 215703 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168719.1 protein_id gnl|my_center|LOCUS_19810 217443 216550 gene locus_tag LOCUS_19820 217443 216550 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_19820 217570 217722 gene locus_tag LOCUS_19830 217570 217722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 217726 218592 gene locus_tag LOCUS_19840 217726 218592 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_19840 218593 219558 gene locus_tag LOCUS_19850 gene coxB 218593 219558 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220059.1 protein_id gnl|my_center|LOCUS_19850 219569 221185 gene locus_tag LOCUS_19860 gene ctaD 219569 221185 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102008.1 protein_id gnl|my_center|LOCUS_19860 221289 221945 gene locus_tag LOCUS_19870 221289 221945 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_19870 221959 222552 gene locus_tag LOCUS_19880 221959 222552 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418707.1 protein_id gnl|my_center|LOCUS_19880 223447 222800 gene locus_tag LOCUS_19890 223447 222800 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_19890 224831 223428 gene locus_tag LOCUS_19900 gene sthA 224831 223428 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311462.1 protein_id gnl|my_center|LOCUS_19900 226424 225105 gene locus_tag LOCUS_19910 226424 225105 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778965.1 protein_id gnl|my_center|LOCUS_19910 227452 226451 gene locus_tag LOCUS_19920 gene ilvC 227452 226451 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284348.1 protein_id gnl|my_center|LOCUS_19920 228588 227683 gene locus_tag LOCUS_19930 228588 227683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 229246 228593 gene locus_tag LOCUS_19940 229246 228593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 229640 229293 gene locus_tag LOCUS_19950 229640 229293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 229960 229637 gene locus_tag LOCUS_19960 229960 229637 CDS product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720240.1 protein_id gnl|my_center|LOCUS_19960 230378 229962 gene locus_tag LOCUS_19970 230378 229962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 230493 230999 gene locus_tag LOCUS_19980 230493 230999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 232782 231049 gene locus_tag LOCUS_19990 232782 231049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 232951 233553 gene locus_tag LOCUS_20000 232951 233553 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 protein_id gnl|my_center|LOCUS_20000 233580 234650 gene locus_tag LOCUS_20010 233580 234650 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_20010 234793 235185 gene locus_tag LOCUS_20020 234793 235185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 235400 236458 gene locus_tag LOCUS_20030 235400 236458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 236578 237522 gene locus_tag LOCUS_20040 236578 237522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 239186 237519 gene locus_tag LOCUS_20050 239186 237519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 240108 239173 gene locus_tag LOCUS_20060 240108 239173 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_20060 242376 240520 gene locus_tag LOCUS_20070 242376 240520 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_20070 246807 242425 gene locus_tag LOCUS_20080 246807 242425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 247226 249709 gene locus_tag LOCUS_20090 247226 249709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 249958 251334 gene locus_tag LOCUS_20100 249958 251334 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420145.1 protein_id gnl|my_center|LOCUS_20100 251344 251877 gene locus_tag LOCUS_20110 251344 251877 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067294.1 protein_id gnl|my_center|LOCUS_20110 251904 252581 gene locus_tag LOCUS_20120 251904 252581 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506979.1 protein_id gnl|my_center|LOCUS_20120 252923 252567 gene locus_tag LOCUS_20130 252923 252567 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036026449.1 protein_id gnl|my_center|LOCUS_20130 253638 252940 gene locus_tag LOCUS_20140 253638 252940 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657519.1 protein_id gnl|my_center|LOCUS_20140 253753 254916 gene locus_tag LOCUS_20150 253753 254916 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054325.1 protein_id gnl|my_center|LOCUS_20150 255824 255135 gene locus_tag LOCUS_20160 255824 255135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 258032 255825 gene locus_tag LOCUS_20170 gene ccsA 258032 255825 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_20170 258421 258029 gene locus_tag LOCUS_20180 258421 258029 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021980.1 protein_id gnl|my_center|LOCUS_20180 259347 258751 gene locus_tag LOCUS_20190 259347 258751 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002084071.1 protein_id gnl|my_center|LOCUS_20190 259414 259605 gene locus_tag LOCUS_20200 259414 259605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 259982 259602 gene locus_tag LOCUS_20210 259982 259602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 260154 261119 gene locus_tag LOCUS_20220 260154 261119 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_20220 261172 262638 gene locus_tag LOCUS_20230 261172 262638 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_20230 263666 262728 gene locus_tag LOCUS_20240 263666 262728 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_20240 264161 263742 gene locus_tag LOCUS_20250 264161 263742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 264226 264414 gene locus_tag LOCUS_20260 264226 264414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 264897 265781 gene locus_tag LOCUS_20270 gene dapA 264897 265781 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970781.1 protein_id gnl|my_center|LOCUS_20270 265774 266577 gene locus_tag LOCUS_20280 gene dapB 265774 266577 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082216.1 protein_id gnl|my_center|LOCUS_20280 266580 267401 gene locus_tag LOCUS_20290 gene cdaA 266580 267401 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464749.1 protein_id gnl|my_center|LOCUS_20290 267403 268464 gene locus_tag LOCUS_20300 267403 268464 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766592.1 protein_id gnl|my_center|LOCUS_20300 269366 268461 gene locus_tag LOCUS_20310 269366 268461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047532.1 protein_id gnl|my_center|LOCUS_20310 269501 269905 gene locus_tag LOCUS_20320 269501 269905 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_20320 270000 272531 gene locus_tag LOCUS_20330 270000 272531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 274294 272594 gene locus_tag LOCUS_20340 gene fliF 274294 272594 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115055.1 protein_id gnl|my_center|LOCUS_20340 275759 274599 gene locus_tag LOCUS_20350 275759 274599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 275893 276828 gene locus_tag LOCUS_20360 275893 276828 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954148.1 protein_id gnl|my_center|LOCUS_20360 276829 277335 gene locus_tag LOCUS_20370 276829 277335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 277709 277323 gene locus_tag LOCUS_20380 gene fliE 277709 277323 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405186.1 protein_id gnl|my_center|LOCUS_20380 277907 278308 gene locus_tag LOCUS_20390 277907 278308 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_20390 278374 278865 gene locus_tag LOCUS_20400 278374 278865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 279051 279500 gene locus_tag LOCUS_20410 279051 279500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 279487 279810 gene locus_tag LOCUS_20420 279487 279810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 279807 280139 gene locus_tag LOCUS_20430 279807 280139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 280165 281046 gene locus_tag LOCUS_20440 280165 281046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 282560 281049 gene locus_tag LOCUS_20450 282560 281049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 283107 282646 gene locus_tag LOCUS_20460 gene flgC 283107 282646 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522494.1 protein_id gnl|my_center|LOCUS_20460 283564 283133 gene locus_tag LOCUS_20470 gene flgB 283564 283133 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462091.1 protein_id gnl|my_center|LOCUS_20470 284443 283580 gene locus_tag LOCUS_20480 284443 283580 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_20480 285662 284568 gene locus_tag LOCUS_20490 285662 284568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971889.1 protein_id gnl|my_center|LOCUS_20490 285756 286880 gene locus_tag LOCUS_20500 285756 286880 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_20500 286880 287644 gene locus_tag LOCUS_20510 286880 287644 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_20510 287641 288588 gene locus_tag LOCUS_20520 287641 288588 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_20520 288606 289223 gene locus_tag LOCUS_20530 288606 289223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 289758 290396 gene locus_tag LOCUS_20540 289758 290396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 290511 291656 gene locus_tag LOCUS_20550 290511 291656 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_20550 292063 291842 gene locus_tag LOCUS_20560 292063 291842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20560 292278 292508 gene locus_tag LOCUS_20570 292278 292508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 293633 292569 gene locus_tag LOCUS_20580 293633 292569 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_20580 293997 294419 gene locus_tag LOCUS_20590 293997 294419 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_20590 295662 294445 gene locus_tag LOCUS_20600 295662 294445 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_20600 295772 297001 gene locus_tag LOCUS_20610 295772 297001 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088659.1 protein_id gnl|my_center|LOCUS_20610 297458 296994 gene locus_tag LOCUS_20620 297458 296994 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_20620 298913 297480 gene locus_tag LOCUS_20630 gene pyk 298913 297480 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698533.1 protein_id gnl|my_center|LOCUS_20630 298998 299903 gene locus_tag LOCUS_20640 298998 299903 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_20640 299903 300730 gene locus_tag LOCUS_20650 299903 300730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510896.1 protein_id gnl|my_center|LOCUS_20650 300743 301855 gene locus_tag LOCUS_20660 300743 301855 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134480.1 protein_id gnl|my_center|LOCUS_20660 303443 301812 gene locus_tag LOCUS_20670 303443 301812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 304957 303440 gene locus_tag LOCUS_20680 304957 303440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 305742 305263 gene locus_tag LOCUS_20690 305742 305263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 307709 305817 gene locus_tag LOCUS_20700 307709 305817 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201677.1 protein_id gnl|my_center|LOCUS_20700 307764 308402 gene locus_tag LOCUS_20710 307764 308402 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128627.1 protein_id gnl|my_center|LOCUS_20710 308402 309775 gene locus_tag LOCUS_20720 gene radA 308402 309775 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728128.1 protein_id gnl|my_center|LOCUS_20720 310077 310988 gene locus_tag LOCUS_20730 310077 310988 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_20730 311227 312138 gene locus_tag LOCUS_20740 311227 312138 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_20740 312217 313245 gene locus_tag LOCUS_20750 312217 313245 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854849.1 protein_id gnl|my_center|LOCUS_20750 314207 313242 gene locus_tag LOCUS_20760 314207 313242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 314307 314870 gene locus_tag LOCUS_20770 314307 314870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 314867 315814 gene locus_tag LOCUS_20780 314867 315814 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141968.1 protein_id gnl|my_center|LOCUS_20780 315843 317825 gene locus_tag LOCUS_20790 315843 317825 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802731.1 protein_id gnl|my_center|LOCUS_20790 319138 317867 gene locus_tag LOCUS_20800 319138 317867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439951.1 protein_id gnl|my_center|LOCUS_20800 321460 319235 gene locus_tag LOCUS_20810 321460 319235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 323223 321574 gene locus_tag LOCUS_20820 323223 321574 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087273407.1 protein_id gnl|my_center|LOCUS_20820 324279 323647 gene locus_tag LOCUS_20830 324279 323647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 327426 324700 gene locus_tag LOCUS_20840 327426 324700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 327759 328121 gene locus_tag LOCUS_20850 327759 328121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 328169 328684 gene locus_tag LOCUS_20860 328169 328684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 328681 329682 gene locus_tag LOCUS_20870 328681 329682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 329809 330441 gene locus_tag LOCUS_20880 329809 330441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 330619 330819 gene locus_tag LOCUS_20890 330619 330819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 330886 332064 gene locus_tag LOCUS_20900 330886 332064 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_20900 332355 333377 gene locus_tag LOCUS_20910 332355 333377 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862891.1 protein_id gnl|my_center|LOCUS_20910 335114 333366 gene locus_tag LOCUS_20920 335114 333366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 335810 335115 gene locus_tag LOCUS_20930 335810 335115 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001977544.1 protein_id gnl|my_center|LOCUS_20930 336019 337056 gene locus_tag LOCUS_20940 gene lepB 336019 337056 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764509.1 protein_id gnl|my_center|LOCUS_20940 337064 338710 gene locus_tag LOCUS_20950 337064 338710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934691.1 protein_id gnl|my_center|LOCUS_20950 338715 338927 gene locus_tag LOCUS_20960 338715 338927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 339207 340913 gene locus_tag LOCUS_20970 gene ilvB 339207 340913 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168480.1 protein_id gnl|my_center|LOCUS_20970 341118 341603 gene locus_tag LOCUS_20980 341118 341603 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_20980 341683 342027 gene locus_tag LOCUS_20990 341683 342027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 342211 342621 gene locus_tag LOCUS_21000 gene acpS 342211 342621 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704154.1 protein_id gnl|my_center|LOCUS_21000 342618 342842 gene locus_tag LOCUS_21010 342618 342842 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622506.1 protein_id gnl|my_center|LOCUS_21010 342853 343224 gene locus_tag LOCUS_21020 342853 343224 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_21020 343227 345017 gene locus_tag LOCUS_21030 343227 345017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 345029 345877 gene locus_tag LOCUS_21040 345029 345877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_21040 345878 347701 gene locus_tag LOCUS_21050 345878 347701 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071261.1 protein_id gnl|my_center|LOCUS_21050 347733 349040 gene locus_tag LOCUS_21060 347733 349040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 349204 350154 gene locus_tag LOCUS_21070 349204 350154 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_21070 350230 350676 gene locus_tag LOCUS_21080 350230 350676 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_21080 350865 350692 gene locus_tag LOCUS_21090 350865 350692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 351666 350914 gene locus_tag LOCUS_21100 351666 350914 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665700.1 protein_id gnl|my_center|LOCUS_21100 351883 352284 gene locus_tag LOCUS_21110 351883 352284 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230342.1 protein_id gnl|my_center|LOCUS_21110 352281 352766 gene locus_tag LOCUS_21120 352281 352766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221974.1 protein_id gnl|my_center|LOCUS_21120 353111 354631 gene locus_tag LOCUS_21130 353111 354631 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076957.1 protein_id gnl|my_center|LOCUS_21130 354647 355432 gene locus_tag LOCUS_21140 354647 355432 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800040.1 protein_id gnl|my_center|LOCUS_21140 355542 355766 gene locus_tag LOCUS_21150 355542 355766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 355767 356069 gene locus_tag LOCUS_21160 355767 356069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 357124 356153 gene locus_tag LOCUS_21170 357124 356153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 357725 357111 gene locus_tag LOCUS_21180 357725 357111 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969797.1 protein_id gnl|my_center|LOCUS_21180 358485 357727 gene locus_tag LOCUS_21190 358485 357727 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614697.1 protein_id gnl|my_center|LOCUS_21190 358686 358489 gene locus_tag LOCUS_21200 358686 358489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 359621 358683 gene locus_tag LOCUS_21210 gene thiO 359621 358683 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 protein_id gnl|my_center|LOCUS_21210 360101 360331 gene locus_tag LOCUS_21220 360101 360331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674571.1 protein_id gnl|my_center|LOCUS_21220 360328 360729 gene locus_tag LOCUS_21230 360328 360729 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_21230 360774 360998 gene locus_tag LOCUS_21240 360774 360998 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 protein_id gnl|my_center|LOCUS_21240 360992 361297 gene locus_tag LOCUS_21250 gene mazF 360992 361297 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 protein_id gnl|my_center|LOCUS_21250 361411 361644 gene locus_tag LOCUS_21260 361411 361644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 361648 362523 gene locus_tag LOCUS_21270 gene rpsB 361648 362523 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111480.1 protein_id gnl|my_center|LOCUS_21270 362523 363119 gene locus_tag LOCUS_21280 gene tsf 362523 363119 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741907.1 protein_id gnl|my_center|LOCUS_21280 363109 363858 gene locus_tag LOCUS_21290 gene pyrH 363109 363858 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179852.1 protein_id gnl|my_center|LOCUS_21290 363848 364396 gene locus_tag LOCUS_21300 gene frr 363848 364396 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135448.1 protein_id gnl|my_center|LOCUS_21300 364420 365133 gene locus_tag LOCUS_21310 364420 365133 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522360.1 protein_id gnl|my_center|LOCUS_21310 365130 366041 gene locus_tag LOCUS_21320 365130 366041 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504834.1 protein_id gnl|my_center|LOCUS_21320 366059 367216 gene locus_tag LOCUS_21330 gene dxr 366059 367216 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069750.1 protein_id gnl|my_center|LOCUS_21330 367213 368922 gene locus_tag LOCUS_21340 367213 368922 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906630.1 protein_id gnl|my_center|LOCUS_21340 368949 370694 gene locus_tag LOCUS_21350 368949 370694 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647843.1 protein_id gnl|my_center|LOCUS_21350 371079 372278 gene locus_tag LOCUS_21360 gene trpB 371079 372278 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514163.1 protein_id gnl|my_center|LOCUS_21360 372275 373075 gene locus_tag LOCUS_21370 gene trpA 372275 373075 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084828.1 protein_id gnl|my_center|LOCUS_21370 373212 373877 gene locus_tag LOCUS_21380 373212 373877 CDS product fatty acid desaturase CarF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846138.1 protein_id gnl|my_center|LOCUS_21380 374250 373915 gene locus_tag LOCUS_21390 374250 373915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 374214 376370 gene locus_tag LOCUS_21400 374214 376370 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_21400 376370 377536 gene locus_tag LOCUS_21410 376370 377536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259338.1 protein_id gnl|my_center|LOCUS_21410 380141 377742 gene locus_tag LOCUS_21420 380141 377742 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_21420 381156 380185 gene locus_tag LOCUS_21430 381156 380185 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_21430 382172 382432 gene locus_tag LOCUS_21440 382172 382432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 382673 384997 gene locus_tag LOCUS_21450 382673 384997 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291001.1 protein_id gnl|my_center|LOCUS_21450 385005 386888 gene locus_tag LOCUS_21460 gene dxs 385005 386888 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183723.1 protein_id gnl|my_center|LOCUS_21460 386951 387442 gene locus_tag LOCUS_21470 386951 387442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418044.1 protein_id gnl|my_center|LOCUS_21470 387496 388470 gene locus_tag LOCUS_21480 387496 388470 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_21480 389013 388516 gene locus_tag LOCUS_21490 389013 388516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651384.1 protein_id gnl|my_center|LOCUS_21490 389434 389018 gene locus_tag LOCUS_21500 389434 389018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 389519 390205 gene locus_tag LOCUS_21510 389519 390205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390247.1 protein_id gnl|my_center|LOCUS_21510 390581 390384 gene locus_tag LOCUS_21520 390581 390384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 393186 390739 gene locus_tag LOCUS_21530 393186 390739 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863352.1 protein_id gnl|my_center|LOCUS_21530 393355 394638 gene locus_tag LOCUS_21540 gene aroA 393355 394638 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612433.1 protein_id gnl|my_center|LOCUS_21540 395298 394681 gene locus_tag LOCUS_21550 395298 394681 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109025.1 protein_id gnl|my_center|LOCUS_21550 395699 396700 gene locus_tag LOCUS_21560 395699 396700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 396845 397270 gene locus_tag LOCUS_21570 396845 397270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 397343 398950 gene locus_tag LOCUS_21580 397343 398950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 399173 400954 gene locus_tag LOCUS_21590 399173 400954 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942560.1 protein_id gnl|my_center|LOCUS_21590 401022 401762 gene locus_tag LOCUS_21600 gene cmk 401022 401762 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005055.1 protein_id gnl|my_center|LOCUS_21600 401786 403486 gene locus_tag LOCUS_21610 401786 403486 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182263.1 protein_id gnl|my_center|LOCUS_21610 403492 404247 gene locus_tag LOCUS_21620 403492 404247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833112.1 protein_id gnl|my_center|LOCUS_21620 404248 404862 gene locus_tag LOCUS_21630 gene hisG 404248 404862 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956489.1 protein_id gnl|my_center|LOCUS_21630 405138 406160 gene locus_tag LOCUS_21640 gene plsX 405138 406160 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990052.1 protein_id gnl|my_center|LOCUS_21640 406215 406976 gene locus_tag LOCUS_21650 gene fabG 406215 406976 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_21650 407515 407183 gene locus_tag LOCUS_21660 407515 407183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 409133 407640 gene locus_tag LOCUS_21670 409133 407640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 409552 409785 gene locus_tag LOCUS_21680 gene acpP 409552 409785 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_21680 409843 410583 gene locus_tag LOCUS_21690 gene rnc 409843 410583 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008630.1 protein_id gnl|my_center|LOCUS_21690 410580 411044 gene locus_tag LOCUS_21700 410580 411044 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082285506.1 protein_id gnl|my_center|LOCUS_21700 411041 412141 gene locus_tag LOCUS_21710 gene aroB 411041 412141 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052388.1 protein_id gnl|my_center|LOCUS_21710 412128 413033 gene locus_tag LOCUS_21720 412128 413033 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397489.1 protein_id gnl|my_center|LOCUS_21720 412996 413742 gene locus_tag LOCUS_21730 412996 413742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049436.1 protein_id gnl|my_center|LOCUS_21730 414784 413753 gene locus_tag LOCUS_21740 414784 413753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010571711.1 protein_id gnl|my_center|LOCUS_21740 415772 414789 gene locus_tag LOCUS_21750 415772 414789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097761.1 protein_id gnl|my_center|LOCUS_21750 415833 417185 gene locus_tag LOCUS_21760 415833 417185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867620.1 protein_id gnl|my_center|LOCUS_21760 417178 417876 gene locus_tag LOCUS_21770 417178 417876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052667.1 protein_id gnl|my_center|LOCUS_21770 418103 418687 gene locus_tag LOCUS_21780 418103 418687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 418749 421295 gene locus_tag LOCUS_21790 418749 421295 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889239.1 protein_id gnl|my_center|LOCUS_21790 421296 421730 gene locus_tag LOCUS_21800 421296 421730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121994.1 protein_id gnl|my_center|LOCUS_21800 421727 422500 gene locus_tag LOCUS_21810 421727 422500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 422497 423789 gene locus_tag LOCUS_21820 gene mtaB 422497 423789 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555988.1 protein_id gnl|my_center|LOCUS_21820 424515 425687 gene locus_tag LOCUS_21830 424515 425687 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_21830 426879 425647 gene locus_tag LOCUS_21840 426879 425647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 426961 427269 gene locus_tag LOCUS_21850 426961 427269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 427220 427399 gene locus_tag LOCUS_21860 427220 427399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 427438 427872 gene locus_tag LOCUS_21870 427438 427872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 427802 427963 gene locus_tag LOCUS_21880 427802 427963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 428308 428538 gene locus_tag LOCUS_21890 428308 428538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 430118 428631 gene locus_tag LOCUS_21900 430118 428631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 431079 430132 gene locus_tag LOCUS_21910 431079 430132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 431476 431117 gene locus_tag LOCUS_21920 431476 431117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 433153 431603 gene locus_tag LOCUS_21930 433153 431603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 433870 433262 gene locus_tag LOCUS_21940 433870 433262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 435317 433830 gene locus_tag LOCUS_21950 435317 433830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 435797 435321 gene locus_tag LOCUS_21960 435797 435321 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_21960 435980 436918 gene locus_tag LOCUS_21970 435980 436918 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_21970 436923 438257 gene locus_tag LOCUS_21980 436923 438257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 438247 438963 gene locus_tag LOCUS_21990 438247 438963 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_21990 440189 440794 gene locus_tag LOCUS_22000 440189 440794 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_22000 441289 440798 gene locus_tag LOCUS_22010 441289 440798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 441401 442417 gene locus_tag LOCUS_22020 gene lpxD 441401 442417 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644954.1 protein_id gnl|my_center|LOCUS_22020 442684 442448 gene locus_tag LOCUS_22030 442684 442448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 443031 442792 gene locus_tag LOCUS_22040 443031 442792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433088.1 protein_id gnl|my_center|LOCUS_22040 443746 443072 gene locus_tag LOCUS_22050 443746 443072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 443923 446178 gene locus_tag LOCUS_22060 gene asd 443923 446178 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938814.1 protein_id gnl|my_center|LOCUS_22060 446175 446495 gene locus_tag LOCUS_22070 446175 446495 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_22070 446590 447666 gene locus_tag LOCUS_22080 gene fliN 446590 447666 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503780.1 protein_id gnl|my_center|LOCUS_22080 447663 448421 gene locus_tag LOCUS_22090 gene fliO 447663 448421 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211505.1 protein_id gnl|my_center|LOCUS_22090 448418 449239 gene locus_tag LOCUS_22100 gene fliP 448418 449239 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783972.1 protein_id gnl|my_center|LOCUS_22100 449236 449499 gene locus_tag LOCUS_22110 gene fliQ 449236 449499 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137385.1 protein_id gnl|my_center|LOCUS_22110 449615 450283 gene locus_tag LOCUS_22120 gene fliR 449615 450283 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455610.1 protein_id gnl|my_center|LOCUS_22120 450280 451404 gene locus_tag LOCUS_22130 450280 451404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 451415 453529 gene locus_tag LOCUS_22140 gene flhA 451415 453529 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412863.1 protein_id gnl|my_center|LOCUS_22140 453539 454537 gene locus_tag LOCUS_22150 gene dusA 453539 454537 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891135.1 protein_id gnl|my_center|LOCUS_22150 454728 456425 gene locus_tag LOCUS_22160 454728 456425 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042798.1 protein_id gnl|my_center|LOCUS_22160 456437 457654 gene locus_tag LOCUS_22170 456437 457654 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365892.1 protein_id gnl|my_center|LOCUS_22170 457666 458691 gene locus_tag LOCUS_22180 457666 458691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971371.1 protein_id gnl|my_center|LOCUS_22180 458704 459507 gene locus_tag LOCUS_22190 458704 459507 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277165.1 protein_id gnl|my_center|LOCUS_22190 459504 460505 gene locus_tag LOCUS_22200 459504 460505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 461604 460531 gene locus_tag LOCUS_22210 461604 460531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 462447 461980 gene locus_tag LOCUS_22220 462447 461980 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_22220 462577 464778 gene locus_tag LOCUS_22230 462577 464778 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_22230 466468 464786 gene locus_tag LOCUS_22240 gene ilvD 466468 464786 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_22240 467147 466533 gene locus_tag LOCUS_22250 467147 466533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 467288 468193 gene locus_tag LOCUS_22260 467288 468193 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 protein_id gnl|my_center|LOCUS_22260 469869 468199 gene locus_tag LOCUS_22270 469869 468199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 470954 469887 gene locus_tag LOCUS_22280 470954 469887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010145.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence25 1348 2277 gene locus_tag LOCUS_22290 1348 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2652 5771 gene locus_tag LOCUS_22300 2652 5771 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_22300 6048 8417 gene locus_tag LOCUS_22310 6048 8417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_22310 8612 9724 gene locus_tag LOCUS_22320 8612 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 9993 10157 gene locus_tag LOCUS_22330 9993 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10157 10585 gene locus_tag LOCUS_22340 10157 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence26 1390 467 gene locus_tag LOCUS_22350 1390 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2129 1425 gene locus_tag LOCUS_22360 2129 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 8456 2136 gene locus_tag LOCUS_22370 8456 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9859 8585 gene locus_tag LOCUS_22380 9859 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence27 7079 7810 gene locus_tag LOCUS_22390 7079 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 7928 9640 gene locus_tag LOCUS_22400 7928 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence28 346 3108 gene locus_tag LOCUS_22410 346 3108 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_22410 3105 3290 gene locus_tag LOCUS_22420 3105 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3287 5596 gene locus_tag LOCUS_22430 3287 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5609 7234 gene locus_tag LOCUS_22440 5609 7234 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_22440 7227 9320 gene locus_tag LOCUS_22450 7227 9320 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence29 1028 543 gene locus_tag LOCUS_22460 1028 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2871 1033 gene locus_tag LOCUS_22470 2871 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3550 2888 gene locus_tag LOCUS_22480 3550 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5331 3541 gene locus_tag LOCUS_22490 5331 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence30 1498 329 gene locus_tag LOCUS_22500 1498 329 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967414.1 protein_id gnl|my_center|LOCUS_22500 2525 1611 gene locus_tag LOCUS_22510 2525 1611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113750.1 protein_id gnl|my_center|LOCUS_22510 3224 2577 gene locus_tag LOCUS_22520 3224 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464623.1 protein_id gnl|my_center|LOCUS_22520 4145 3306 gene locus_tag LOCUS_22530 4145 3306 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence31 <1 2879 gene locus_tag LOCUS_22540 <1 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393878.1:M23 family metallopeptidase 2876 3505 gene locus_tag LOCUS_22550 2876 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence32 2045 240 gene locus_tag LOCUS_22560 2045 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2748 2542 gene locus_tag LOCUS_22570 2748 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3048 2752 gene locus_tag LOCUS_22580 3048 2752 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence33 >Feature sequence34 1439 2002 gene locus_tag LOCUS_22590 1439 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2182 2370 gene locus_tag LOCUS_22600 2182 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence35 1345 797 gene locus_tag LOCUS_22610 1345 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence36 2379 796 gene locus_tag LOCUS_22620 2379 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3324 2728 gene locus_tag LOCUS_22630 3324 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 3610 3855 gene locus_tag LOCUS_22640 3610 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3852 4919 gene locus_tag LOCUS_22650 3852 4919 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_22650 4912 6246 gene locus_tag LOCUS_22660 gene fslC 4912 6246 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_22660 6243 8345 gene locus_tag LOCUS_22670 6243 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8324 9874 gene locus_tag LOCUS_22680 8324 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9917 10855 gene locus_tag LOCUS_22690 9917 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 13964 10866 gene locus_tag LOCUS_22700 13964 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 15019 13961 gene locus_tag LOCUS_22710 15019 13961 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_22710 15608 15006 gene locus_tag LOCUS_22720 15608 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 16060 15656 gene locus_tag LOCUS_22730 16060 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 16171 16986 gene locus_tag LOCUS_22740 16171 16986 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_22740 20060 17070 gene locus_tag LOCUS_22750 20060 17070 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_22750 20759 20181 gene locus_tag LOCUS_22760 20759 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 22609 20828 gene locus_tag LOCUS_22770 22609 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 24034 23780 gene locus_tag LOCUS_22780 24034 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 25056 24034 gene locus_tag LOCUS_22790 gene mltG 25056 24034 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022116.1 protein_id gnl|my_center|LOCUS_22790 25118 25726 gene locus_tag LOCUS_22800 25118 25726 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_22800 26829 25717 gene locus_tag LOCUS_22810 26829 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 28054 26972 gene locus_tag LOCUS_22820 28054 26972 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_22820 28105 28461 gene locus_tag LOCUS_22830 28105 28461 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_22830 29365 28475 gene locus_tag LOCUS_22840 29365 28475 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_22840 31892 29358 gene locus_tag LOCUS_22850 31892 29358 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_22850 35160 31906 gene locus_tag LOCUS_22860 35160 31906 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_22860 36133 35165 gene locus_tag LOCUS_22870 36133 35165 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_22870 37577 36153 gene locus_tag LOCUS_22880 37577 36153 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_22880 38557 37790 gene locus_tag LOCUS_22890 38557 37790 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_22890 39148 38585 gene locus_tag LOCUS_22900 39148 38585 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_22900 40110 39148 gene locus_tag LOCUS_22910 40110 39148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_22910 41253 40135 gene locus_tag LOCUS_22920 gene dnaJ 41253 40135 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004170.1 protein_id gnl|my_center|LOCUS_22920 43203 41272 gene locus_tag LOCUS_22930 gene dnaK 43203 41272 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031822.1 protein_id gnl|my_center|LOCUS_22930 43828 43232 gene locus_tag LOCUS_22940 gene grpE 43828 43232 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829531.1 protein_id gnl|my_center|LOCUS_22940 44873 43842 gene locus_tag LOCUS_22950 gene hrcA 44873 43842 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366219.1 protein_id gnl|my_center|LOCUS_22950 44936 45538 gene locus_tag LOCUS_22960 44936 45538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 45546 46010 gene locus_tag LOCUS_22970 45546 46010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 protein_id gnl|my_center|LOCUS_22970 46076 47260 gene locus_tag LOCUS_22980 46076 47260 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_22980 47324 47836 gene locus_tag LOCUS_22990 47324 47836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 48277 47810 gene locus_tag LOCUS_23000 48277 47810 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_23000 48351 49529 gene locus_tag LOCUS_23010 48351 49529 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_23010 50480 49548 gene locus_tag LOCUS_23020 50480 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 51672 50473 gene locus_tag LOCUS_23030 51672 50473 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_23030 52154 51669 gene locus_tag LOCUS_23040 52154 51669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 52201 54750 gene locus_tag LOCUS_23050 52201 54750 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130940.1 protein_id gnl|my_center|LOCUS_23050 54753 56375 gene locus_tag LOCUS_23060 54753 56375 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_23060 57866 56382 gene locus_tag LOCUS_23070 57866 56382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 58587 58249 gene locus_tag LOCUS_23080 58587 58249 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004296.1 protein_id gnl|my_center|LOCUS_23080 59874 58657 gene locus_tag LOCUS_23090 59874 58657 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_23090 60983 59943 gene locus_tag LOCUS_23100 60983 59943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 61531 61004 gene locus_tag LOCUS_23110 61531 61004 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_23110 62966 61518 gene locus_tag LOCUS_23120 62966 61518 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_23120 63753 63019 gene locus_tag LOCUS_23130 63753 63019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861512.1 protein_id gnl|my_center|LOCUS_23130 64897 63761 gene locus_tag LOCUS_23140 gene aroC 64897 63761 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141234.1 protein_id gnl|my_center|LOCUS_23140 64974 65486 gene locus_tag LOCUS_23150 64974 65486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 65473 66012 gene locus_tag LOCUS_23160 65473 66012 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572205.1 protein_id gnl|my_center|LOCUS_23160 66009 66977 gene locus_tag LOCUS_23170 66009 66977 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371239.1 protein_id gnl|my_center|LOCUS_23170 66980 67702 gene locus_tag LOCUS_23180 66980 67702 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076103.1 protein_id gnl|my_center|LOCUS_23180 69326 67656 gene locus_tag LOCUS_23190 69326 67656 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885542.1 protein_id gnl|my_center|LOCUS_23190 70961 69354 gene locus_tag LOCUS_23200 70961 69354 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508949.1 protein_id gnl|my_center|LOCUS_23200 71474 70980 gene locus_tag LOCUS_23210 71474 70980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443328.1 protein_id gnl|my_center|LOCUS_23210 71617 72843 gene locus_tag LOCUS_23220 71617 72843 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794293.1 protein_id gnl|my_center|LOCUS_23220 72858 75494 gene locus_tag LOCUS_23230 gene pepN 72858 75494 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_23230 75461 75823 gene locus_tag LOCUS_23240 75461 75823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 75833 76195 gene locus_tag LOCUS_23250 75833 76195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 77138 76182 gene locus_tag LOCUS_23260 77138 76182 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595809.1 protein_id gnl|my_center|LOCUS_23260 78385 77372 gene locus_tag LOCUS_23270 gene fliG 78385 77372 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_23270 78580 79008 gene locus_tag LOCUS_23280 78580 79008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 79125 79715 gene locus_tag LOCUS_23290 79125 79715 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_23290 79727 80680 gene locus_tag LOCUS_23300 79727 80680 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_23300 81204 80851 gene locus_tag LOCUS_23310 81204 80851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 83143 81443 gene locus_tag LOCUS_23320 83143 81443 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458677.1 protein_id gnl|my_center|LOCUS_23320 83964 83284 gene locus_tag LOCUS_23330 83964 83284 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_23330 84533 83961 gene locus_tag LOCUS_23340 84533 83961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 84532 85611 gene locus_tag LOCUS_23350 84532 85611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871902.1 protein_id gnl|my_center|LOCUS_23350 86604 85615 gene locus_tag LOCUS_23360 86604 85615 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410870.1 protein_id gnl|my_center|LOCUS_23360 89064 86635 gene locus_tag LOCUS_23370 89064 86635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 89308 89961 gene locus_tag LOCUS_23380 89308 89961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684121.1 protein_id gnl|my_center|LOCUS_23380 90737 89958 gene locus_tag LOCUS_23390 90737 89958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 91236 90745 gene locus_tag LOCUS_23400 91236 90745 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746232.1 protein_id gnl|my_center|LOCUS_23400 91466 91239 gene locus_tag LOCUS_23410 91466 91239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 91657 92580 gene locus_tag LOCUS_23420 91657 92580 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805390.1 protein_id gnl|my_center|LOCUS_23420 92582 92803 gene locus_tag LOCUS_23430 92582 92803 CDS product transcriptional coactivator p15/PC4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538231.1 protein_id gnl|my_center|LOCUS_23430 94446 92800 gene locus_tag LOCUS_23440 94446 92800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 94527 95237 gene locus_tag LOCUS_23450 94527 95237 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369357.1 protein_id gnl|my_center|LOCUS_23450 95237 98080 gene locus_tag LOCUS_23460 95237 98080 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393269.1 protein_id gnl|my_center|LOCUS_23460 98349 98197 gene locus_tag LOCUS_23470 98349 98197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 98297 99367 gene locus_tag LOCUS_23480 98297 99367 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263200.1 protein_id gnl|my_center|LOCUS_23480 99368 100234 gene locus_tag LOCUS_23490 99368 100234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 100240 101118 gene locus_tag LOCUS_23500 100240 101118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 101187 101429 gene locus_tag LOCUS_23510 101187 101429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 101426 101671 gene locus_tag LOCUS_23520 101426 101671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 101675 101998 gene locus_tag LOCUS_23530 101675 101998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 102023 102475 gene locus_tag LOCUS_23540 102023 102475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 104680 102533 gene locus_tag LOCUS_23550 104680 102533 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089694.1 protein_id gnl|my_center|LOCUS_23550 104790 105914 gene locus_tag LOCUS_23560 104790 105914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 107878 105911 gene locus_tag LOCUS_23570 gene acs 107878 105911 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983589.1 protein_id gnl|my_center|LOCUS_23570 108525 107974 gene locus_tag LOCUS_23580 gene folE 108525 107974 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_23580 108680 109777 gene locus_tag LOCUS_23590 108680 109777 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512781.1 protein_id gnl|my_center|LOCUS_23590 110024 109782 gene locus_tag LOCUS_23600 110024 109782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 110190 110387 gene locus_tag LOCUS_23610 110190 110387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 110362 110835 gene locus_tag LOCUS_23620 110362 110835 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206947.1 protein_id gnl|my_center|LOCUS_23620 111042 111809 gene locus_tag LOCUS_23630 111042 111809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 111809 112696 gene locus_tag LOCUS_23640 111809 112696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_23640 112733 112945 gene locus_tag LOCUS_23650 112733 112945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 114134 112992 gene locus_tag LOCUS_23660 114134 112992 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834066.1 protein_id gnl|my_center|LOCUS_23660 114204 114289 gene locus_tag LOCUS_t00190 114204 114289 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 114299 114388 gene locus_tag LOCUS_t00200 114299 114388 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 114780 114854 gene locus_tag LOCUS_t00210 114780 114854 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 114845 115297 gene locus_tag LOCUS_23670 114845 115297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 115342 115427 gene locus_tag LOCUS_t00220 115342 115427 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 115439 116911 gene locus_tag LOCUS_23680 gene dnaX 115439 116911 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929205.1 protein_id gnl|my_center|LOCUS_23680 116930 117301 gene locus_tag LOCUS_23690 116930 117301 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459763.1 protein_id gnl|my_center|LOCUS_23690 117393 117887 gene locus_tag LOCUS_23700 gene recR 117393 117887 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829688.1 protein_id gnl|my_center|LOCUS_23700 119436 117898 gene locus_tag LOCUS_23710 119436 117898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282641.1 protein_id gnl|my_center|LOCUS_23710 120309 119443 gene locus_tag LOCUS_23720 120309 119443 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462055.1 protein_id gnl|my_center|LOCUS_23720 121613 120354 gene locus_tag LOCUS_23730 121613 120354 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053886.1 protein_id gnl|my_center|LOCUS_23730 122902 121646 gene locus_tag LOCUS_23740 gene serS 122902 121646 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886261.1 protein_id gnl|my_center|LOCUS_23740 123701 122895 gene locus_tag LOCUS_23750 123701 122895 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253693.1 protein_id gnl|my_center|LOCUS_23750 123932 124801 gene locus_tag LOCUS_23760 123932 124801 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351651.1 protein_id gnl|my_center|LOCUS_23760 124801 125148 gene locus_tag LOCUS_23770 124801 125148 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_23770 125164 125631 gene locus_tag LOCUS_23780 125164 125631 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866690.1 protein_id gnl|my_center|LOCUS_23780 125636 127399 gene locus_tag LOCUS_23790 125636 127399 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267268.1 protein_id gnl|my_center|LOCUS_23790 128275 127382 gene locus_tag LOCUS_23800 128275 127382 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_23800 129041 128280 gene locus_tag LOCUS_23810 129041 128280 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516556.1 protein_id gnl|my_center|LOCUS_23810 129777 129034 gene locus_tag LOCUS_23820 129777 129034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153932.1 protein_id gnl|my_center|LOCUS_23820 129834 130658 gene locus_tag LOCUS_23830 129834 130658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619331.1 protein_id gnl|my_center|LOCUS_23830 131185 130751 gene locus_tag LOCUS_23840 131185 130751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 133199 131325 gene locus_tag LOCUS_23850 gene mnmG 133199 131325 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572982.1 protein_id gnl|my_center|LOCUS_23850 133354 134277 gene locus_tag LOCUS_23860 133354 134277 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841027.1 protein_id gnl|my_center|LOCUS_23860 134287 135225 gene locus_tag LOCUS_23870 134287 135225 CDS product DNA polymerase III subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834729.1 protein_id gnl|my_center|LOCUS_23870 135378 136703 gene locus_tag LOCUS_23880 gene dnaA 135378 136703 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478209.1 protein_id gnl|my_center|LOCUS_23880 136948 138066 gene locus_tag LOCUS_23890 gene dnaN 136948 138066 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695822.1 protein_id gnl|my_center|LOCUS_23890 138066 139169 gene locus_tag LOCUS_23900 gene recF 138066 139169 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478831.1 protein_id gnl|my_center|LOCUS_23900 139166 139495 gene locus_tag LOCUS_23910 139166 139495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 139567 141486 gene locus_tag LOCUS_23920 gene gyrB 139567 141486 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076460.1 protein_id gnl|my_center|LOCUS_23920 141506 144028 gene locus_tag LOCUS_23930 gene gyrA 141506 144028 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076846.1 protein_id gnl|my_center|LOCUS_23930 144031 145047 gene locus_tag LOCUS_23940 gene dusB 144031 145047 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_23940 145063 145446 gene locus_tag LOCUS_23950 145063 145446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 146114 145536 gene locus_tag LOCUS_23960 146114 145536 CDS product lipoprotein LipL21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610519.1 protein_id gnl|my_center|LOCUS_23960 146218 147831 gene locus_tag LOCUS_23970 146218 147831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 147812 148693 gene locus_tag LOCUS_23980 147812 148693 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083576.1 protein_id gnl|my_center|LOCUS_23980 149778 148672 gene locus_tag LOCUS_23990 149778 148672 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212007.1 protein_id gnl|my_center|LOCUS_23990 149830 150060 gene locus_tag LOCUS_24000 149830 150060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 150646 150071 gene locus_tag LOCUS_24010 150646 150071 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636518.1 protein_id gnl|my_center|LOCUS_24010 150665 150928 gene locus_tag LOCUS_24020 150665 150928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 150925 151662 gene locus_tag LOCUS_24030 150925 151662 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998676.1 protein_id gnl|my_center|LOCUS_24030 151670 152296 gene locus_tag LOCUS_24040 151670 152296 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603802.1 protein_id gnl|my_center|LOCUS_24040 153286 152318 gene locus_tag LOCUS_24050 153286 152318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 153375 155048 gene locus_tag LOCUS_24060 153375 155048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 157223 155052 gene locus_tag LOCUS_24070 157223 155052 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022144.1 protein_id gnl|my_center|LOCUS_24070 157897 157223 gene locus_tag LOCUS_24080 gene tsaB 157897 157223 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721734.1 protein_id gnl|my_center|LOCUS_24080 158340 157894 gene locus_tag LOCUS_24090 158340 157894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 159188 158337 gene locus_tag LOCUS_24100 159188 158337 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551848.1 protein_id gnl|my_center|LOCUS_24100 159265 161253 gene locus_tag LOCUS_24110 159265 161253 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_24110 161254 162153 gene locus_tag LOCUS_24120 161254 162153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420355.1 protein_id gnl|my_center|LOCUS_24120 162162 163007 gene locus_tag LOCUS_24130 162162 163007 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400940.1 protein_id gnl|my_center|LOCUS_24130 163099 163674 gene locus_tag LOCUS_24140 gene sodB 163099 163674 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_24140 163792 165177 gene locus_tag LOCUS_24150 gene trpE 163792 165177 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_24150 165178 165795 gene locus_tag LOCUS_24160 165178 165795 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_24160 167004 165772 gene locus_tag LOCUS_24170 167004 165772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781311.1 protein_id gnl|my_center|LOCUS_24170 167392 166979 gene locus_tag LOCUS_24180 167392 166979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 167503 168342 gene locus_tag LOCUS_24190 167503 168342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 169064 168339 gene locus_tag LOCUS_24200 gene cysE 169064 168339 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462634.1 protein_id gnl|my_center|LOCUS_24200 170842 169070 gene locus_tag LOCUS_24210 170842 169070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 170933 171859 gene locus_tag LOCUS_24220 170933 171859 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497874.1 protein_id gnl|my_center|LOCUS_24220 171861 173273 gene locus_tag LOCUS_24230 171861 173273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347907.1 protein_id gnl|my_center|LOCUS_24230 173218 174090 gene locus_tag LOCUS_24240 173218 174090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 175278 174079 gene locus_tag LOCUS_24250 175278 174079 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281953.1 protein_id gnl|my_center|LOCUS_24250 175427 176782 gene locus_tag LOCUS_24260 gene add 175427 176782 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229174.1 protein_id gnl|my_center|LOCUS_24260 176859 177170 gene locus_tag LOCUS_24270 176859 177170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 177441 177764 gene locus_tag LOCUS_24280 177441 177764 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_24280 177776 178084 gene locus_tag LOCUS_24290 177776 178084 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_24290 179665 178364 gene locus_tag LOCUS_24300 gene purB 179665 178364 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567237.1 protein_id gnl|my_center|LOCUS_24300 179776 180543 gene locus_tag LOCUS_24310 179776 180543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043153.1 protein_id gnl|my_center|LOCUS_24310 182470 180530 gene locus_tag LOCUS_24320 182470 180530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 183446 182664 gene locus_tag LOCUS_24330 183446 182664 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761502.1 protein_id gnl|my_center|LOCUS_24330 184336 183443 gene locus_tag LOCUS_24340 184336 183443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 185701 184352 gene locus_tag LOCUS_24350 185701 184352 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214763.1 protein_id gnl|my_center|LOCUS_24350 185793 186038 gene locus_tag LOCUS_24360 185793 186038 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966522.1 protein_id gnl|my_center|LOCUS_24360 186837 186094 gene locus_tag LOCUS_24370 186837 186094 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014140.1 protein_id gnl|my_center|LOCUS_24370 186964 188130 gene locus_tag LOCUS_24380 186964 188130 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_24380 188235 188807 gene locus_tag LOCUS_24390 188235 188807 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479265.1 protein_id gnl|my_center|LOCUS_24390 188804 190699 gene locus_tag LOCUS_24400 188804 190699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667646.1 protein_id gnl|my_center|LOCUS_24400 190696 191097 gene locus_tag LOCUS_24410 190696 191097 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750243.1 protein_id gnl|my_center|LOCUS_24410 193023 191101 gene locus_tag LOCUS_24420 193023 191101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 193337 193101 gene locus_tag LOCUS_24430 193337 193101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 193371 194696 gene locus_tag LOCUS_24440 gene hflX 193371 194696 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960087.1 protein_id gnl|my_center|LOCUS_24440 195067 194693 gene locus_tag LOCUS_24450 195067 194693 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124812.1 protein_id gnl|my_center|LOCUS_24450 196370 195087 gene locus_tag LOCUS_24460 196370 195087 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439719.1 protein_id gnl|my_center|LOCUS_24460 196516 197178 gene locus_tag LOCUS_24470 196516 197178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 197786 197175 gene locus_tag LOCUS_24480 197786 197175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 197882 199156 gene locus_tag LOCUS_24490 197882 199156 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141825.1 protein_id gnl|my_center|LOCUS_24490 199549 199157 gene locus_tag LOCUS_24500 199549 199157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 200000 199542 gene locus_tag LOCUS_24510 200000 199542 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_24510 201537 200098 gene locus_tag LOCUS_24520 201537 200098 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_24520 201631 202494 gene locus_tag LOCUS_24530 gene mtnP 201631 202494 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121285.1 protein_id gnl|my_center|LOCUS_24530 202887 202495 gene locus_tag LOCUS_24540 202887 202495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 204050 202884 gene locus_tag LOCUS_24550 gene galK 204050 202884 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611876.1 protein_id gnl|my_center|LOCUS_24550 204136 205485 gene locus_tag LOCUS_24560 204136 205485 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 protein_id gnl|my_center|LOCUS_24560 206192 205509 gene locus_tag LOCUS_24570 206192 205509 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667727.1 protein_id gnl|my_center|LOCUS_24570 207220 206228 gene locus_tag LOCUS_24580 207220 206228 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027025.1 protein_id gnl|my_center|LOCUS_24580 208739 207243 gene locus_tag LOCUS_24590 208739 207243 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983427.1 protein_id gnl|my_center|LOCUS_24590 211098 208732 gene locus_tag LOCUS_24600 211098 208732 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113417.1 protein_id gnl|my_center|LOCUS_24600 211187 211996 gene locus_tag LOCUS_24610 211187 211996 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033108110.1 protein_id gnl|my_center|LOCUS_24610 212043 212405 gene locus_tag LOCUS_24620 212043 212405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 213177 212398 gene locus_tag LOCUS_24630 213177 212398 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090417.1 protein_id gnl|my_center|LOCUS_24630 214102 213158 gene locus_tag LOCUS_24640 214102 213158 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070306.1 protein_id gnl|my_center|LOCUS_24640 214562 214149 gene locus_tag LOCUS_24650 214562 214149 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091691.1 protein_id gnl|my_center|LOCUS_24650 216713 214605 gene locus_tag LOCUS_24660 216713 214605 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962610.1 protein_id gnl|my_center|LOCUS_24660 217215 216733 gene locus_tag LOCUS_24670 gene coaD 217215 216733 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_24670 218426 217215 gene locus_tag LOCUS_24680 218426 217215 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068290.1 protein_id gnl|my_center|LOCUS_24680 218507 219643 gene locus_tag LOCUS_24690 218507 219643 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_24690 219627 220181 gene locus_tag LOCUS_24700 219627 220181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061045.1 protein_id gnl|my_center|LOCUS_24700 220182 221735 gene locus_tag LOCUS_24710 220182 221735 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016790.1 protein_id gnl|my_center|LOCUS_24710 221792 221986 gene locus_tag LOCUS_24720 221792 221986 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_24720 222010 222438 gene locus_tag LOCUS_24730 222010 222438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 223647 222472 gene locus_tag LOCUS_24740 gene rlmD 223647 222472 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804174.1 protein_id gnl|my_center|LOCUS_24740 224723 223647 gene locus_tag LOCUS_24750 224723 223647 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972959.1 protein_id gnl|my_center|LOCUS_24750 224829 226439 gene locus_tag LOCUS_24760 224829 226439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 226436 227368 gene locus_tag LOCUS_24770 226436 227368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 227537 227385 gene locus_tag LOCUS_24780 227537 227385 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_24780 227955 227548 gene locus_tag LOCUS_24790 227955 227548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 229806 227962 gene locus_tag LOCUS_24800 229806 227962 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_24800 231620 229941 gene locus_tag LOCUS_24810 231620 229941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 233092 232115 gene locus_tag LOCUS_24820 gene ephM 233092 232115 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_24820 233236 233817 gene locus_tag LOCUS_24830 233236 233817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_24830 234621 234273 gene locus_tag LOCUS_tm00010 234621 234273 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 234716 235849 gene locus_tag LOCUS_24840 234716 235849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067879.1 protein_id gnl|my_center|LOCUS_24840 235846 236493 gene locus_tag LOCUS_24850 235846 236493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281797.1 protein_id gnl|my_center|LOCUS_24850 236494 237228 gene locus_tag LOCUS_24860 236494 237228 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088841.1 protein_id gnl|my_center|LOCUS_24860 237225 237647 gene locus_tag LOCUS_24870 237225 237647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 237653 238642 gene locus_tag LOCUS_24880 237653 238642 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943790.1 protein_id gnl|my_center|LOCUS_24880 239260 238655 gene locus_tag LOCUS_24890 239260 238655 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_24890 239915 239277 gene locus_tag LOCUS_24900 239915 239277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 240677 239964 gene locus_tag LOCUS_24910 240677 239964 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188398.1 protein_id gnl|my_center|LOCUS_24910 241614 240691 gene locus_tag LOCUS_24920 241614 240691 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_24920 242282 241611 gene locus_tag LOCUS_24930 242282 241611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 243014 242298 gene locus_tag LOCUS_24940 243014 242298 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535419.1 protein_id gnl|my_center|LOCUS_24940 243156 244448 gene locus_tag LOCUS_24950 243156 244448 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974248.1 protein_id gnl|my_center|LOCUS_24950 244560 244937 gene locus_tag LOCUS_24960 244560 244937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414808.1 protein_id gnl|my_center|LOCUS_24960 245038 245871 gene locus_tag LOCUS_24970 245038 245871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 246476 245883 gene locus_tag LOCUS_24980 246476 245883 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437523.1 protein_id gnl|my_center|LOCUS_24980 246900 246478 gene locus_tag LOCUS_24990 246900 246478 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_24990 247319 246900 gene locus_tag LOCUS_25000 247319 246900 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619314.1 protein_id gnl|my_center|LOCUS_25000 248180 247332 gene locus_tag LOCUS_25010 248180 247332 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668013.1 protein_id gnl|my_center|LOCUS_25010 249353 248574 gene locus_tag LOCUS_25020 249353 248574 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580059.1 protein_id gnl|my_center|LOCUS_25020 250051 249356 gene locus_tag LOCUS_25030 250051 249356 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_25030 251868 250054 gene locus_tag LOCUS_25040 251868 250054 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_25040 252560 251865 gene locus_tag LOCUS_25050 252560 251865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 253809 252574 gene locus_tag LOCUS_25060 253809 252574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010415565.1 protein_id gnl|my_center|LOCUS_25060 253986 255281 gene locus_tag LOCUS_25070 253986 255281 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981895.1 protein_id gnl|my_center|LOCUS_25070 255297 257051 gene locus_tag LOCUS_25080 255297 257051 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101415.1 protein_id gnl|my_center|LOCUS_25080 257087 260431 gene locus_tag LOCUS_25090 257087 260431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 260436 261452 gene locus_tag LOCUS_25100 260436 261452 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_25100 262626 261628 gene locus_tag LOCUS_25110 262626 261628 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_25110 263180 262650 gene locus_tag LOCUS_25120 263180 262650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183762.1 protein_id gnl|my_center|LOCUS_25120 264296 263184 gene locus_tag LOCUS_25130 264296 263184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 264382 266235 gene locus_tag LOCUS_25140 264382 266235 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_25140 266225 267544 gene locus_tag LOCUS_25150 266225 267544 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_25150 269290 267548 gene locus_tag LOCUS_25160 269290 267548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 270549 269287 gene locus_tag LOCUS_25170 270549 269287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 270787 271815 gene locus_tag LOCUS_25180 gene gmd 270787 271815 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709513.1 protein_id gnl|my_center|LOCUS_25180 272167 271862 gene locus_tag LOCUS_25190 272167 271862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 273427 272216 gene locus_tag LOCUS_25200 273427 272216 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103068.1 protein_id gnl|my_center|LOCUS_25200 274036 273509 gene locus_tag LOCUS_25210 274036 273509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 274965 274051 gene locus_tag LOCUS_25220 274965 274051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 275765 275139 gene locus_tag LOCUS_25230 275765 275139 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234817.1 protein_id gnl|my_center|LOCUS_25230 276982 275765 gene locus_tag LOCUS_25240 276982 275765 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166720.1 protein_id gnl|my_center|LOCUS_25240 277024 278451 gene locus_tag LOCUS_25250 gene purF 277024 278451 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086941.1 protein_id gnl|my_center|LOCUS_25250 278454 278828 gene locus_tag LOCUS_25260 gene queD 278454 278828 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391049.1 protein_id gnl|my_center|LOCUS_25260 278842 279558 gene locus_tag LOCUS_25270 gene queC 278842 279558 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088969.1 protein_id gnl|my_center|LOCUS_25270 279785 279713 gene locus_tag LOCUS_t00230 279785 279713 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 279868 281376 gene locus_tag LOCUS_25280 279868 281376 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393446.1 protein_id gnl|my_center|LOCUS_25280 281387 281716 gene locus_tag LOCUS_25290 281387 281716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983891.1 protein_id gnl|my_center|LOCUS_25290 282102 281686 gene locus_tag LOCUS_25300 282102 281686 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_25300 282124 282459 gene locus_tag LOCUS_25310 282124 282459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192756.1 protein_id gnl|my_center|LOCUS_25310 283199 282456 gene locus_tag LOCUS_25320 283199 282456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069317.1 protein_id gnl|my_center|LOCUS_25320 284095 283196 gene locus_tag LOCUS_25330 284095 283196 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961610.1 protein_id gnl|my_center|LOCUS_25330 284176 285078 gene locus_tag LOCUS_25340 284176 285078 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804809.1 protein_id gnl|my_center|LOCUS_25340 285125 286300 gene locus_tag LOCUS_25350 285125 286300 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_25350 286301 287344 gene locus_tag LOCUS_25360 286301 287344 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_25360 287334 287744 gene locus_tag LOCUS_25370 287334 287744 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153016.1 protein_id gnl|my_center|LOCUS_25370 287745 288461 gene locus_tag LOCUS_25380 287745 288461 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022303.1 protein_id gnl|my_center|LOCUS_25380 289095 288454 gene locus_tag LOCUS_25390 289095 288454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 290143 289127 gene locus_tag LOCUS_25400 290143 289127 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_25400 290440 290153 gene locus_tag LOCUS_25410 290440 290153 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534971.1 protein_id gnl|my_center|LOCUS_25410 290961 290476 gene locus_tag LOCUS_25420 290961 290476 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360600.1 protein_id gnl|my_center|LOCUS_25420 291065 291553 gene locus_tag LOCUS_25430 gene sixA 291065 291553 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691324.1 protein_id gnl|my_center|LOCUS_25430 291638 291709 gene locus_tag LOCUS_t00240 291638 291709 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 292095 291802 gene locus_tag LOCUS_25440 292095 291802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428739.1 protein_id gnl|my_center|LOCUS_25440 292267 293235 gene locus_tag LOCUS_25450 292267 293235 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_25450 293723 293193 gene locus_tag LOCUS_25460 293723 293193 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257917.1 protein_id gnl|my_center|LOCUS_25460 293842 295518 gene locus_tag LOCUS_25470 293842 295518 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_25470 295713 296396 gene locus_tag LOCUS_25480 295713 296396 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_25480 297361 296702 gene locus_tag LOCUS_25490 297361 296702 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101186.1 protein_id gnl|my_center|LOCUS_25490 299775 297361 gene locus_tag LOCUS_25500 299775 297361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 300577 300086 gene locus_tag LOCUS_25510 300577 300086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131967.1 protein_id gnl|my_center|LOCUS_25510 300699 302729 gene locus_tag LOCUS_25520 gene metG 300699 302729 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088999.1 protein_id gnl|my_center|LOCUS_25520 302748 304037 gene locus_tag LOCUS_25530 302748 304037 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146178.1 protein_id gnl|my_center|LOCUS_25530 304038 304646 gene locus_tag LOCUS_25540 304038 304646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 304650 305006 gene locus_tag LOCUS_25550 304650 305006 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 protein_id gnl|my_center|LOCUS_25550 305479 305003 gene locus_tag LOCUS_25560 305479 305003 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_25560 305532 306056 gene locus_tag LOCUS_25570 305532 306056 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697175.1 protein_id gnl|my_center|LOCUS_25570 307939 306059 gene locus_tag LOCUS_25580 307939 306059 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929340.1 protein_id gnl|my_center|LOCUS_25580 308020 308943 gene locus_tag LOCUS_25590 gene thyX 308020 308943 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_25590 309020 309733 gene locus_tag LOCUS_25600 309020 309733 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106963.1 protein_id gnl|my_center|LOCUS_25600 309733 311133 gene locus_tag LOCUS_25610 309733 311133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218028.1 protein_id gnl|my_center|LOCUS_25610 311138 312421 gene locus_tag LOCUS_25620 311138 312421 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949344.1 protein_id gnl|my_center|LOCUS_25620 313816 312875 gene locus_tag LOCUS_25630 313816 312875 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_25630 314178 313813 gene locus_tag LOCUS_25640 314178 313813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 314393 316117 gene locus_tag LOCUS_25650 314393 316117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 317161 316124 gene locus_tag LOCUS_25660 317161 316124 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_25660 317772 317161 gene locus_tag LOCUS_25670 317772 317161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529883.1 protein_id gnl|my_center|LOCUS_25670 317869 318705 gene locus_tag LOCUS_25680 317869 318705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648678.1 protein_id gnl|my_center|LOCUS_25680 318766 319374 gene locus_tag LOCUS_25690 318766 319374 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621499.1 protein_id gnl|my_center|LOCUS_25690 319374 320816 gene locus_tag LOCUS_25700 319374 320816 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687494.1 protein_id gnl|my_center|LOCUS_25700 320833 323286 gene locus_tag LOCUS_25710 320833 323286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 323283 323705 gene locus_tag LOCUS_25720 323283 323705 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033731.1 protein_id gnl|my_center|LOCUS_25720 323698 324873 gene locus_tag LOCUS_25730 323698 324873 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_25730 324972 325169 gene locus_tag LOCUS_25740 324972 325169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 326305 325166 gene locus_tag LOCUS_25750 326305 325166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669757.1 protein_id gnl|my_center|LOCUS_25750 326931 326302 gene locus_tag LOCUS_25760 326931 326302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427417.1 protein_id gnl|my_center|LOCUS_25760 326989 328050 gene locus_tag LOCUS_25770 gene prfA 326989 328050 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567183.1 protein_id gnl|my_center|LOCUS_25770 328116 329849 gene locus_tag LOCUS_25780 328116 329849 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037804.1 protein_id gnl|my_center|LOCUS_25780 329870 330484 gene locus_tag LOCUS_25790 329870 330484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 330586 331128 gene locus_tag LOCUS_25800 330586 331128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 331564 333267 gene locus_tag LOCUS_25810 331564 333267 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 protein_id gnl|my_center|LOCUS_25810 333298 333933 gene locus_tag LOCUS_25820 333298 333933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 334852 333965 gene locus_tag LOCUS_25830 gene metF 334852 333965 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_25830 335680 334865 gene locus_tag LOCUS_25840 335680 334865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_25840 335742 336497 gene locus_tag LOCUS_25850 335742 336497 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181792.1 protein_id gnl|my_center|LOCUS_25850 336498 337301 gene locus_tag LOCUS_25860 336498 337301 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928025.1 protein_id gnl|my_center|LOCUS_25860 337934 337287 gene locus_tag LOCUS_25870 337934 337287 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844452.1 protein_id gnl|my_center|LOCUS_25870 339291 337921 gene locus_tag LOCUS_25880 339291 337921 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506556.1 protein_id gnl|my_center|LOCUS_25880 339742 339404 gene locus_tag LOCUS_25890 339742 339404 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404111.1 protein_id gnl|my_center|LOCUS_25890 340156 339797 gene locus_tag LOCUS_25900 340156 339797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 340625 341695 gene locus_tag LOCUS_25910 340625 341695 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_25910 341698 342570 gene locus_tag LOCUS_25920 341698 342570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 342570 343382 gene locus_tag LOCUS_25930 342570 343382 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050899.1 protein_id gnl|my_center|LOCUS_25930 344553 343363 gene locus_tag LOCUS_25940 344553 343363 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842681.1 protein_id gnl|my_center|LOCUS_25940 345612 344560 gene locus_tag LOCUS_25950 345612 344560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_25950 346670 345609 gene locus_tag LOCUS_25960 346670 345609 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870443.1 protein_id gnl|my_center|LOCUS_25960 347689 346670 gene locus_tag LOCUS_25970 347689 346670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389571.1 protein_id gnl|my_center|LOCUS_25970 347774 348688 gene locus_tag LOCUS_25980 347774 348688 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_25980 349859 348678 gene locus_tag LOCUS_25990 349859 348678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 350816 349860 gene locus_tag LOCUS_26000 350816 349860 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395239.1 protein_id gnl|my_center|LOCUS_26000 351283 351083 gene locus_tag LOCUS_26010 351283 351083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 351425 352414 gene locus_tag LOCUS_26020 351425 352414 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134756.1 protein_id gnl|my_center|LOCUS_26020 353598 352363 gene locus_tag LOCUS_26030 353598 352363 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_26030 354386 353604 gene locus_tag LOCUS_26040 354386 353604 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_26040 354504 355757 gene locus_tag LOCUS_26050 354504 355757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_26050 356723 355776 gene locus_tag LOCUS_26060 356723 355776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264550.1 protein_id gnl|my_center|LOCUS_26060 357221 356757 gene locus_tag LOCUS_26070 357221 356757 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478347.1 protein_id gnl|my_center|LOCUS_26070 357370 357723 gene locus_tag LOCUS_26080 357370 357723 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587664.1 protein_id gnl|my_center|LOCUS_26080 357768 359252 gene locus_tag LOCUS_26090 357768 359252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 359947 359249 gene locus_tag LOCUS_26100 359947 359249 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718925.1 protein_id gnl|my_center|LOCUS_26100 360014 360787 gene locus_tag LOCUS_26110 360014 360787 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001943.1 protein_id gnl|my_center|LOCUS_26110 360791 361315 gene locus_tag LOCUS_26120 gene dcd 360791 361315 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604072.1 protein_id gnl|my_center|LOCUS_26120 361879 361355 gene locus_tag LOCUS_26130 361879 361355 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640259.1 protein_id gnl|my_center|LOCUS_26130 365294 362067 gene locus_tag LOCUS_26140 365294 362067 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_26140 366346 365441 gene locus_tag LOCUS_26150 366346 365441 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033108072.1 protein_id gnl|my_center|LOCUS_26150 366455 367351 gene locus_tag LOCUS_26160 366455 367351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145208.1 protein_id gnl|my_center|LOCUS_26160 367436 368275 gene locus_tag LOCUS_26170 367436 368275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 368713 369651 gene locus_tag LOCUS_26180 368713 369651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 370541 369696 gene locus_tag LOCUS_26190 gene folP 370541 369696 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444207.1 protein_id gnl|my_center|LOCUS_26190 370603 372621 gene locus_tag LOCUS_26200 370603 372621 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247314.1 protein_id gnl|my_center|LOCUS_26200 372674 373750 gene locus_tag LOCUS_26210 372674 373750 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116023.1 protein_id gnl|my_center|LOCUS_26210 373782 375092 gene locus_tag LOCUS_26220 gene hisS 373782 375092 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_26220 375197 375616 gene locus_tag LOCUS_26230 375197 375616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 375635 376534 gene locus_tag LOCUS_26240 375635 376534 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_26240 376535 377461 gene locus_tag LOCUS_26250 376535 377461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence37 1868 2521 gene locus_tag LOCUS_26260 1868 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence38 >Feature sequence39 231 1337 gene locus_tag LOCUS_26270 231 1337 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991727.1 protein_id gnl|my_center|LOCUS_26270 1854 1342 gene locus_tag LOCUS_26280 1854 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence40 195 1337 gene locus_tag LOCUS_26290 195 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1321 1662 gene locus_tag LOCUS_26300 1321 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1842 2060 gene locus_tag LOCUS_26310 1842 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence41 405 1900 gene locus_tag LOCUS_r00010 405 1900 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence42 >Feature sequence43 <1 782 gene locus_tag LOCUS_26320 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018305385.1:M23 family metallopeptidase 779 1507 gene locus_tag LOCUS_26330 779 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence44 >Feature sequence45 >Feature sequence46 <1 782 gene locus_tag LOCUS_26340 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458832.1:peptidoglycan DD-metalloendopeptidase family protein 779 1501 gene locus_tag LOCUS_26350 779 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence47 742 572 gene locus_tag LOCUS_26360 742 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2203 1022 gene locus_tag LOCUS_26370 gene purT 2203 1022 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_26370 2710 2264 gene locus_tag LOCUS_26380 2710 2264 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_26380 4177 2723 gene locus_tag LOCUS_26390 4177 2723 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_26390 5837 4191 gene locus_tag LOCUS_26400 5837 4191 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_26400 6317 5916 gene locus_tag LOCUS_26410 6317 5916 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929556.1 protein_id gnl|my_center|LOCUS_26410 6826 6314 gene locus_tag LOCUS_26420 6826 6314 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640378.1 protein_id gnl|my_center|LOCUS_26420 7147 7980 gene locus_tag LOCUS_26430 7147 7980 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_26430 7977 8702 gene locus_tag LOCUS_26440 7977 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26440 8689 9927 gene locus_tag LOCUS_26450 8689 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26450 10936 9869 gene locus_tag LOCUS_26460 gene lpxK 10936 9869 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084119.1 protein_id gnl|my_center|LOCUS_26460 11227 10949 gene locus_tag LOCUS_26470 gene hisE 11227 10949 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394955.1 protein_id gnl|my_center|LOCUS_26470 11328 12158 gene locus_tag LOCUS_26480 11328 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 13459 12155 gene locus_tag LOCUS_26490 13459 12155 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861675.1 protein_id gnl|my_center|LOCUS_26490 14695 13538 gene locus_tag LOCUS_26500 14695 13538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054169.1 protein_id gnl|my_center|LOCUS_26500 15486 14737 gene locus_tag LOCUS_26510 15486 14737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916820.1 protein_id gnl|my_center|LOCUS_26510 15955 15743 gene locus_tag LOCUS_26520 15955 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 16231 17790 gene locus_tag LOCUS_26530 16231 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 18671 17787 gene locus_tag LOCUS_26540 18671 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 19170 18688 gene locus_tag LOCUS_26550 19170 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943435.1 protein_id gnl|my_center|LOCUS_26550 20277 19171 gene locus_tag LOCUS_26560 20277 19171 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680548.1 protein_id gnl|my_center|LOCUS_26560 21007 20537 gene locus_tag LOCUS_26570 21007 20537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032646.1 protein_id gnl|my_center|LOCUS_26570 23568 21061 gene locus_tag LOCUS_26580 23568 21061 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_26580 24078 23620 gene locus_tag LOCUS_26590 24078 23620 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278813.1 protein_id gnl|my_center|LOCUS_26590 24849 24079 gene locus_tag LOCUS_26600 24849 24079 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291082.1 protein_id gnl|my_center|LOCUS_26600 26231 24867 gene locus_tag LOCUS_26610 26231 24867 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219857.1 protein_id gnl|my_center|LOCUS_26610 26573 26232 gene locus_tag LOCUS_26620 26573 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906752.1 protein_id gnl|my_center|LOCUS_26620 26717 27637 gene locus_tag LOCUS_26630 26717 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927885.1 protein_id gnl|my_center|LOCUS_26630 27684 29012 gene locus_tag LOCUS_26640 27684 29012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769786.1 protein_id gnl|my_center|LOCUS_26640 29118 30866 gene locus_tag LOCUS_26650 29118 30866 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704964.1 protein_id gnl|my_center|LOCUS_26650 30879 31394 gene locus_tag LOCUS_26660 30879 31394 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_26660 31395 33176 gene locus_tag LOCUS_26670 31395 33176 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_26670 33173 34216 gene locus_tag LOCUS_26680 gene cheB 33173 34216 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392014.1 protein_id gnl|my_center|LOCUS_26680 34213 35463 gene locus_tag LOCUS_26690 34213 35463 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402080.1 protein_id gnl|my_center|LOCUS_26690 35479 35838 gene locus_tag LOCUS_26700 35479 35838 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151341.1 protein_id gnl|my_center|LOCUS_26700 35859 38321 gene locus_tag LOCUS_26710 35859 38321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 39345 38314 gene locus_tag LOCUS_26720 gene purM 39345 38314 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203232959.1 protein_id gnl|my_center|LOCUS_26720 40141 39338 gene locus_tag LOCUS_26730 gene murI 40141 39338 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662655.1 protein_id gnl|my_center|LOCUS_26730 41442 40141 gene locus_tag LOCUS_26740 41442 40141 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253865.1 protein_id gnl|my_center|LOCUS_26740 42390 41455 gene locus_tag LOCUS_26750 42390 41455 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001976240.1 protein_id gnl|my_center|LOCUS_26750 42586 43665 gene locus_tag LOCUS_26760 42586 43665 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_26760 51720 43750 gene locus_tag LOCUS_26770 51720 43750 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251296.1 protein_id gnl|my_center|LOCUS_26770 52317 51721 gene locus_tag LOCUS_26780 52317 51721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795862.1 protein_id gnl|my_center|LOCUS_26780 55231 52328 gene locus_tag LOCUS_26790 55231 52328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402241.1 protein_id gnl|my_center|LOCUS_26790 55725 55384 gene locus_tag LOCUS_26800 55725 55384 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_26800 56608 55790 gene locus_tag LOCUS_26810 56608 55790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 58089 56710 gene locus_tag LOCUS_26820 gene nhaC 58089 56710 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068039.1 protein_id gnl|my_center|LOCUS_26820 59352 58096 gene locus_tag LOCUS_26830 59352 58096 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_26830 59476 59904 gene locus_tag LOCUS_26840 59476 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 60819 60112 gene locus_tag LOCUS_26850 60819 60112 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822485.1 protein_id gnl|my_center|LOCUS_26850 62161 60953 gene locus_tag LOCUS_26860 62161 60953 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_26860 64705 62168 gene locus_tag LOCUS_26870 64705 62168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 66449 65289 gene locus_tag LOCUS_26880 66449 65289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 66599 67192 gene locus_tag LOCUS_26890 66599 67192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 68044 68652 gene locus_tag LOCUS_26900 68044 68652 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527819.1 protein_id gnl|my_center|LOCUS_26900 69308 69553 gene locus_tag LOCUS_26910 69308 69553 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004496206.1 protein_id gnl|my_center|LOCUS_26910 69550 69975 gene locus_tag LOCUS_26920 69550 69975 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_26920 70245 70589 gene locus_tag LOCUS_26930 70245 70589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 70576 71124 gene locus_tag LOCUS_26940 70576 71124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 71379 71597 gene locus_tag LOCUS_26950 71379 71597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790422.1 protein_id gnl|my_center|LOCUS_26950 71587 72042 gene locus_tag LOCUS_26960 71587 72042 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_26960 72256 72708 gene locus_tag LOCUS_26970 72256 72708 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 protein_id gnl|my_center|LOCUS_26970 73106 73384 gene locus_tag LOCUS_26980 73106 73384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 73368 73766 gene locus_tag LOCUS_26990 73368 73766 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_26990 74024 74218 gene locus_tag LOCUS_27000 74024 74218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 74455 74210 gene locus_tag LOCUS_27010 74455 74210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 76068 74512 gene locus_tag LOCUS_27020 76068 74512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 77034 76222 gene locus_tag LOCUS_27030 77034 76222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 78964 77051 gene locus_tag LOCUS_27040 78964 77051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 79241 79852 gene locus_tag LOCUS_27050 79241 79852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 80161 81525 gene locus_tag LOCUS_27060 80161 81525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 81798 83192 gene locus_tag LOCUS_27070 81798 83192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 84510 83224 gene locus_tag LOCUS_27080 84510 83224 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_27080 86121 85237 gene locus_tag LOCUS_27090 gene xerC 86121 85237 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_27090 86485 87639 gene locus_tag LOCUS_27100 gene recA 86485 87639 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504720.1 protein_id gnl|my_center|LOCUS_27100 88224 87742 gene locus_tag LOCUS_27110 88224 87742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 90769 88214 gene locus_tag LOCUS_27120 90769 88214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 90857 91852 gene locus_tag LOCUS_27130 90857 91852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_27130 92842 92012 gene locus_tag LOCUS_27140 92842 92012 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_27140 95265 92878 gene locus_tag LOCUS_27150 gene clpB 95265 92878 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038185.1 protein_id gnl|my_center|LOCUS_27150 95400 96809 gene locus_tag LOCUS_27160 95400 96809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 96870 98768 gene locus_tag LOCUS_27170 96870 98768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 100978 98786 gene locus_tag LOCUS_27180 100978 98786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 102991 101066 gene locus_tag LOCUS_27190 102991 101066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 103012 103557 gene locus_tag LOCUS_27200 103012 103557 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941388.1 protein_id gnl|my_center|LOCUS_27200 104804 103554 gene locus_tag LOCUS_27210 104804 103554 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402080.1 protein_id gnl|my_center|LOCUS_27210 105195 104827 gene locus_tag LOCUS_27220 105195 104827 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_27220 106235 105204 gene locus_tag LOCUS_27230 106235 105204 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918324.1 protein_id gnl|my_center|LOCUS_27230 108040 106232 gene locus_tag LOCUS_27240 gene cheA 108040 106232 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350517.1 protein_id gnl|my_center|LOCUS_27240 109618 108050 gene locus_tag LOCUS_27250 109618 108050 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266628.1 protein_id gnl|my_center|LOCUS_27250 110163 109636 gene locus_tag LOCUS_27260 110163 109636 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_27260 111528 110266 gene locus_tag LOCUS_27270 111528 110266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 112174 112371 gene locus_tag LOCUS_27280 112174 112371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 113724 112375 gene locus_tag LOCUS_27290 113724 112375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 114697 113813 gene locus_tag LOCUS_27300 114697 113813 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_27300 115984 115127 gene locus_tag LOCUS_27310 115984 115127 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159609.1 protein_id gnl|my_center|LOCUS_27310 118557 116053 gene locus_tag LOCUS_27320 118557 116053 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_27320 118656 120011 gene locus_tag LOCUS_27330 118656 120011 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_27330 122273 120006 gene locus_tag LOCUS_27340 122273 120006 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 protein_id gnl|my_center|LOCUS_27340 123617 122310 gene locus_tag LOCUS_27350 123617 122310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 125368 123614 gene locus_tag LOCUS_27360 125368 123614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 126148 125534 gene locus_tag LOCUS_27370 126148 125534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734052.1 protein_id gnl|my_center|LOCUS_27370 127653 126157 gene locus_tag LOCUS_27380 127653 126157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018490.1 protein_id gnl|my_center|LOCUS_27380 128633 127689 gene locus_tag LOCUS_27390 128633 127689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 129291 128905 gene locus_tag LOCUS_27400 gene cueR 129291 128905 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 protein_id gnl|my_center|LOCUS_27400 129487 131742 gene locus_tag LOCUS_27410 129487 131742 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868075.1 protein_id gnl|my_center|LOCUS_27410 132043 132885 gene locus_tag LOCUS_27420 132043 132885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 133981 132929 gene locus_tag LOCUS_27430 133981 132929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 134597 133983 gene locus_tag LOCUS_27440 134597 133983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 135313 134609 gene locus_tag LOCUS_27450 135313 134609 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705346.1 protein_id gnl|my_center|LOCUS_27450 135406 136374 gene locus_tag LOCUS_27460 135406 136374 CDS product LA_2444/LA_4059 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915032.1 protein_id gnl|my_center|LOCUS_27460 136518 136826 gene locus_tag LOCUS_27470 136518 136826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 138320 136743 gene locus_tag LOCUS_27480 138320 136743 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180837.1 protein_id gnl|my_center|LOCUS_27480 138551 138982 gene locus_tag LOCUS_27490 138551 138982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 139102 139305 gene locus_tag LOCUS_27500 139102 139305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 139619 140998 gene locus_tag LOCUS_27510 139619 140998 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079684.1 protein_id gnl|my_center|LOCUS_27510 141315 141007 gene locus_tag LOCUS_27520 141315 141007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 141398 142468 gene locus_tag LOCUS_27530 141398 142468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 143160 142501 gene locus_tag LOCUS_27540 143160 142501 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_27540 145406 143253 gene locus_tag LOCUS_27550 gene cerN 145406 143253 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_27550 146496 145735 gene locus_tag LOCUS_27560 146496 145735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055336.1 protein_id gnl|my_center|LOCUS_27560 147434 146493 gene locus_tag LOCUS_27570 147434 146493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982953.1 protein_id gnl|my_center|LOCUS_27570 148127 148921 gene locus_tag LOCUS_27580 148127 148921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648678.1 protein_id gnl|my_center|LOCUS_27580 149036 149617 gene locus_tag LOCUS_27590 149036 149617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 150531 149686 gene locus_tag LOCUS_27600 150531 149686 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_27600 151577 150663 gene locus_tag LOCUS_27610 151577 150663 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172234.1 protein_id gnl|my_center|LOCUS_27610 151666 152148 gene locus_tag LOCUS_27620 151666 152148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 152266 153993 gene locus_tag LOCUS_27630 152266 153993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 154404 154060 gene locus_tag LOCUS_27640 154404 154060 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_27640 155718 154414 gene locus_tag LOCUS_27650 155718 154414 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872256.1 protein_id gnl|my_center|LOCUS_27650 156058 156243 gene locus_tag LOCUS_27660 156058 156243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 156586 156275 gene locus_tag LOCUS_27670 156586 156275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 159497 156615 gene locus_tag LOCUS_27680 159497 156615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 161094 159499 gene locus_tag LOCUS_27690 161094 159499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 163595 161091 gene locus_tag LOCUS_27700 163595 161091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 164683 164156 gene locus_tag LOCUS_27710 164683 164156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 164803 165678 gene locus_tag LOCUS_27720 164803 165678 CDS product PcfJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578381.1 protein_id gnl|my_center|LOCUS_27720 166184 165906 gene locus_tag LOCUS_27730 166184 165906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 166876 166767 gene locus_tag LOCUS_r00020 166876 166767 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 167920 166940 gene locus_tag LOCUS_27740 167920 166940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 168770 168207 gene locus_tag LOCUS_27750 168770 168207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 169128 168832 gene locus_tag LOCUS_27760 169128 168832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 170224 169691 gene locus_tag LOCUS_27770 170224 169691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 171014 170292 gene locus_tag LOCUS_27780 171014 170292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 171105 171683 gene locus_tag LOCUS_27790 171105 171683 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890764.1 protein_id gnl|my_center|LOCUS_27790 172120 172275 gene locus_tag LOCUS_27800 172120 172275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 172727 172618 gene locus_tag LOCUS_r00030 172727 172618 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 172784 173287 gene locus_tag LOCUS_27810 172784 173287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 174003 173227 gene locus_tag LOCUS_27820 174003 173227 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007162.1 protein_id gnl|my_center|LOCUS_27820 175736 174000 gene locus_tag LOCUS_27830 175736 174000 CDS product TonB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457083.1 protein_id gnl|my_center|LOCUS_27830 175873 177273 gene locus_tag LOCUS_27840 175873 177273 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412099.1 protein_id gnl|my_center|LOCUS_27840 177273 177758 gene locus_tag LOCUS_27850 177273 177758 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126680.1 protein_id gnl|my_center|LOCUS_27850 178538 177801 gene locus_tag LOCUS_27860 178538 177801 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_27860 179368 178541 gene locus_tag LOCUS_27870 179368 178541 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079537.1 protein_id gnl|my_center|LOCUS_27870 179770 180699 gene locus_tag LOCUS_27880 179770 180699 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738680.1 protein_id gnl|my_center|LOCUS_27880 180830 181873 gene locus_tag LOCUS_27890 180830 181873 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854849.1 protein_id gnl|my_center|LOCUS_27890 181866 183665 gene locus_tag LOCUS_27900 181866 183665 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499632.1 protein_id gnl|my_center|LOCUS_27900 183710 184003 gene locus_tag LOCUS_27910 183710 184003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454661.1 protein_id gnl|my_center|LOCUS_27910 186030 184021 gene locus_tag LOCUS_27920 186030 184021 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063951.1 protein_id gnl|my_center|LOCUS_27920 186200 187450 gene locus_tag LOCUS_27930 186200 187450 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896817.1 protein_id gnl|my_center|LOCUS_27930 187467 187730 gene locus_tag LOCUS_27940 187467 187730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 187736 189805 gene locus_tag LOCUS_27950 gene feoB 187736 189805 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510008.1 protein_id gnl|my_center|LOCUS_27950 189836 190822 gene locus_tag LOCUS_27960 189836 190822 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011675.1 protein_id gnl|my_center|LOCUS_27960 192076 190847 gene locus_tag LOCUS_27970 192076 190847 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071432.1 protein_id gnl|my_center|LOCUS_27970 192833 192099 gene locus_tag LOCUS_27980 gene hisA 192833 192099 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635440.1 protein_id gnl|my_center|LOCUS_27980 193464 192835 gene locus_tag LOCUS_27990 gene hisH 193464 192835 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560473.1 protein_id gnl|my_center|LOCUS_27990 194042 193461 gene locus_tag LOCUS_28000 gene hisB 194042 193461 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130165.1 protein_id gnl|my_center|LOCUS_28000 196582 194321 gene locus_tag LOCUS_28010 196582 194321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 197757 196591 gene locus_tag LOCUS_28020 197757 196591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 198371 197754 gene locus_tag LOCUS_28030 198371 197754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 198886 198407 gene locus_tag LOCUS_28040 198886 198407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068280.1 protein_id gnl|my_center|LOCUS_28040 199893 198940 gene locus_tag LOCUS_28050 199893 198940 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788714.1 protein_id gnl|my_center|LOCUS_28050 200911 200111 gene locus_tag LOCUS_28060 200911 200111 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_28060 201443 200913 gene locus_tag LOCUS_28070 201443 200913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381195.1 protein_id gnl|my_center|LOCUS_28070 201561 202826 gene locus_tag LOCUS_28080 201561 202826 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268191.1 protein_id gnl|my_center|LOCUS_28080 203925 202831 gene locus_tag LOCUS_28090 203925 202831 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232101.1 protein_id gnl|my_center|LOCUS_28090 205435 205611 gene locus_tag LOCUS_28100 205435 205611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 205627 205968 gene locus_tag LOCUS_28110 205627 205968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 209325 206191 gene locus_tag LOCUS_28120 209325 206191 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620776.1 protein_id gnl|my_center|LOCUS_28120 210284 209331 gene locus_tag LOCUS_28130 210284 209331 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690698.1 protein_id gnl|my_center|LOCUS_28130 211557 210292 gene locus_tag LOCUS_28140 211557 210292 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718042.1 protein_id gnl|my_center|LOCUS_28140 214241 211704 gene locus_tag LOCUS_28150 214241 211704 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821884.1 protein_id gnl|my_center|LOCUS_28150 215457 214255 gene locus_tag LOCUS_28160 215457 214255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 216191 215526 gene locus_tag LOCUS_28170 216191 215526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 216584 217405 gene locus_tag LOCUS_28180 216584 217405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 217595 218401 gene locus_tag LOCUS_28190 217595 218401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 218591 219397 gene locus_tag LOCUS_28200 218591 219397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 219534 221636 gene locus_tag LOCUS_28210 219534 221636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 224880 221683 gene locus_tag LOCUS_28220 224880 221683 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_28220 226270 224867 gene locus_tag LOCUS_28230 226270 224867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 226508 226275 gene locus_tag LOCUS_28240 226508 226275 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_28240 226874 226608 gene locus_tag LOCUS_28250 226874 226608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 226889 227707 gene locus_tag LOCUS_28260 226889 227707 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688306.1 protein_id gnl|my_center|LOCUS_28260 228952 227702 gene locus_tag LOCUS_28270 228952 227702 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684307.1 protein_id gnl|my_center|LOCUS_28270 229338 228949 gene locus_tag LOCUS_28280 229338 228949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 229395 229826 gene locus_tag LOCUS_28290 229395 229826 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371377.1 protein_id gnl|my_center|LOCUS_28290 231709 229823 gene locus_tag LOCUS_28300 231709 229823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172203.1 protein_id gnl|my_center|LOCUS_28300 231790 233157 gene locus_tag LOCUS_28310 231790 233157 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348634.1 protein_id gnl|my_center|LOCUS_28310 235588 233123 gene locus_tag LOCUS_28320 235588 233123 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146262.1 protein_id gnl|my_center|LOCUS_28320 237962 235590 gene locus_tag LOCUS_28330 gene lon 237962 235590 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398438.1 protein_id gnl|my_center|LOCUS_28330 239984 237990 gene locus_tag LOCUS_28340 gene uvrB 239984 237990 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179030.1 protein_id gnl|my_center|LOCUS_28340 240679 240005 gene locus_tag LOCUS_28350 240679 240005 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144004.1 protein_id gnl|my_center|LOCUS_28350 241195 240722 gene locus_tag LOCUS_28360 241195 240722 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061100.1 protein_id gnl|my_center|LOCUS_28360 242362 241199 gene locus_tag LOCUS_28370 242362 241199 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664814.1 protein_id gnl|my_center|LOCUS_28370 243705 242359 gene locus_tag LOCUS_28380 243705 242359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028161.1 protein_id gnl|my_center|LOCUS_28380 243848 244534 gene locus_tag LOCUS_28390 243848 244534 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425174.1 protein_id gnl|my_center|LOCUS_28390 244539 245402 gene locus_tag LOCUS_28400 244539 245402 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_28400 245642 245298 gene locus_tag LOCUS_28410 245642 245298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052862.1 protein_id gnl|my_center|LOCUS_28410 245729 246643 gene locus_tag LOCUS_28420 gene aroE 245729 246643 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033107988.1 protein_id gnl|my_center|LOCUS_28420 246589 247872 gene locus_tag LOCUS_28430 246589 247872 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083524.1 protein_id gnl|my_center|LOCUS_28430 247935 248555 gene locus_tag LOCUS_28440 247935 248555 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787373.1 protein_id gnl|my_center|LOCUS_28440 248571 249194 gene locus_tag LOCUS_28450 248571 249194 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984951.1 protein_id gnl|my_center|LOCUS_28450 249181 251712 gene locus_tag LOCUS_28460 gene mutS 249181 251712 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047648.1 protein_id gnl|my_center|LOCUS_28460 252564 251683 gene locus_tag LOCUS_28470 gene serB 252564 251683 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927928.1 protein_id gnl|my_center|LOCUS_28470 253273 252578 gene locus_tag LOCUS_28480 253273 252578 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051394.1 protein_id gnl|my_center|LOCUS_28480 253502 253323 gene locus_tag LOCUS_28490 253502 253323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 255104 253527 gene locus_tag LOCUS_28500 255104 253527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_28500 256224 255166 gene locus_tag LOCUS_28510 gene bioB 256224 255166 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002111813.1 protein_id gnl|my_center|LOCUS_28510 257593 256268 gene locus_tag LOCUS_28520 gene bioA 257593 256268 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638435.1 protein_id gnl|my_center|LOCUS_28520 258287 257577 gene locus_tag LOCUS_28530 gene bioD 258287 257577 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257883.1 protein_id gnl|my_center|LOCUS_28530 258338 258871 gene locus_tag LOCUS_28540 258338 258871 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_28540 258858 259910 gene locus_tag LOCUS_28550 258858 259910 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206646.1 protein_id gnl|my_center|LOCUS_28550 260308 259907 gene locus_tag LOCUS_28560 260308 259907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 260867 262096 gene locus_tag LOCUS_28570 260867 262096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118752.1 protein_id gnl|my_center|LOCUS_28570 262133 262798 gene locus_tag LOCUS_28580 gene ung 262133 262798 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_28580 262788 263681 gene locus_tag LOCUS_28590 gene rarD 262788 263681 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231209.1 protein_id gnl|my_center|LOCUS_28590 263738 264043 gene locus_tag LOCUS_28600 263738 264043 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141644.1 protein_id gnl|my_center|LOCUS_28600 265716 264109 gene locus_tag LOCUS_28610 265716 264109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 266632 265730 gene locus_tag LOCUS_28620 266632 265730 CDS product porin OmpL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620707.1 protein_id gnl|my_center|LOCUS_28620 266779 267414 gene locus_tag LOCUS_28630 266779 267414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 267624 268712 gene locus_tag LOCUS_28640 gene carA 267624 268712 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643186.1 protein_id gnl|my_center|LOCUS_28640 268726 268911 gene locus_tag LOCUS_28650 268726 268911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134554.1 protein_id gnl|my_center|LOCUS_28650 269972 268908 gene locus_tag LOCUS_28660 269972 268908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723594.1 protein_id gnl|my_center|LOCUS_28660 271248 269974 gene locus_tag LOCUS_28670 271248 269974 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898554.1 protein_id gnl|my_center|LOCUS_28670 273613 271400 gene locus_tag LOCUS_28680 273613 271400 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523709.1 protein_id gnl|my_center|LOCUS_28680 275804 273615 gene locus_tag LOCUS_28690 275804 273615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 276110 275814 gene locus_tag LOCUS_28700 276110 275814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 276539 276159 gene locus_tag LOCUS_28710 276539 276159 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723461.1 protein_id gnl|my_center|LOCUS_28710 277963 276557 gene locus_tag LOCUS_28720 gene atpD 277963 276557 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032431.1 protein_id gnl|my_center|LOCUS_28720 278854 277985 gene locus_tag LOCUS_28730 gene atpG 278854 277985 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235141.1 protein_id gnl|my_center|LOCUS_28730 280380 278866 gene locus_tag LOCUS_28740 gene atpA 280380 278866 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695329.1 protein_id gnl|my_center|LOCUS_28740 280939 280370 gene locus_tag LOCUS_28750 gene atpH 280939 280370 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999999.1 protein_id gnl|my_center|LOCUS_28750 281460 280936 gene locus_tag LOCUS_28760 281460 280936 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243426.1 protein_id gnl|my_center|LOCUS_28760 281753 281463 gene locus_tag LOCUS_28770 281753 281463 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394249.1 protein_id gnl|my_center|LOCUS_28770 282859 281801 gene locus_tag LOCUS_28780 gene atpB 282859 281801 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281179.1 protein_id gnl|my_center|LOCUS_28780 283229 282849 gene locus_tag LOCUS_28790 283229 282849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 283688 283503 gene locus_tag LOCUS_28800 283688 283503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 284706 283666 gene locus_tag LOCUS_28810 284706 283666 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_28810 285609 285016 gene locus_tag LOCUS_28820 285609 285016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_28820 285773 285609 gene locus_tag LOCUS_28830 285773 285609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 286436 286038 gene locus_tag LOCUS_28840 286436 286038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 287077 286433 gene locus_tag LOCUS_28850 287077 286433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 287443 287078 gene locus_tag LOCUS_28860 287443 287078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 289006 288149 gene locus_tag LOCUS_28870 289006 288149 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016758384.1 protein_id gnl|my_center|LOCUS_28870 295192 289550 gene locus_tag LOCUS_28880 295192 289550 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_28880 296057 295290 gene locus_tag LOCUS_28890 296057 295290 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_28890 297404 296145 gene locus_tag LOCUS_28900 297404 296145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 297598 298791 gene locus_tag LOCUS_28910 gene rocD 297598 298791 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_28910 299515 298796 gene locus_tag LOCUS_28920 299515 298796 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854387.1 protein_id gnl|my_center|LOCUS_28920 300140 299592 gene locus_tag LOCUS_28930 300140 299592 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_28930 302241 300154 gene locus_tag LOCUS_28940 302241 300154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 303804 302641 gene locus_tag LOCUS_28950 303804 302641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707519.1 protein_id gnl|my_center|LOCUS_28950 303931 305388 gene locus_tag LOCUS_28960 gene gabD 303931 305388 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_28960 305997 305473 gene locus_tag LOCUS_28970 305997 305473 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 protein_id gnl|my_center|LOCUS_28970 306245 308476 gene locus_tag LOCUS_28980 gene katG 306245 308476 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167181779.1 protein_id gnl|my_center|LOCUS_28980 308479 308853 gene locus_tag LOCUS_28990 308479 308853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 310269 308860 gene locus_tag LOCUS_29000 310269 308860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 311059 310370 gene locus_tag LOCUS_29010 311059 310370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 311294 312583 gene locus_tag LOCUS_29020 311294 312583 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_29020 313304 312606 gene locus_tag LOCUS_29030 313304 312606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979308.1 protein_id gnl|my_center|LOCUS_29030 313371 314642 gene locus_tag LOCUS_29040 313371 314642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281374.1 protein_id gnl|my_center|LOCUS_29040 314642 315106 gene locus_tag LOCUS_29050 314642 315106 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167022.1 protein_id gnl|my_center|LOCUS_29050 316288 315299 gene locus_tag LOCUS_29060 316288 315299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 317139 316315 gene locus_tag LOCUS_29070 317139 316315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 319025 317142 gene locus_tag LOCUS_29080 319025 317142 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_29080 319179 320690 gene locus_tag LOCUS_29090 319179 320690 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_29090 321742 320915 gene locus_tag LOCUS_29100 321742 320915 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_29100 322461 321868 gene locus_tag LOCUS_29110 322461 321868 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_29110 323439 322498 gene locus_tag LOCUS_29120 323439 322498 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_29120 324154 323555 gene locus_tag LOCUS_29130 gene rdgB 324154 323555 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828653.1 protein_id gnl|my_center|LOCUS_29130 324523 324170 gene locus_tag LOCUS_29140 324523 324170 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406975.1 protein_id gnl|my_center|LOCUS_29140 324765 324520 gene locus_tag LOCUS_29150 324765 324520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 326344 325295 gene locus_tag LOCUS_29160 326344 325295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678902.1 protein_id gnl|my_center|LOCUS_29160 326410 327045 gene locus_tag LOCUS_29170 326410 327045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 327124 327579 gene locus_tag LOCUS_29180 327124 327579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007332.1 protein_id gnl|my_center|LOCUS_29180 329091 327586 gene locus_tag LOCUS_29190 329091 327586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 330871 329111 gene locus_tag LOCUS_29200 330871 329111 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958086.1 protein_id gnl|my_center|LOCUS_29200 331927 330896 gene locus_tag LOCUS_29210 331927 330896 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581182.1 protein_id gnl|my_center|LOCUS_29210 332548 331970 gene locus_tag LOCUS_29220 332548 331970 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729197.1 protein_id gnl|my_center|LOCUS_29220 333274 332633 gene locus_tag LOCUS_29230 333274 332633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179445.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence48 >Feature sequence49 >Feature sequence50 956 87 gene locus_tag LOCUS_29240 956 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence51 933 331 gene locus_tag LOCUS_29250 933 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence52 >Feature sequence53 >Feature sequence54 >Feature sequence55 >Feature sequence56 3 689 gene locus_tag LOCUS_29260 3 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1630 746 gene locus_tag LOCUS_29270 1630 746 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064131.1 protein_id gnl|my_center|LOCUS_29270 2120 1638 gene locus_tag LOCUS_29280 2120 1638 CDS product DUF2505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875950.1 protein_id gnl|my_center|LOCUS_29280 2902 2120 gene locus_tag LOCUS_29290 2902 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3625 2957 gene locus_tag LOCUS_29300 3625 2957 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_29300 3788 4003 gene locus_tag LOCUS_29310 3788 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 4005 5852 gene locus_tag LOCUS_29320 4005 5852 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013245.1 protein_id gnl|my_center|LOCUS_29320 8970 5860 gene locus_tag LOCUS_29330 8970 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 9078 11213 gene locus_tag LOCUS_29340 gene scpA 9078 11213 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_29340 11194 12300 gene locus_tag LOCUS_29350 gene meaB 11194 12300 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_29350 13366 12356 gene locus_tag LOCUS_29360 13366 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 14865 13447 gene locus_tag LOCUS_29370 14865 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 15486 15127 gene locus_tag LOCUS_29380 15486 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 17505 15649 gene locus_tag LOCUS_29390 17505 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760152.1 protein_id gnl|my_center|LOCUS_29390 17690 18334 gene locus_tag LOCUS_29400 17690 18334 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_29400 18345 18746 gene locus_tag LOCUS_29410 18345 18746 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_29410 18748 19395 gene locus_tag LOCUS_29420 18748 19395 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776116.1 protein_id gnl|my_center|LOCUS_29420 19398 21812 gene locus_tag LOCUS_29430 19398 21812 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221442.1 protein_id gnl|my_center|LOCUS_29430 22227 21814 gene locus_tag LOCUS_29440 22227 21814 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633512.1 protein_id gnl|my_center|LOCUS_29440 22328 22945 gene locus_tag LOCUS_29450 22328 22945 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_29450 24610 23192 gene locus_tag LOCUS_29460 24610 23192 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377734.1 protein_id gnl|my_center|LOCUS_29460 24958 24623 gene locus_tag LOCUS_29470 24958 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 26441 24990 gene locus_tag LOCUS_29480 26441 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 27978 26452 gene locus_tag LOCUS_29490 27978 26452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 28154 29278 gene locus_tag LOCUS_29500 28154 29278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 29248 31437 gene locus_tag LOCUS_29510 29248 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 31487 32320 gene locus_tag LOCUS_29520 31487 32320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 32833 32381 gene locus_tag LOCUS_29530 32833 32381 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689877.1 protein_id gnl|my_center|LOCUS_29530 34588 33365 gene locus_tag LOCUS_29540 34588 33365 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151296.1 protein_id gnl|my_center|LOCUS_29540 34649 35152 gene locus_tag LOCUS_29550 34649 35152 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956231.1 protein_id gnl|my_center|LOCUS_29550 35160 36014 gene locus_tag LOCUS_29560 35160 36014 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659901.1 protein_id gnl|my_center|LOCUS_29560 36017 36544 gene locus_tag LOCUS_29570 36017 36544 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739193.1 protein_id gnl|my_center|LOCUS_29570 39077 36555 gene locus_tag LOCUS_29580 39077 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 40019 39090 gene locus_tag LOCUS_29590 40019 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 40713 45296 gene locus_tag LOCUS_29600 gene gltB 40713 45296 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_29600 45289 46731 gene locus_tag LOCUS_29610 45289 46731 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_29610 46952 47965 gene locus_tag LOCUS_29620 46952 47965 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532389.1 protein_id gnl|my_center|LOCUS_29620 48240 47971 gene locus_tag LOCUS_29630 48240 47971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 48769 48230 gene locus_tag LOCUS_29640 48769 48230 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988152.1 protein_id gnl|my_center|LOCUS_29640 49225 48773 gene locus_tag LOCUS_29650 49225 48773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 49489 50739 gene locus_tag LOCUS_29660 49489 50739 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488428.1 protein_id gnl|my_center|LOCUS_29660 50985 51710 gene locus_tag LOCUS_29670 50985 51710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 51731 52354 gene locus_tag LOCUS_29680 51731 52354 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381501.1 protein_id gnl|my_center|LOCUS_29680 52422 53078 gene locus_tag LOCUS_29690 52422 53078 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603280.1 protein_id gnl|my_center|LOCUS_29690 53498 53070 gene locus_tag LOCUS_29700 53498 53070 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_29700 54982 53495 gene locus_tag LOCUS_29710 54982 53495 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_29710 56248 55040 gene locus_tag LOCUS_29720 56248 55040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 56476 58494 gene locus_tag LOCUS_29730 56476 58494 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 protein_id gnl|my_center|LOCUS_29730 58528 59652 gene locus_tag LOCUS_29740 58528 59652 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_29740 59652 60635 gene locus_tag LOCUS_29750 59652 60635 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877313.1 protein_id gnl|my_center|LOCUS_29750 61050 60628 gene locus_tag LOCUS_29760 61050 60628 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_29760 62691 61051 gene locus_tag LOCUS_29770 62691 61051 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_29770 63624 62701 gene locus_tag LOCUS_29780 63624 62701 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_29780 64271 63621 gene locus_tag LOCUS_29790 64271 63621 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091114.1 protein_id gnl|my_center|LOCUS_29790 65891 64272 gene locus_tag LOCUS_29800 65891 64272 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_29800 66550 66095 gene locus_tag LOCUS_29810 66550 66095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012417.1 protein_id gnl|my_center|LOCUS_29810 66919 66611 gene locus_tag LOCUS_29820 66919 66611 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_29820 67074 67997 gene locus_tag LOCUS_29830 67074 67997 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968824.1 protein_id gnl|my_center|LOCUS_29830 68008 68373 gene locus_tag LOCUS_29840 68008 68373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 68377 68883 gene locus_tag LOCUS_29850 68377 68883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 69367 68834 gene locus_tag LOCUS_29860 69367 68834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 69454 70956 gene locus_tag LOCUS_29870 69454 70956 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742439.1 protein_id gnl|my_center|LOCUS_29870 70966 71217 gene locus_tag LOCUS_29880 70966 71217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 71660 71214 gene locus_tag LOCUS_29890 71660 71214 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093846.1 protein_id gnl|my_center|LOCUS_29890 71771 72838 gene locus_tag LOCUS_29900 71771 72838 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625168.1 protein_id gnl|my_center|LOCUS_29900 73409 72804 gene locus_tag LOCUS_29910 73409 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 74056 73406 gene locus_tag LOCUS_29920 74056 73406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 74772 74071 gene locus_tag LOCUS_29930 74772 74071 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129332.1 protein_id gnl|my_center|LOCUS_29930 75682 74756 gene locus_tag LOCUS_29940 75682 74756 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086265.1 protein_id gnl|my_center|LOCUS_29940 75746 76852 gene locus_tag LOCUS_29950 75746 76852 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983163.1 protein_id gnl|my_center|LOCUS_29950 76854 77564 gene locus_tag LOCUS_29960 76854 77564 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_29960 77571 78071 gene locus_tag LOCUS_29970 77571 78071 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 protein_id gnl|my_center|LOCUS_29970 78083 79339 gene locus_tag LOCUS_29980 78083 79339 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_29980 79540 79355 gene locus_tag LOCUS_29990 79540 79355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 80043 79609 gene locus_tag LOCUS_30000 80043 79609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 80140 80988 gene locus_tag LOCUS_30010 80140 80988 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_30010 81039 81581 gene locus_tag LOCUS_30020 81039 81581 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379289.1 protein_id gnl|my_center|LOCUS_30020 81578 82897 gene locus_tag LOCUS_30030 81578 82897 CDS product LIC20035 family adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819152.1 protein_id gnl|my_center|LOCUS_30030 82888 83868 gene locus_tag LOCUS_30040 82888 83868 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410299.1 protein_id gnl|my_center|LOCUS_30040 83875 84699 gene locus_tag LOCUS_30050 83875 84699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 84696 85550 gene locus_tag LOCUS_30060 84696 85550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 85555 86508 gene locus_tag LOCUS_30070 85555 86508 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011139.1 protein_id gnl|my_center|LOCUS_30070 86505 88187 gene locus_tag LOCUS_30080 86505 88187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 88171 89763 gene locus_tag LOCUS_30090 88171 89763 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079247.1 protein_id gnl|my_center|LOCUS_30090 89776 91611 gene locus_tag LOCUS_30100 gene htpG 89776 91611 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287997.1 protein_id gnl|my_center|LOCUS_30100 91815 94004 gene locus_tag LOCUS_30110 91815 94004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011392.1 protein_id gnl|my_center|LOCUS_30110 94797 93991 gene locus_tag LOCUS_30120 94797 93991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755935.1 protein_id gnl|my_center|LOCUS_30120 94887 96089 gene locus_tag LOCUS_30130 94887 96089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599987.1 protein_id gnl|my_center|LOCUS_30130 96086 96922 gene locus_tag LOCUS_30140 96086 96922 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395995.1 protein_id gnl|my_center|LOCUS_30140 99439 96905 gene locus_tag LOCUS_30150 99439 96905 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083704.1 protein_id gnl|my_center|LOCUS_30150 100377 99463 gene locus_tag LOCUS_30160 100377 99463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002094852.1 protein_id gnl|my_center|LOCUS_30160 101542 100718 gene locus_tag LOCUS_30170 101542 100718 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095800.1 protein_id gnl|my_center|LOCUS_30170 102278 101526 gene locus_tag LOCUS_30180 102278 101526 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637633.1 protein_id gnl|my_center|LOCUS_30180 102504 103811 gene locus_tag LOCUS_30190 102504 103811 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931504.1 protein_id gnl|my_center|LOCUS_30190 103814 104815 gene locus_tag LOCUS_30200 103814 104815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968786.1 protein_id gnl|my_center|LOCUS_30200 105429 105842 gene locus_tag LOCUS_30210 105429 105842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 108546 110084 gene locus_tag LOCUS_30220 108546 110084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057258.1 protein_id gnl|my_center|LOCUS_30220 110122 111174 gene locus_tag LOCUS_30230 gene asd 110122 111174 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092012.1 protein_id gnl|my_center|LOCUS_30230 111186 113156 gene locus_tag LOCUS_30240 111186 113156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892878.1 protein_id gnl|my_center|LOCUS_30240 113163 114596 gene locus_tag LOCUS_30250 gene pyk 113163 114596 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_30250 115372 114665 gene locus_tag LOCUS_30260 115372 114665 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767943.1 protein_id gnl|my_center|LOCUS_30260 115576 117144 gene locus_tag LOCUS_30270 115576 117144 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_30270 117154 117840 gene locus_tag LOCUS_30280 117154 117840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 117947 120511 gene locus_tag LOCUS_30290 117947 120511 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666317.1 protein_id gnl|my_center|LOCUS_30290 120513 121175 gene locus_tag LOCUS_30300 120513 121175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 121761 121405 gene locus_tag LOCUS_30310 121761 121405 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004761.1 protein_id gnl|my_center|LOCUS_30310 122893 121748 gene locus_tag LOCUS_30320 122893 121748 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666150.1 protein_id gnl|my_center|LOCUS_30320 124395 122899 gene locus_tag LOCUS_30330 124395 122899 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898540.1 protein_id gnl|my_center|LOCUS_30330 125688 124402 gene locus_tag LOCUS_30340 125688 124402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632684.1 protein_id gnl|my_center|LOCUS_30340 126318 125725 gene locus_tag LOCUS_30350 126318 125725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 127403 126315 gene locus_tag LOCUS_30360 127403 126315 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122447.1 protein_id gnl|my_center|LOCUS_30360 128604 127387 gene locus_tag LOCUS_30370 128604 127387 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095798.1 protein_id gnl|my_center|LOCUS_30370 128738 129781 gene locus_tag LOCUS_30380 gene queA 128738 129781 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897624.1 protein_id gnl|my_center|LOCUS_30380 129898 131169 gene locus_tag LOCUS_30390 129898 131169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 131159 131650 gene locus_tag LOCUS_30400 131159 131650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 131740 133995 gene locus_tag LOCUS_30410 131740 133995 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_30410 134186 135787 gene locus_tag LOCUS_30420 134186 135787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 135810 137294 gene locus_tag LOCUS_30430 135810 137294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 139276 137177 gene locus_tag LOCUS_30440 139276 137177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 139424 140101 gene locus_tag LOCUS_30450 139424 140101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668264.1 protein_id gnl|my_center|LOCUS_30450 140305 144000 gene locus_tag LOCUS_30460 140305 144000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 144646 145842 gene locus_tag LOCUS_30470 144646 145842 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431263.1 protein_id gnl|my_center|LOCUS_30470 145866 146525 gene locus_tag LOCUS_30480 gene pnuC 145866 146525 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_30480 147141 146809 gene locus_tag LOCUS_30490 147141 146809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 149668 147170 gene locus_tag LOCUS_30500 149668 147170 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221442.1 protein_id gnl|my_center|LOCUS_30500 150093 149665 gene locus_tag LOCUS_30510 150093 149665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 150558 150307 gene locus_tag LOCUS_30520 150558 150307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 150933 150571 gene locus_tag LOCUS_30530 150933 150571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 151221 150937 gene locus_tag LOCUS_30540 151221 150937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 151949 151224 gene locus_tag LOCUS_30550 151949 151224 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849259.1 protein_id gnl|my_center|LOCUS_30550 152014 152427 gene locus_tag LOCUS_30560 152014 152427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 152764 152381 gene locus_tag LOCUS_30570 152764 152381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 152894 153862 gene locus_tag LOCUS_30580 gene epmA 152894 153862 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002142465.1 protein_id gnl|my_center|LOCUS_30580 154972 154331 gene locus_tag LOCUS_30590 154972 154331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 155074 155661 gene locus_tag LOCUS_30600 155074 155661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 155669 156610 gene locus_tag LOCUS_30610 155669 156610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 156774 157049 gene locus_tag LOCUS_30620 156774 157049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 158538 157507 gene locus_tag LOCUS_30630 158538 157507 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_30630 158626 159429 gene locus_tag LOCUS_30640 158626 159429 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069861.1 protein_id gnl|my_center|LOCUS_30640 159518 160273 gene locus_tag LOCUS_30650 159518 160273 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945962.1 protein_id gnl|my_center|LOCUS_30650 160319 161347 gene locus_tag LOCUS_30660 160319 161347 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_30660 162744 161326 gene locus_tag LOCUS_30670 162744 161326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 163103 164053 gene locus_tag LOCUS_30680 gene msrB 163103 164053 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796156.1 protein_id gnl|my_center|LOCUS_30680 164878 164093 gene locus_tag LOCUS_30690 164878 164093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031000.1 protein_id gnl|my_center|LOCUS_30690 165091 164885 gene locus_tag LOCUS_30700 165091 164885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266284.1 protein_id gnl|my_center|LOCUS_30700 166392 165814 gene locus_tag LOCUS_30710 166392 165814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 167440 166376 gene locus_tag LOCUS_30720 167440 166376 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103009.1 protein_id gnl|my_center|LOCUS_30720 167507 168073 gene locus_tag LOCUS_30730 gene efp 167507 168073 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172195.1 protein_id gnl|my_center|LOCUS_30730 168142 168702 gene locus_tag LOCUS_30740 gene mtnB 168142 168702 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_30740 168699 169427 gene locus_tag LOCUS_30750 168699 169427 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093664.1 protein_id gnl|my_center|LOCUS_30750 169430 170167 gene locus_tag LOCUS_30760 169430 170167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968389.1 protein_id gnl|my_center|LOCUS_30760 170171 172006 gene locus_tag LOCUS_30770 170171 172006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 172969 172013 gene locus_tag LOCUS_30780 gene corA 172969 172013 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_30780 174748 172973 gene locus_tag LOCUS_30790 174748 172973 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277370.1 protein_id gnl|my_center|LOCUS_30790 175280 174888 gene locus_tag LOCUS_30800 175280 174888 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581246.1 protein_id gnl|my_center|LOCUS_30800 175299 175577 gene locus_tag LOCUS_30810 175299 175577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 175837 175613 gene locus_tag LOCUS_30820 175837 175613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 175943 176869 gene locus_tag LOCUS_30830 175943 176869 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_30830 176954 178081 gene locus_tag LOCUS_30840 176954 178081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 178265 178131 gene locus_tag LOCUS_30850 178265 178131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 178257 180725 gene locus_tag LOCUS_30860 178257 180725 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999373.1 protein_id gnl|my_center|LOCUS_30860 180828 183377 gene locus_tag LOCUS_30870 180828 183377 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999373.1 protein_id gnl|my_center|LOCUS_30870 183435 183956 gene locus_tag LOCUS_30880 183435 183956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 184023 185030 gene locus_tag LOCUS_30890 184023 185030 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_30890 185014 186333 gene locus_tag LOCUS_30900 gene ahcY 185014 186333 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117570.1 protein_id gnl|my_center|LOCUS_30900 186398 186697 gene locus_tag LOCUS_30910 186398 186697 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332230.1 protein_id gnl|my_center|LOCUS_30910 186760 190485 gene locus_tag LOCUS_30920 gene metH 186760 190485 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_30920 190494 190781 gene locus_tag LOCUS_30930 190494 190781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 191611 190778 gene locus_tag LOCUS_30940 191611 190778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 191695 193002 gene locus_tag LOCUS_30950 191695 193002 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_30950 193599 193003 gene locus_tag LOCUS_30960 193599 193003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 195357 193612 gene locus_tag LOCUS_30970 195357 193612 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004124.1 protein_id gnl|my_center|LOCUS_30970 196243 195371 gene locus_tag LOCUS_30980 gene argB 196243 195371 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982628.1 protein_id gnl|my_center|LOCUS_30980 196300 197118 gene locus_tag LOCUS_30990 196300 197118 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_30990 198004 197096 gene locus_tag LOCUS_31000 gene yieE 198004 197096 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548286.1 protein_id gnl|my_center|LOCUS_31000 198076 199089 gene locus_tag LOCUS_31010 198076 199089 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182057.1 protein_id gnl|my_center|LOCUS_31010 200023 199130 gene locus_tag LOCUS_31020 200023 199130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 201162 200032 gene locus_tag LOCUS_31030 gene alr 201162 200032 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_31030 201221 202417 gene locus_tag LOCUS_31040 201221 202417 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190668.1 protein_id gnl|my_center|LOCUS_31040 202414 203334 gene locus_tag LOCUS_31050 202414 203334 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448524.1 protein_id gnl|my_center|LOCUS_31050 203565 204032 gene locus_tag LOCUS_31060 203565 204032 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125527.1 protein_id gnl|my_center|LOCUS_31060 204250 206199 gene locus_tag LOCUS_31070 204250 206199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 206348 207694 gene locus_tag LOCUS_31080 206348 207694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 209303 207867 gene locus_tag LOCUS_31090 209303 207867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 209257 209463 gene locus_tag LOCUS_31100 209257 209463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 209784 209975 gene locus_tag LOCUS_31110 209784 209975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 210640 209936 gene locus_tag LOCUS_31120 210640 209936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 211746 210637 gene locus_tag LOCUS_31130 211746 210637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 212877 212134 gene locus_tag LOCUS_31140 212877 212134 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012765.1 protein_id gnl|my_center|LOCUS_31140 212876 213331 gene locus_tag LOCUS_31150 212876 213331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 213336 213740 gene locus_tag LOCUS_31160 213336 213740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 215740 213746 gene locus_tag LOCUS_31170 215740 213746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 216864 215737 gene locus_tag LOCUS_31180 216864 215737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 216947 218035 gene locus_tag LOCUS_31190 gene dinB 216947 218035 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450036.1 protein_id gnl|my_center|LOCUS_31190 218040 218744 gene locus_tag LOCUS_31200 218040 218744 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_31200 218895 219656 gene locus_tag LOCUS_31210 218895 219656 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_31210 220076 219663 gene locus_tag LOCUS_31220 220076 219663 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 protein_id gnl|my_center|LOCUS_31220 220800 220165 gene locus_tag LOCUS_31230 220800 220165 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_31230 221159 220953 gene locus_tag LOCUS_31240 221159 220953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 221379 222782 gene locus_tag LOCUS_31250 gene sthA 221379 222782 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900556.1 protein_id gnl|my_center|LOCUS_31250 222905 223402 gene locus_tag LOCUS_31260 222905 223402 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971886.1 protein_id gnl|my_center|LOCUS_31260 223406 224479 gene locus_tag LOCUS_31270 223406 224479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 224563 225123 gene locus_tag LOCUS_31280 224563 225123 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240474.1 protein_id gnl|my_center|LOCUS_31280 225239 226081 gene locus_tag LOCUS_31290 225239 226081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 226272 226772 gene locus_tag LOCUS_31300 226272 226772 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969827.1 protein_id gnl|my_center|LOCUS_31300 227739 226813 gene locus_tag LOCUS_31310 227739 226813 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_31310 228061 227744 gene locus_tag LOCUS_31320 228061 227744 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_31320 228282 228058 gene locus_tag LOCUS_31330 228282 228058 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_31330 228479 230971 gene locus_tag LOCUS_31340 gene hrpB 228479 230971 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105140.1 protein_id gnl|my_center|LOCUS_31340 231525 230968 gene locus_tag LOCUS_31350 231525 230968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 231659 233488 gene locus_tag LOCUS_31360 231659 233488 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457972.1 protein_id gnl|my_center|LOCUS_31360 233485 233961 gene locus_tag LOCUS_31370 233485 233961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360826.1 protein_id gnl|my_center|LOCUS_31370 233958 235568 gene locus_tag LOCUS_31380 233958 235568 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075232.1 protein_id gnl|my_center|LOCUS_31380 235663 236553 gene locus_tag LOCUS_31390 gene htpX 235663 236553 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_31390 236650 237183 gene locus_tag LOCUS_31400 236650 237183 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029425.1 protein_id gnl|my_center|LOCUS_31400 238440 237187 gene locus_tag LOCUS_31410 238440 237187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 238421 239815 gene locus_tag LOCUS_31420 238421 239815 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_31420 239812 241299 gene locus_tag LOCUS_31430 239812 241299 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_31430 242517 241291 gene locus_tag LOCUS_31440 242517 241291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599987.1 protein_id gnl|my_center|LOCUS_31440 244060 242522 gene locus_tag LOCUS_31450 244060 242522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083737.1 protein_id gnl|my_center|LOCUS_31450 244770 244057 gene locus_tag LOCUS_31460 244770 244057 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965878.1 protein_id gnl|my_center|LOCUS_31460 245816 244779 gene locus_tag LOCUS_31470 245816 244779 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039095124.1 protein_id gnl|my_center|LOCUS_31470 247279 245813 gene locus_tag LOCUS_31480 247279 245813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 247967 247314 gene locus_tag LOCUS_31490 247967 247314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 248118 249566 gene locus_tag LOCUS_31500 248118 249566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 250542 249490 gene locus_tag LOCUS_31510 250542 249490 CDS product DUF1574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837638.1 protein_id gnl|my_center|LOCUS_31510 251003 250641 gene locus_tag LOCUS_31520 251003 250641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422624.1 protein_id gnl|my_center|LOCUS_31520 251524 251060 gene locus_tag LOCUS_31530 251524 251060 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450144.1 protein_id gnl|my_center|LOCUS_31530 251625 252272 gene locus_tag LOCUS_31540 251625 252272 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532132.1 protein_id gnl|my_center|LOCUS_31540 252262 252771 gene locus_tag LOCUS_31550 252262 252771 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531618.1 protein_id gnl|my_center|LOCUS_31550 254106 252793 gene locus_tag LOCUS_31560 254106 252793 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_31560 254881 254069 gene locus_tag LOCUS_31570 254881 254069 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920453.1 protein_id gnl|my_center|LOCUS_31570 256146 254878 gene locus_tag LOCUS_31580 256146 254878 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_31580 257043 256216 gene locus_tag LOCUS_31590 gene pyrF 257043 256216 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080039.1 protein_id gnl|my_center|LOCUS_31590 257901 257044 gene locus_tag LOCUS_31600 257901 257044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122639.1 protein_id gnl|my_center|LOCUS_31600 258578 257898 gene locus_tag LOCUS_31610 258578 257898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 259830 258568 gene locus_tag LOCUS_31620 259830 258568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 260682 259837 gene locus_tag LOCUS_31630 gene speE 260682 259837 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424716.1 protein_id gnl|my_center|LOCUS_31630 260841 261950 gene locus_tag LOCUS_31640 260841 261950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 262072 263304 gene locus_tag LOCUS_31650 262072 263304 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_31650 264216 263296 gene locus_tag LOCUS_31660 264216 263296 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_31660 264509 264228 gene locus_tag LOCUS_31670 264509 264228 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_31670 265495 264635 gene locus_tag LOCUS_31680 265495 264635 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054152.1 protein_id gnl|my_center|LOCUS_31680 265799 265485 gene locus_tag LOCUS_31690 265799 265485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 266188 265799 gene locus_tag LOCUS_31700 gene speD 266188 265799 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992621.1 protein_id gnl|my_center|LOCUS_31700 266403 266795 gene locus_tag LOCUS_31710 266403 266795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence57 >Feature sequence58 >Feature sequence59 >Feature sequence60 >Feature sequence61 >Feature sequence62 >Feature sequence63 >Feature sequence64 >Feature sequence65 1373 435 gene locus_tag LOCUS_31720 1373 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3032 1506 gene locus_tag LOCUS_31730 3032 1506 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_31730 3800 4564 gene locus_tag LOCUS_31740 3800 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4804 5010 gene locus_tag LOCUS_31750 4804 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 5583 5131 gene locus_tag LOCUS_31760 5583 5131 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177028.1 protein_id gnl|my_center|LOCUS_31760 5641 5835 gene locus_tag LOCUS_31770 5641 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 5861 6334 gene locus_tag LOCUS_31780 gene ribE 5861 6334 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613915.1 protein_id gnl|my_center|LOCUS_31780 6331 6753 gene locus_tag LOCUS_31790 gene nusB 6331 6753 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_31790 6769 8889 gene locus_tag LOCUS_31800 6769 8889 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356645.1 protein_id gnl|my_center|LOCUS_31800 8886 9686 gene locus_tag LOCUS_31810 8886 9686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283287.1 protein_id gnl|my_center|LOCUS_31810 9690 11264 gene locus_tag LOCUS_31820 9690 11264 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667199.1 protein_id gnl|my_center|LOCUS_31820 11228 12352 gene locus_tag LOCUS_31830 11228 12352 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107542.1 protein_id gnl|my_center|LOCUS_31830 12333 13157 gene locus_tag LOCUS_31840 12333 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 15187 13154 gene locus_tag LOCUS_31850 gene ispG 15187 13154 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011576.1 protein_id gnl|my_center|LOCUS_31850 15325 15609 gene locus_tag LOCUS_31860 15325 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 15606 16673 gene locus_tag LOCUS_31870 gene mutY 15606 16673 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773586.1 protein_id gnl|my_center|LOCUS_31870 17234 16710 gene locus_tag LOCUS_31880 17234 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 17465 18238 gene locus_tag LOCUS_31890 17465 18238 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_31890 18305 19675 gene locus_tag LOCUS_31900 18305 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 19968 20852 gene locus_tag LOCUS_31910 19968 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 20957 22261 gene locus_tag LOCUS_31920 20957 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 22272 24785 gene locus_tag LOCUS_31930 22272 24785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 25397 25672 gene locus_tag LOCUS_31940 25397 25672 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730539.1 protein_id gnl|my_center|LOCUS_31940 25669 27198 gene locus_tag LOCUS_31950 25669 27198 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_31950 27206 27772 gene locus_tag LOCUS_31960 gene pth 27206 27772 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284985.1 protein_id gnl|my_center|LOCUS_31960 27769 28377 gene locus_tag LOCUS_31970 27769 28377 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_31970 28624 29886 gene locus_tag LOCUS_31980 28624 29886 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281336.1 protein_id gnl|my_center|LOCUS_31980 32377 29948 gene locus_tag LOCUS_31990 32377 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 33981 32374 gene locus_tag LOCUS_32000 33981 32374 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817768.1 protein_id gnl|my_center|LOCUS_32000 35123 33996 gene locus_tag LOCUS_32010 35123 33996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 36610 35156 gene locus_tag LOCUS_32020 36610 35156 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065150.1 protein_id gnl|my_center|LOCUS_32020 37782 36643 gene locus_tag LOCUS_32030 gene prpC 37782 36643 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_32030 38684 37779 gene locus_tag LOCUS_32040 gene prpB 38684 37779 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_32040 41039 38715 gene locus_tag LOCUS_32050 gene metE 41039 38715 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084864.1 protein_id gnl|my_center|LOCUS_32050 41493 41053 gene locus_tag LOCUS_32060 41493 41053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 44808 42415 gene locus_tag LOCUS_32070 44808 42415 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_32070 45423 45118 gene locus_tag LOCUS_32080 45423 45118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 45659 45414 gene locus_tag LOCUS_32090 45659 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 45981 46358 gene locus_tag LOCUS_32100 45981 46358 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057833.1 protein_id gnl|my_center|LOCUS_32100 46349 46909 gene locus_tag LOCUS_32110 46349 46909 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_32110 46906 47427 gene locus_tag LOCUS_32120 46906 47427 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660869.1 protein_id gnl|my_center|LOCUS_32120 47439 48659 gene locus_tag LOCUS_32130 47439 48659 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990075.1 protein_id gnl|my_center|LOCUS_32130 48659 49147 gene locus_tag LOCUS_32140 gene nuoE 48659 49147 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_32140 49149 50444 gene locus_tag LOCUS_32150 gene nuoF 49149 50444 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_32150 50463 51533 gene locus_tag LOCUS_32160 gene nuoH 50463 51533 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_32160 51530 52141 gene locus_tag LOCUS_32170 51530 52141 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116835.1 protein_id gnl|my_center|LOCUS_32170 52138 52458 gene locus_tag LOCUS_32180 gene nuoK 52138 52458 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015281.1 protein_id gnl|my_center|LOCUS_32180 52463 54394 gene locus_tag LOCUS_32190 gene nuoL 52463 54394 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406351.1 protein_id gnl|my_center|LOCUS_32190 54401 56134 gene locus_tag LOCUS_32200 54401 56134 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_32200 56136 57578 gene locus_tag LOCUS_32210 56136 57578 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047886.1 protein_id gnl|my_center|LOCUS_32210 57696 58229 gene locus_tag LOCUS_32220 57696 58229 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_32220 60433 58469 gene locus_tag LOCUS_32230 gene recJ 60433 58469 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615880.1 protein_id gnl|my_center|LOCUS_32230 60741 60421 gene locus_tag LOCUS_32240 60741 60421 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278842.1 protein_id gnl|my_center|LOCUS_32240 60889 61215 gene locus_tag LOCUS_32250 60889 61215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 61294 64545 gene locus_tag LOCUS_32260 61294 64545 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565846.1 protein_id gnl|my_center|LOCUS_32260 64542 65168 gene locus_tag LOCUS_32270 64542 65168 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_32270 65273 66490 gene locus_tag LOCUS_32280 65273 66490 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254988.1 protein_id gnl|my_center|LOCUS_32280 66498 67679 gene locus_tag LOCUS_32290 66498 67679 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614666.1 protein_id gnl|my_center|LOCUS_32290 68070 67726 gene locus_tag LOCUS_32300 68070 67726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 68575 68174 gene locus_tag LOCUS_32310 68575 68174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 70090 68969 gene locus_tag LOCUS_32320 70090 68969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 70265 70873 gene locus_tag LOCUS_32330 gene lexA 70265 70873 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_32330 70911 71213 gene locus_tag LOCUS_32340 70911 71213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283525.1 protein_id gnl|my_center|LOCUS_32340 71210 72586 gene locus_tag LOCUS_32350 71210 72586 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790723.1 protein_id gnl|my_center|LOCUS_32350 72591 73637 gene locus_tag LOCUS_32360 gene tsaD 72591 73637 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579852.1 protein_id gnl|my_center|LOCUS_32360 73634 74389 gene locus_tag LOCUS_32370 gene pssA 73634 74389 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769017.1 protein_id gnl|my_center|LOCUS_32370 74472 75428 gene locus_tag LOCUS_32380 74472 75428 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_32380 75430 76923 gene locus_tag LOCUS_32390 gene glpK 75430 76923 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286755.1 protein_id gnl|my_center|LOCUS_32390 78371 77010 gene locus_tag LOCUS_32400 78371 77010 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773754.1 protein_id gnl|my_center|LOCUS_32400 80807 79440 gene locus_tag LOCUS_32410 80807 79440 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773754.1 protein_id gnl|my_center|LOCUS_32410 82220 81336 gene locus_tag LOCUS_32420 82220 81336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 82723 82481 gene locus_tag LOCUS_32430 82723 82481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 83903 82737 gene locus_tag LOCUS_32440 83903 82737 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122024.1 protein_id gnl|my_center|LOCUS_32440 84313 83987 gene locus_tag LOCUS_32450 84313 83987 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150993.1 protein_id gnl|my_center|LOCUS_32450 85044 84334 gene locus_tag LOCUS_32460 gene rsmI 85044 84334 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083567.1 protein_id gnl|my_center|LOCUS_32460 85702 85046 gene locus_tag LOCUS_32470 85702 85046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273875.1 protein_id gnl|my_center|LOCUS_32470 85851 86543 gene locus_tag LOCUS_32480 85851 86543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623631.1 protein_id gnl|my_center|LOCUS_32480 88499 86547 gene locus_tag LOCUS_32490 gene nadE 88499 86547 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_32490 89694 88486 gene locus_tag LOCUS_32500 89694 88486 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576871.1 protein_id gnl|my_center|LOCUS_32500 90534 89779 gene locus_tag LOCUS_32510 90534 89779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 90614 91381 gene locus_tag LOCUS_32520 90614 91381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 91385 92086 gene locus_tag LOCUS_32530 91385 92086 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538451.1 protein_id gnl|my_center|LOCUS_32530 92064 92858 gene locus_tag LOCUS_32540 gene proC 92064 92858 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080974.1 protein_id gnl|my_center|LOCUS_32540 92944 92870 gene locus_tag LOCUS_t00250 92944 92870 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 93115 94176 gene locus_tag LOCUS_32550 93115 94176 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623742.1 protein_id gnl|my_center|LOCUS_32550 94199 94426 gene locus_tag LOCUS_32560 94199 94426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 94555 95307 gene locus_tag LOCUS_32570 94555 95307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 95310 96446 gene locus_tag LOCUS_32580 gene mnmA 95310 96446 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033460.1 protein_id gnl|my_center|LOCUS_32580 96463 98715 gene locus_tag LOCUS_32590 96463 98715 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058907.1 protein_id gnl|my_center|LOCUS_32590 98719 99936 gene locus_tag LOCUS_32600 98719 99936 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357126.1 protein_id gnl|my_center|LOCUS_32600 99936 100913 gene locus_tag LOCUS_32610 99936 100913 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566815.1 protein_id gnl|my_center|LOCUS_32610 100989 102146 gene locus_tag LOCUS_32620 100989 102146 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_32620 102213 102641 gene locus_tag LOCUS_32630 102213 102641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 103107 102652 gene locus_tag LOCUS_32640 103107 102652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 103763 103104 gene locus_tag LOCUS_32650 103763 103104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087418.1 protein_id gnl|my_center|LOCUS_32650 103936 105342 gene locus_tag LOCUS_32660 103936 105342 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333576.1 protein_id gnl|my_center|LOCUS_32660 105339 106757 gene locus_tag LOCUS_32670 105339 106757 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649937.1 protein_id gnl|my_center|LOCUS_32670 106757 107602 gene locus_tag LOCUS_32680 106757 107602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_32680 107644 108252 gene locus_tag LOCUS_32690 107644 108252 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033675.1 protein_id gnl|my_center|LOCUS_32690 108297 109055 gene locus_tag LOCUS_32700 108297 109055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096242.1 protein_id gnl|my_center|LOCUS_32700 109105 110421 gene locus_tag LOCUS_32710 109105 110421 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918539.1 protein_id gnl|my_center|LOCUS_32710 110418 111185 gene locus_tag LOCUS_32720 110418 111185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427172.1 protein_id gnl|my_center|LOCUS_32720 111282 111196 gene locus_tag LOCUS_t00260 111282 111196 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 111747 111292 gene locus_tag LOCUS_32730 111747 111292 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648186.1 protein_id gnl|my_center|LOCUS_32730 111946 114597 gene locus_tag LOCUS_32740 111946 114597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209452.1 protein_id gnl|my_center|LOCUS_32740 114768 116288 gene locus_tag LOCUS_32750 114768 116288 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_32750 116233 119661 gene locus_tag LOCUS_32760 116233 119661 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028770.1 protein_id gnl|my_center|LOCUS_32760 119658 122687 gene locus_tag LOCUS_32770 119658 122687 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103182.1 protein_id gnl|my_center|LOCUS_32770 122684 124510 gene locus_tag LOCUS_32780 gene recD 122684 124510 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503851.1 protein_id gnl|my_center|LOCUS_32780 124521 124691 gene locus_tag LOCUS_32790 124521 124691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 124857 125114 gene locus_tag LOCUS_32800 124857 125114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 125358 125951 gene locus_tag LOCUS_32810 125358 125951 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136732.1 protein_id gnl|my_center|LOCUS_32810 126033 127454 gene locus_tag LOCUS_32820 gene sufB 126033 127454 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438391.1 protein_id gnl|my_center|LOCUS_32820 127479 128537 gene locus_tag LOCUS_32830 gene rlmN 127479 128537 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622604.1 protein_id gnl|my_center|LOCUS_32830 128639 130669 gene locus_tag LOCUS_32840 128639 130669 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487747.1 protein_id gnl|my_center|LOCUS_32840 132522 130642 gene locus_tag LOCUS_32850 132522 130642 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231009.1 protein_id gnl|my_center|LOCUS_32850 132648 132932 gene locus_tag LOCUS_32860 132648 132932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 132935 134632 gene locus_tag LOCUS_32870 132935 134632 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071946.1 protein_id gnl|my_center|LOCUS_32870 134906 136906 gene locus_tag LOCUS_32880 134906 136906 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999373.1 protein_id gnl|my_center|LOCUS_32880 137157 137675 gene locus_tag LOCUS_32890 137157 137675 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_32890 137700 140843 gene locus_tag LOCUS_32900 137700 140843 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_32900 140859 142232 gene locus_tag LOCUS_32910 gene nrfD 140859 142232 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_32910 142234 142797 gene locus_tag LOCUS_32920 142234 142797 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277765.1 protein_id gnl|my_center|LOCUS_32920 142798 143394 gene locus_tag LOCUS_32930 142798 143394 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_32930 143403 144653 gene locus_tag LOCUS_32940 143403 144653 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_32940 144658 145179 gene locus_tag LOCUS_32950 144658 145179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827841.1 protein_id gnl|my_center|LOCUS_32950 148311 145234 gene locus_tag LOCUS_32960 148311 145234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 148384 149037 gene locus_tag LOCUS_32970 148384 149037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 149359 149658 gene locus_tag LOCUS_32980 149359 149658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 151480 149636 gene locus_tag LOCUS_32990 151480 149636 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654981.1 protein_id gnl|my_center|LOCUS_32990 152324 151473 gene locus_tag LOCUS_33000 152324 151473 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010757.1 protein_id gnl|my_center|LOCUS_33000 152408 152566 gene locus_tag LOCUS_33010 152408 152566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 153399 152563 gene locus_tag LOCUS_33020 153399 152563 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848056.1 protein_id gnl|my_center|LOCUS_33020 154322 153396 gene locus_tag LOCUS_33030 154322 153396 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567061.1 protein_id gnl|my_center|LOCUS_33030 154469 154987 gene locus_tag LOCUS_33040 154469 154987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 155356 157674 gene locus_tag LOCUS_33050 155356 157674 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002071771.1 protein_id gnl|my_center|LOCUS_33050 158621 157689 gene locus_tag LOCUS_33060 158621 157689 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625244.1 protein_id gnl|my_center|LOCUS_33060 158746 160257 gene locus_tag LOCUS_33070 gene pcnB 158746 160257 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670773.1 protein_id gnl|my_center|LOCUS_33070 161290 160379 gene locus_tag LOCUS_33080 gene thiL 161290 160379 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662272.1 protein_id gnl|my_center|LOCUS_33080 161368 161820 gene locus_tag LOCUS_33090 gene rplM 161368 161820 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115097.1 protein_id gnl|my_center|LOCUS_33090 161824 162219 gene locus_tag LOCUS_33100 gene rpsI 161824 162219 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001966744.1 protein_id gnl|my_center|LOCUS_33100 162320 163489 gene locus_tag LOCUS_33110 162320 163489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958523.1 protein_id gnl|my_center|LOCUS_33110 163540 166302 gene locus_tag LOCUS_33120 gene alaS 163540 166302 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802924.1 protein_id gnl|my_center|LOCUS_33120 166306 166803 gene locus_tag LOCUS_33130 166306 166803 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283275.1 protein_id gnl|my_center|LOCUS_33130 167542 166853 gene locus_tag LOCUS_33140 167542 166853 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_33140 167442 170486 gene locus_tag LOCUS_33150 167442 170486 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444199.1 protein_id gnl|my_center|LOCUS_33150 170509 171240 gene locus_tag LOCUS_33160 170509 171240 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196651.1 protein_id gnl|my_center|LOCUS_33160 171264 172361 gene locus_tag LOCUS_33170 171264 172361 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072287.1 protein_id gnl|my_center|LOCUS_33170 172363 173709 gene locus_tag LOCUS_33180 gene rimO 172363 173709 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358323.1 protein_id gnl|my_center|LOCUS_33180 173709 174455 gene locus_tag LOCUS_33190 gene pgsA 173709 174455 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045091.1 protein_id gnl|my_center|LOCUS_33190 174436 175482 gene locus_tag LOCUS_33200 gene trpD 174436 175482 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433682.1 protein_id gnl|my_center|LOCUS_33200 175489 175818 gene locus_tag LOCUS_33210 gene yajC 175489 175818 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141830.1 protein_id gnl|my_center|LOCUS_33210 175822 176472 gene locus_tag LOCUS_33220 175822 176472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 176495 178429 gene locus_tag LOCUS_33230 gene secD 176495 178429 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833715.1 protein_id gnl|my_center|LOCUS_33230 178422 179363 gene locus_tag LOCUS_33240 gene secF 178422 179363 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459252.1 protein_id gnl|my_center|LOCUS_33240 179370 180677 gene locus_tag LOCUS_33250 179370 180677 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202680.1 protein_id gnl|my_center|LOCUS_33250 180956 181567 gene locus_tag LOCUS_33260 180956 181567 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494006.1 protein_id gnl|my_center|LOCUS_33260 181927 181550 gene locus_tag LOCUS_33270 181927 181550 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406135.1 protein_id gnl|my_center|LOCUS_33270 182047 183255 gene locus_tag LOCUS_33280 182047 183255 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615785.1 protein_id gnl|my_center|LOCUS_33280 183906 183259 gene locus_tag LOCUS_33290 gene pdxH 183906 183259 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371278.1 protein_id gnl|my_center|LOCUS_33290 184723 183893 gene locus_tag LOCUS_33300 184723 183893 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909038.1 protein_id gnl|my_center|LOCUS_33300 185820 184732 gene locus_tag LOCUS_33310 185820 184732 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895444.1 protein_id gnl|my_center|LOCUS_33310 185923 188940 gene locus_tag LOCUS_33320 185923 188940 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450798.1 protein_id gnl|my_center|LOCUS_33320 188947 189435 gene locus_tag LOCUS_33330 gene smpB 188947 189435 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239365.1 protein_id gnl|my_center|LOCUS_33330 189432 190796 gene locus_tag LOCUS_33340 gene der 189432 190796 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029807.1 protein_id gnl|my_center|LOCUS_33340 190793 191416 gene locus_tag LOCUS_33350 gene plsY 190793 191416 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010596.1 protein_id gnl|my_center|LOCUS_33350 191406 192035 gene locus_tag LOCUS_33360 191406 192035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 193858 191999 gene locus_tag LOCUS_33370 193858 191999 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019143.1 protein_id gnl|my_center|LOCUS_33370 193933 196710 gene locus_tag LOCUS_33380 193933 196710 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281021.1 protein_id gnl|my_center|LOCUS_33380 197038 196751 gene locus_tag LOCUS_33390 197038 196751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 197137 197061 gene locus_tag LOCUS_t00270 197137 197061 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 198795 197335 gene locus_tag LOCUS_33400 gene glnA 198795 197335 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091770.1 protein_id gnl|my_center|LOCUS_33400 199269 201014 gene locus_tag LOCUS_33410 199269 201014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 201788 201030 gene locus_tag LOCUS_33420 201788 201030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258977.1 protein_id gnl|my_center|LOCUS_33420 202539 201856 gene locus_tag LOCUS_33430 202539 201856 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201863.1 protein_id gnl|my_center|LOCUS_33430 203429 202536 gene locus_tag LOCUS_33440 203429 202536 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499591.1 protein_id gnl|my_center|LOCUS_33440 203526 204950 gene locus_tag LOCUS_33450 203526 204950 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_33450 204951 205868 gene locus_tag LOCUS_33460 204951 205868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 205941 207005 gene locus_tag LOCUS_33470 205941 207005 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141027.1 protein_id gnl|my_center|LOCUS_33470 207124 208749 gene locus_tag LOCUS_33480 207124 208749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 209028 209570 gene locus_tag LOCUS_33490 209028 209570 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945785.1 protein_id gnl|my_center|LOCUS_33490 210359 209577 gene locus_tag LOCUS_33500 210359 209577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 210489 211511 gene locus_tag LOCUS_33510 210489 211511 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_33510 211532 213301 gene locus_tag LOCUS_33520 211532 213301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 213285 214097 gene locus_tag LOCUS_33530 gene bla2 213285 214097 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124981.1 protein_id gnl|my_center|LOCUS_33530 215245 214115 gene locus_tag LOCUS_33540 215245 214115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123180310.1 protein_id gnl|my_center|LOCUS_33540 216366 215242 gene locus_tag LOCUS_33550 216366 215242 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576385.1 protein_id gnl|my_center|LOCUS_33550 216790 216386 gene locus_tag LOCUS_33560 216790 216386 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_33560 219403 216851 gene locus_tag LOCUS_33570 219403 216851 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_33570 220505 219435 gene locus_tag LOCUS_33580 220505 219435 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907503.1 protein_id gnl|my_center|LOCUS_33580 220563 221828 gene locus_tag LOCUS_33590 220563 221828 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_33590 221832 222524 gene locus_tag LOCUS_33600 221832 222524 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838282.1 protein_id gnl|my_center|LOCUS_33600 223615 222521 gene locus_tag LOCUS_33610 223615 222521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 224245 223715 gene locus_tag LOCUS_33620 224245 223715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 224679 224242 gene locus_tag LOCUS_33630 224679 224242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 225118 225201 gene locus_tag LOCUS_t00280 225118 225201 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence66 >Feature sequence67 >Feature sequence68 >Feature sequence69 >Feature sequence70 183 560 gene locus_tag LOCUS_33640 183 560 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681202.1 protein_id gnl|my_center|LOCUS_33640 526 843 gene locus_tag LOCUS_33650 526 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002689021.1 protein_id gnl|my_center|LOCUS_33650 1162 1386 gene locus_tag LOCUS_33660 1162 1386 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_33660 1376 1738 gene locus_tag LOCUS_33670 1376 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1800 1958 gene locus_tag LOCUS_33680 1800 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2764 2997 gene locus_tag LOCUS_33690 2764 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3235 4671 gene locus_tag LOCUS_33700 3235 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 5719 4865 gene locus_tag LOCUS_33710 5719 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 5930 7072 gene locus_tag LOCUS_33720 5930 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942013.1 protein_id gnl|my_center|LOCUS_33720 7237 7497 gene locus_tag LOCUS_33730 7237 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 7902 8336 gene locus_tag LOCUS_33740 7902 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33740 8529 10001 gene locus_tag LOCUS_33750 8529 10001 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994769.1 protein_id gnl|my_center|LOCUS_33750 10277 10558 gene locus_tag LOCUS_33760 10277 10558 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_33760 10571 10873 gene locus_tag LOCUS_33770 10571 10873 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679295.1 protein_id gnl|my_center|LOCUS_33770 11236 11976 gene locus_tag LOCUS_33780 11236 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 12541 12942 gene locus_tag LOCUS_33790 12541 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 13238 13822 gene locus_tag LOCUS_33800 13238 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 13803 14261 gene locus_tag LOCUS_33810 13803 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 14566 14853 gene locus_tag LOCUS_33820 14566 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 14828 15082 gene locus_tag LOCUS_33830 14828 15082 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681198.1 protein_id gnl|my_center|LOCUS_33830 15821 16081 gene locus_tag LOCUS_33840 15821 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 16078 16431 gene locus_tag LOCUS_33850 16078 16431 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_33850 16610 17047 gene locus_tag LOCUS_33860 16610 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 17040 17300 gene locus_tag LOCUS_33870 17040 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 17487 18905 gene locus_tag LOCUS_33880 17487 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 19163 19444 gene locus_tag LOCUS_33890 19163 19444 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_33890 19457 19762 gene locus_tag LOCUS_33900 19457 19762 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_33900 20346 20690 gene locus_tag LOCUS_33910 20346 20690 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_33910 20677 21150 gene locus_tag LOCUS_33920 20677 21150 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528593.1 protein_id gnl|my_center|LOCUS_33920 21197 21613 gene locus_tag LOCUS_33930 21197 21613 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067708.1 protein_id gnl|my_center|LOCUS_33930 21618 21851 gene locus_tag LOCUS_33940 21618 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 21998 22366 gene locus_tag LOCUS_33950 21998 22366 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816008.1 protein_id gnl|my_center|LOCUS_33950 22410 23021 gene locus_tag LOCUS_33960 22410 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 23726 23232 gene locus_tag LOCUS_33970 23726 23232 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620896.1 protein_id gnl|my_center|LOCUS_33970 24042 23719 gene locus_tag LOCUS_33980 24042 23719 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965471.1 protein_id gnl|my_center|LOCUS_33980 25342 24629 gene locus_tag LOCUS_33990 25342 24629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_33990 25493 25909 gene locus_tag LOCUS_34000 25493 25909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 26052 27110 gene locus_tag LOCUS_34010 26052 27110 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_34010 27145 27318 gene locus_tag LOCUS_34020 27145 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 27358 27894 gene locus_tag LOCUS_34030 27358 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 27896 28225 gene locus_tag LOCUS_34040 27896 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 28210 28614 gene locus_tag LOCUS_34050 28210 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 28661 29305 gene locus_tag LOCUS_34060 28661 29305 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070918.1 protein_id gnl|my_center|LOCUS_34060 29306 30283 gene locus_tag LOCUS_34070 29306 30283 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_34070 30797 30327 gene locus_tag LOCUS_34080 30797 30327 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_34080 31332 30859 gene locus_tag LOCUS_34090 31332 30859 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969809.1 protein_id gnl|my_center|LOCUS_34090 31540 31295 gene locus_tag LOCUS_34100 31540 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 31935 32747 gene locus_tag LOCUS_34110 31935 32747 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_34110 32807 33304 gene locus_tag LOCUS_34120 32807 33304 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_34120 33368 34213 gene locus_tag LOCUS_34130 33368 34213 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_34130 34213 34656 gene locus_tag LOCUS_34140 34213 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 34653 35045 gene locus_tag LOCUS_34150 34653 35045 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_34150 35073 35480 gene locus_tag LOCUS_34160 35073 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 35559 35918 gene locus_tag LOCUS_34170 35559 35918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 35958 37184 gene locus_tag LOCUS_34180 35958 37184 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_34180 37280 37657 gene locus_tag LOCUS_34190 37280 37657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 37824 37579 gene locus_tag LOCUS_34200 37824 37579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 38378 37761 gene locus_tag LOCUS_34210 38378 37761 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_34210 38609 39151 gene locus_tag LOCUS_34220 38609 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 39383 39739 gene locus_tag LOCUS_34230 39383 39739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 39760 40152 gene locus_tag LOCUS_34240 39760 40152 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_34240 40215 40679 gene locus_tag LOCUS_34250 40215 40679 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_34250 40727 41194 gene locus_tag LOCUS_34260 40727 41194 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057349.1 protein_id gnl|my_center|LOCUS_34260 41206 41445 gene locus_tag LOCUS_34270 41206 41445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 41442 42974 gene locus_tag LOCUS_34280 41442 42974 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_34280 42971 43495 gene locus_tag LOCUS_34290 42971 43495 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_34290 43505 43678 gene locus_tag LOCUS_34300 43505 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 43617 45293 gene locus_tag LOCUS_34310 43617 45293 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_34310 45375 46982 gene locus_tag LOCUS_34320 45375 46982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 47045 47545 gene locus_tag LOCUS_34330 47045 47545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_34330 47552 49153 gene locus_tag LOCUS_34340 47552 49153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 49549 49154 gene locus_tag LOCUS_34350 49549 49154 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_34350 50298 49546 gene locus_tag LOCUS_34360 50298 49546 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_34360 51733 50447 gene locus_tag LOCUS_34370 51733 50447 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020980741.1 protein_id gnl|my_center|LOCUS_34370 52010 52540 gene locus_tag LOCUS_34380 52010 52540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 52592 53512 gene locus_tag LOCUS_34390 52592 53512 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_34390 53619 54233 gene locus_tag LOCUS_34400 gene paiB 53619 54233 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_34400 54226 54936 gene locus_tag LOCUS_34410 54226 54936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 55033 56649 gene locus_tag LOCUS_34420 55033 56649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412628.1 protein_id gnl|my_center|LOCUS_34420 57982 56657 gene locus_tag LOCUS_34430 57982 56657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 61095 58024 gene locus_tag LOCUS_34440 61095 58024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 62204 61092 gene locus_tag LOCUS_34450 62204 61092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 65259 62185 gene locus_tag LOCUS_34460 65259 62185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 66809 65262 gene locus_tag LOCUS_34470 66809 65262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 68053 66872 gene locus_tag LOCUS_34480 68053 66872 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_34480 68143 69549 gene locus_tag LOCUS_34490 68143 69549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 69902 69558 gene locus_tag LOCUS_34500 69902 69558 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959562.1 protein_id gnl|my_center|LOCUS_34500 70009 70815 gene locus_tag LOCUS_34510 gene lpxA 70009 70815 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_34510 70812 71780 gene locus_tag LOCUS_34520 gene galE 70812 71780 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984071.1 protein_id gnl|my_center|LOCUS_34520 73230 72445 gene locus_tag LOCUS_34530 73230 72445 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_34530 75341 73272 gene locus_tag LOCUS_34540 gene recG 75341 73272 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798669.1 protein_id gnl|my_center|LOCUS_34540 75715 75341 gene locus_tag LOCUS_34550 75715 75341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145547.1 protein_id gnl|my_center|LOCUS_34550 76721 75717 gene locus_tag LOCUS_34560 76721 75717 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692533.1 protein_id gnl|my_center|LOCUS_34560 77408 76728 gene locus_tag LOCUS_34570 77408 76728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886252.1 protein_id gnl|my_center|LOCUS_34570 77465 78466 gene locus_tag LOCUS_34580 77465 78466 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690430.1 protein_id gnl|my_center|LOCUS_34580 78488 78862 gene locus_tag LOCUS_34590 gene crcB 78488 78862 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_34590 79262 78855 gene locus_tag LOCUS_34600 79262 78855 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 protein_id gnl|my_center|LOCUS_34600 80249 79443 gene locus_tag LOCUS_34610 80249 79443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 81275 80265 gene locus_tag LOCUS_34620 81275 80265 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_34620 81766 81485 gene locus_tag LOCUS_34630 81766 81485 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_34630 82052 81738 gene locus_tag LOCUS_34640 82052 81738 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_34640 82716 82366 gene locus_tag LOCUS_34650 82716 82366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 83020 82706 gene locus_tag LOCUS_34660 83020 82706 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_34660 83653 83285 gene locus_tag LOCUS_34670 83653 83285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 83945 83646 gene locus_tag LOCUS_34680 83945 83646 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879182.1 protein_id gnl|my_center|LOCUS_34680 84528 84100 gene locus_tag LOCUS_34690 84528 84100 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_34690 86229 85033 gene locus_tag LOCUS_34700 gene ccrA 86229 85033 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_34700 87211 86351 gene locus_tag LOCUS_34710 87211 86351 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812382.1 protein_id gnl|my_center|LOCUS_34710 88279 87335 gene locus_tag LOCUS_34720 88279 87335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620882.1 protein_id gnl|my_center|LOCUS_34720 89551 88325 gene locus_tag LOCUS_34730 89551 88325 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_34730 90590 89652 gene locus_tag LOCUS_34740 90590 89652 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163350.1 protein_id gnl|my_center|LOCUS_34740 91182 90730 gene locus_tag LOCUS_34750 91182 90730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672998.1 protein_id gnl|my_center|LOCUS_34750 91311 91637 gene locus_tag LOCUS_34760 91311 91637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 91871 93778 gene locus_tag LOCUS_34770 91871 93778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 95510 93834 gene locus_tag LOCUS_34780 95510 93834 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_34780 95606 96097 gene locus_tag LOCUS_34790 95606 96097 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842388.1 protein_id gnl|my_center|LOCUS_34790 96372 96635 gene locus_tag LOCUS_34800 96372 96635 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115710.1 protein_id gnl|my_center|LOCUS_34800 97238 96762 gene locus_tag LOCUS_34810 97238 96762 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001361.1 protein_id gnl|my_center|LOCUS_34810 97331 97702 gene locus_tag LOCUS_34820 97331 97702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_34820 97819 99210 gene locus_tag LOCUS_34830 gene fumC 97819 99210 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_34830 99653 99471 gene locus_tag LOCUS_34840 99653 99471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 100166 99855 gene locus_tag LOCUS_34850 gene iss 100166 99855 CDS product increased serum survival lipoprotein Iss inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_34850 100283 100483 gene locus_tag LOCUS_34860 100283 100483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 100748 100536 gene locus_tag LOCUS_34870 100748 100536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 101240 100854 gene locus_tag LOCUS_34880 101240 100854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 101446 101252 gene locus_tag LOCUS_34890 101446 101252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 102127 101459 gene locus_tag LOCUS_34900 102127 101459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 102359 102523 gene locus_tag LOCUS_34910 102359 102523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 102520 102669 gene locus_tag LOCUS_34920 102520 102669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 102980 102672 gene locus_tag LOCUS_34930 102980 102672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 103510 103043 gene locus_tag LOCUS_34940 103510 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 103870 103568 gene locus_tag LOCUS_34950 103870 103568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 104535 103867 gene locus_tag LOCUS_34960 104535 103867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 105017 104535 gene locus_tag LOCUS_34970 105017 104535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 105493 105014 gene locus_tag LOCUS_34980 105493 105014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 105898 105497 gene locus_tag LOCUS_34990 105898 105497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 106291 105902 gene locus_tag LOCUS_35000 106291 105902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 107714 106293 gene locus_tag LOCUS_35010 107714 106293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 108281 107718 gene locus_tag LOCUS_35020 108281 107718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 108843 108391 gene locus_tag LOCUS_35030 108843 108391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 109516 108875 gene locus_tag LOCUS_35040 109516 108875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 110100 109561 gene locus_tag LOCUS_35050 110100 109561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 110298 110101 gene locus_tag LOCUS_35060 110298 110101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 111863 110295 gene locus_tag LOCUS_35070 111863 110295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 112522 111992 gene locus_tag LOCUS_35080 112522 111992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 112861 112577 gene locus_tag LOCUS_35090 112861 112577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 113088 112861 gene locus_tag LOCUS_35100 113088 112861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 113575 113066 gene locus_tag LOCUS_35110 113575 113066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 113779 113600 gene locus_tag LOCUS_35120 113779 113600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 114209 113949 gene locus_tag LOCUS_35130 114209 113949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 114843 114385 gene locus_tag LOCUS_35140 114843 114385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 116357 114855 gene locus_tag LOCUS_35150 116357 114855 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_35150 116536 116354 gene locus_tag LOCUS_35160 116536 116354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 117393 116533 gene locus_tag LOCUS_35170 117393 116533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 118862 117615 gene locus_tag LOCUS_35180 118862 117615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 119008 120018 gene locus_tag LOCUS_35190 119008 120018 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_35190 120024 120941 gene locus_tag LOCUS_35200 120024 120941 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_35200 123368 120930 gene locus_tag LOCUS_35210 123368 120930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 123428 123709 gene locus_tag LOCUS_35220 123428 123709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 123997 127248 gene locus_tag LOCUS_35230 123997 127248 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046741.1 protein_id gnl|my_center|LOCUS_35230 128253 127546 gene locus_tag LOCUS_35240 128253 127546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35240 128558 128259 gene locus_tag LOCUS_35250 128558 128259 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034680.1 protein_id gnl|my_center|LOCUS_35250 131549 128685 gene locus_tag LOCUS_35260 131549 128685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 131679 132581 gene locus_tag LOCUS_35270 gene cas1e 131679 132581 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_35270 132788 132716 gene locus_tag LOCUS_t00290 132788 132716 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 132882 132807 gene locus_tag LOCUS_t00300 132882 132807 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 132970 132897 gene locus_tag LOCUS_t00310 132970 132897 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 133695 133030 gene locus_tag LOCUS_35280 133695 133030 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280575.1 protein_id gnl|my_center|LOCUS_35280 134448 133702 gene locus_tag LOCUS_35290 gene surE 134448 133702 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023250.1 protein_id gnl|my_center|LOCUS_35290 135060 134449 gene locus_tag LOCUS_35300 135060 134449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 136022 135057 gene locus_tag LOCUS_35310 gene sppA 136022 135057 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440816.1 protein_id gnl|my_center|LOCUS_35310 136158 136724 gene locus_tag LOCUS_35320 136158 136724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453664.1 protein_id gnl|my_center|LOCUS_35320 136784 138109 gene locus_tag LOCUS_35330 136784 138109 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493034.1 protein_id gnl|my_center|LOCUS_35330 138121 139146 gene locus_tag LOCUS_35340 138121 139146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 139625 140641 gene locus_tag LOCUS_35350 139625 140641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 140874 140638 gene locus_tag LOCUS_35360 140874 140638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 141479 141078 gene locus_tag LOCUS_35370 141479 141078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377461.1 protein_id gnl|my_center|LOCUS_35370 141553 142023 gene locus_tag LOCUS_35380 gene bcp 141553 142023 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_35380 142029 143507 gene locus_tag LOCUS_35390 142029 143507 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762684.1 protein_id gnl|my_center|LOCUS_35390 146090 143661 gene locus_tag LOCUS_35400 146090 143661 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002071771.1 protein_id gnl|my_center|LOCUS_35400 147737 146136 gene locus_tag LOCUS_35410 147737 146136 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_35410 147891 148913 gene locus_tag LOCUS_35420 147891 148913 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_35420 150428 149838 gene locus_tag LOCUS_35430 150428 149838 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140192.1 protein_id gnl|my_center|LOCUS_35430 151430 150432 gene locus_tag LOCUS_35440 151430 150432 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140193.1 protein_id gnl|my_center|LOCUS_35440 152695 152129 gene locus_tag LOCUS_35450 152695 152129 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239306.1 protein_id gnl|my_center|LOCUS_35450 152755 153693 gene locus_tag LOCUS_35460 152755 153693 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047544.1 protein_id gnl|my_center|LOCUS_35460 154222 155202 gene locus_tag LOCUS_35470 154222 155202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 155255 155998 gene locus_tag LOCUS_35480 155255 155998 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_35480 155995 156567 gene locus_tag LOCUS_35490 155995 156567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 157533 156634 gene locus_tag LOCUS_35500 157533 156634 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246419.1 protein_id gnl|my_center|LOCUS_35500 158572 157856 gene locus_tag LOCUS_35510 158572 157856 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049241.1 protein_id gnl|my_center|LOCUS_35510 159162 158569 gene locus_tag LOCUS_35520 159162 158569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484465.1 protein_id gnl|my_center|LOCUS_35520 160024 159134 gene locus_tag LOCUS_35530 160024 159134 CDS product YHYH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615243.1 protein_id gnl|my_center|LOCUS_35530 160788 160135 gene locus_tag LOCUS_35540 160788 160135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 163638 161317 gene locus_tag LOCUS_35550 163638 161317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_35550 165954 163681 gene locus_tag LOCUS_35560 165954 163681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_35560 166123 166719 gene locus_tag LOCUS_35570 166123 166719 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_35570 166764 167276 gene locus_tag LOCUS_35580 166764 167276 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145486.1 protein_id gnl|my_center|LOCUS_35580 167273 167800 gene locus_tag LOCUS_35590 gene hpt 167273 167800 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019306.1 protein_id gnl|my_center|LOCUS_35590 168662 167787 gene locus_tag LOCUS_35600 168662 167787 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768212.1 protein_id gnl|my_center|LOCUS_35600 168921 170072 gene locus_tag LOCUS_35610 168921 170072 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002970704.1 protein_id gnl|my_center|LOCUS_35610 171337 170069 gene locus_tag LOCUS_35620 171337 170069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 173630 171387 gene locus_tag LOCUS_35630 173630 171387 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135774324.1 protein_id gnl|my_center|LOCUS_35630 174237 174530 gene locus_tag LOCUS_35640 174237 174530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 174520 174822 gene locus_tag LOCUS_35650 174520 174822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672992.1 protein_id gnl|my_center|LOCUS_35650 178183 175190 gene locus_tag LOCUS_35660 178183 175190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 178482 179348 gene locus_tag LOCUS_35670 178482 179348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011733.1 protein_id gnl|my_center|LOCUS_35670 179364 179801 gene locus_tag LOCUS_35680 179364 179801 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_35680 179820 180239 gene locus_tag LOCUS_35690 179820 180239 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_35690 181098 180304 gene locus_tag LOCUS_35700 181098 180304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 protein_id gnl|my_center|LOCUS_35700 181216 181563 gene locus_tag LOCUS_35710 181216 181563 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245808.1 protein_id gnl|my_center|LOCUS_35710 181711 182763 gene locus_tag LOCUS_35720 181711 182763 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_35720 184850 182871 gene locus_tag LOCUS_35730 184850 182871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 184960 185568 gene locus_tag LOCUS_35740 184960 185568 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_35740 186039 186275 gene locus_tag LOCUS_35750 186039 186275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277167.1 protein_id gnl|my_center|LOCUS_35750 186275 187417 gene locus_tag LOCUS_35760 186275 187417 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_35760 187477 188058 gene locus_tag LOCUS_35770 187477 188058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 189375 188413 gene locus_tag LOCUS_35780 189375 188413 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_35780 189520 190644 gene locus_tag LOCUS_35790 gene gcvT 189520 190644 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973508.1 protein_id gnl|my_center|LOCUS_35790 190682 191074 gene locus_tag LOCUS_35800 gene gcvH 190682 191074 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852369.1 protein_id gnl|my_center|LOCUS_35800 191091 194006 gene locus_tag LOCUS_35810 gene gcvP 191091 194006 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089349.1 protein_id gnl|my_center|LOCUS_35810 194030 194350 gene locus_tag LOCUS_35820 194030 194350 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181227.1 protein_id gnl|my_center|LOCUS_35820 195239 194301 gene locus_tag LOCUS_35830 195239 194301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 195573 195358 gene locus_tag LOCUS_35840 195573 195358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 196083 195655 gene locus_tag LOCUS_35850 196083 195655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 196386 196907 gene locus_tag LOCUS_35860 196386 196907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 196929 198401 gene locus_tag LOCUS_35870 196929 198401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 198439 199380 gene locus_tag LOCUS_35880 198439 199380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 200683 199412 gene locus_tag LOCUS_35890 200683 199412 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221079.1 protein_id gnl|my_center|LOCUS_35890 202644 200944 gene locus_tag LOCUS_35900 202644 200944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 206034 202660 gene locus_tag LOCUS_35910 206034 202660 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_35910 207002 206127 gene locus_tag LOCUS_35920 207002 206127 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431423.1 protein_id gnl|my_center|LOCUS_35920 207008 208012 gene locus_tag LOCUS_35930 207008 208012 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031032.1 protein_id gnl|my_center|LOCUS_35930 208015 209292 gene locus_tag LOCUS_35940 208015 209292 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282546.1 protein_id gnl|my_center|LOCUS_35940 >Feature sequence71 >Feature sequence72 1364 564 gene locus_tag LOCUS_35950 1364 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 1605 1417 gene locus_tag LOCUS_35960 1605 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3016 1973 gene locus_tag LOCUS_35970 3016 1973 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_35970 3868 3125 gene locus_tag LOCUS_35980 3868 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4382 5032 gene locus_tag LOCUS_35990 4382 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 6170 5298 gene locus_tag LOCUS_36000 6170 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 7005 6172 gene locus_tag LOCUS_36010 7005 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 9267 7189 gene locus_tag LOCUS_36020 9267 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 11171 9621 gene locus_tag LOCUS_36030 11171 9621 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_36030 11631 11230 gene locus_tag LOCUS_36040 11631 11230 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_36040 13506 11632 gene locus_tag LOCUS_36050 13506 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 13681 14040 gene locus_tag LOCUS_36060 13681 14040 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788957.1 protein_id gnl|my_center|LOCUS_36060 15227 14088 gene locus_tag LOCUS_36070 15227 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 15987 15487 gene locus_tag LOCUS_36080 15987 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 16113 17606 gene locus_tag LOCUS_36090 16113 17606 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_36090 17657 18007 gene locus_tag LOCUS_36100 17657 18007 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016912.1 protein_id gnl|my_center|LOCUS_36100 18109 18807 gene locus_tag LOCUS_36110 18109 18807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_36110 18810 19541 gene locus_tag LOCUS_36120 18810 19541 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_36120 19574 20740 gene locus_tag LOCUS_36130 gene metK 19574 20740 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_36130 20744 21709 gene locus_tag LOCUS_36140 20744 21709 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501205.1 protein_id gnl|my_center|LOCUS_36140 21727 22053 gene locus_tag LOCUS_36150 21727 22053 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168948.1 protein_id gnl|my_center|LOCUS_36150 23439 22462 gene locus_tag LOCUS_36160 23439 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898918.1 protein_id gnl|my_center|LOCUS_36160 23483 27112 gene locus_tag LOCUS_36170 23483 27112 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796630.1 protein_id gnl|my_center|LOCUS_36170 27930 27115 gene locus_tag LOCUS_36180 27930 27115 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742874.1 protein_id gnl|my_center|LOCUS_36180 28066 29082 gene locus_tag LOCUS_36190 28066 29082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846599.1 protein_id gnl|my_center|LOCUS_36190 29085 30446 gene locus_tag LOCUS_36200 29085 30446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097553.1 protein_id gnl|my_center|LOCUS_36200 30455 31171 gene locus_tag LOCUS_36210 gene mtnC 30455 31171 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022662.1 protein_id gnl|my_center|LOCUS_36210 31216 32778 gene locus_tag LOCUS_36220 31216 32778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 35023 33023 gene locus_tag LOCUS_36230 35023 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 36975 35020 gene locus_tag LOCUS_36240 36975 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 37895 36972 gene locus_tag LOCUS_36250 gene fliH 37895 36972 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096786.1 protein_id gnl|my_center|LOCUS_36250 38982 37900 gene locus_tag LOCUS_36260 38982 37900 CDS product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061755.1 protein_id gnl|my_center|LOCUS_36260 39510 41684 gene locus_tag LOCUS_36270 39510 41684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 41964 44060 gene locus_tag LOCUS_36280 41964 44060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 44293 46428 gene locus_tag LOCUS_36290 44293 46428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 46676 48730 gene locus_tag LOCUS_36300 46676 48730 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251358.1 protein_id gnl|my_center|LOCUS_36300 48730 50856 gene locus_tag LOCUS_36310 48730 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 52156 50987 gene locus_tag LOCUS_36320 52156 50987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 53629 52397 gene locus_tag LOCUS_36330 53629 52397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 54856 56331 gene locus_tag LOCUS_36340 54856 56331 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_36340 56940 58403 gene locus_tag LOCUS_36350 gene gatB 56940 58403 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807228.1 protein_id gnl|my_center|LOCUS_36350 58996 58400 gene locus_tag LOCUS_36360 gene cobC 58996 58400 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_36360 59850 58981 gene locus_tag LOCUS_36370 59850 58981 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_36370 60908 59847 gene locus_tag LOCUS_36380 gene cobT 60908 59847 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_36380 61091 64591 gene locus_tag LOCUS_36390 gene dnaE 61091 64591 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150496.1 protein_id gnl|my_center|LOCUS_36390 64588 65715 gene locus_tag LOCUS_36400 64588 65715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 65786 67681 gene locus_tag LOCUS_36410 65786 67681 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_36410 68570 67758 gene locus_tag LOCUS_36420 68570 67758 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714135.1 protein_id gnl|my_center|LOCUS_36420 68748 69665 gene locus_tag LOCUS_36430 68748 69665 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054050.1 protein_id gnl|my_center|LOCUS_36430 69709 70446 gene locus_tag LOCUS_36440 69709 70446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 70459 72279 gene locus_tag LOCUS_36450 70459 72279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 72276 72992 gene locus_tag LOCUS_36460 72276 72992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050596.1 protein_id gnl|my_center|LOCUS_36460 73286 73020 gene locus_tag LOCUS_36470 73286 73020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409984.1 protein_id gnl|my_center|LOCUS_36470 73399 74469 gene locus_tag LOCUS_36480 gene mtnA 73399 74469 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158184.1 protein_id gnl|my_center|LOCUS_36480 74476 74985 gene locus_tag LOCUS_36490 gene msrA 74476 74985 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_36490 76481 74994 gene locus_tag LOCUS_36500 76481 74994 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993253.1 protein_id gnl|my_center|LOCUS_36500 77562 76528 gene locus_tag LOCUS_36510 77562 76528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132138.1 protein_id gnl|my_center|LOCUS_36510 78086 77577 gene locus_tag LOCUS_36520 78086 77577 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116541.1 protein_id gnl|my_center|LOCUS_36520 79196 78087 gene locus_tag LOCUS_36530 79196 78087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 79276 80016 gene locus_tag LOCUS_36540 79276 80016 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_36540 80059 81486 gene locus_tag LOCUS_36550 gene lpdA 80059 81486 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115270.1 protein_id gnl|my_center|LOCUS_36550 82690 81854 gene locus_tag LOCUS_36560 82690 81854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944890.1 protein_id gnl|my_center|LOCUS_36560 82738 83127 gene locus_tag LOCUS_36570 82738 83127 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166988.1 protein_id gnl|my_center|LOCUS_36570 83250 84929 gene locus_tag LOCUS_36580 83250 84929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 89568 84931 gene locus_tag LOCUS_36590 89568 84931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 89694 90887 gene locus_tag LOCUS_36600 89694 90887 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071499.1 protein_id gnl|my_center|LOCUS_36600 90957 92036 gene locus_tag LOCUS_36610 90957 92036 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617806.1 protein_id gnl|my_center|LOCUS_36610 92039 94348 gene locus_tag LOCUS_36620 92039 94348 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622215.1 protein_id gnl|my_center|LOCUS_36620 94860 94345 gene locus_tag LOCUS_36630 gene tpx 94860 94345 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170133.1 protein_id gnl|my_center|LOCUS_36630 96051 94921 gene locus_tag LOCUS_36640 96051 94921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 98085 96349 gene locus_tag LOCUS_36650 98085 96349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155537.1 protein_id gnl|my_center|LOCUS_36650 98138 99100 gene locus_tag LOCUS_36660 gene rsgA 98138 99100 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893972.1 protein_id gnl|my_center|LOCUS_36660 99168 100127 gene locus_tag LOCUS_36670 99168 100127 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833301.1 protein_id gnl|my_center|LOCUS_36670 100124 101755 gene locus_tag LOCUS_36680 100124 101755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257938.1 protein_id gnl|my_center|LOCUS_36680 101752 105348 gene locus_tag LOCUS_36690 101752 105348 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677425.1 protein_id gnl|my_center|LOCUS_36690 106013 105354 gene locus_tag LOCUS_36700 gene trmB 106013 105354 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249518.1 protein_id gnl|my_center|LOCUS_36700 106105 107052 gene locus_tag LOCUS_36710 106105 107052 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694733.1 protein_id gnl|my_center|LOCUS_36710 108366 107077 gene locus_tag LOCUS_36720 108366 107077 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_36720 109863 108877 gene locus_tag LOCUS_36730 109863 108877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468938.1 protein_id gnl|my_center|LOCUS_36730 110372 109944 gene locus_tag LOCUS_36740 110372 109944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 110462 111037 gene locus_tag LOCUS_36750 110462 111037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 111083 112294 gene locus_tag LOCUS_36760 111083 112294 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062719.1 protein_id gnl|my_center|LOCUS_36760 112551 113798 gene locus_tag LOCUS_36770 112551 113798 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 protein_id gnl|my_center|LOCUS_36770 113806 115767 gene locus_tag LOCUS_36780 113806 115767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 116607 116113 gene locus_tag LOCUS_36790 116607 116113 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921259.1 protein_id gnl|my_center|LOCUS_36790 117349 116645 gene locus_tag LOCUS_36800 117349 116645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_36800 117458 117898 gene locus_tag LOCUS_36810 117458 117898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 118815 117907 gene locus_tag LOCUS_36820 118815 117907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 119965 118940 gene locus_tag LOCUS_36830 119965 118940 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_36830 120132 121298 gene locus_tag LOCUS_36840 120132 121298 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232010.1 protein_id gnl|my_center|LOCUS_36840 121461 121658 gene locus_tag LOCUS_36850 121461 121658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 122637 121816 gene locus_tag LOCUS_36860 122637 121816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 123630 122665 gene locus_tag LOCUS_36870 123630 122665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 124865 123636 gene locus_tag LOCUS_36880 124865 123636 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_36880 125171 128815 gene locus_tag LOCUS_36890 125171 128815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 129649 128924 gene locus_tag LOCUS_36900 129649 128924 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651458.1 protein_id gnl|my_center|LOCUS_36900 131171 129699 gene locus_tag LOCUS_36910 131171 129699 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742439.1 protein_id gnl|my_center|LOCUS_36910 131295 131513 gene locus_tag LOCUS_36920 131295 131513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 132865 131510 gene locus_tag LOCUS_36930 132865 131510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 133446 132973 gene locus_tag LOCUS_36940 133446 132973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 133587 134174 gene locus_tag LOCUS_36950 133587 134174 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863243.1 protein_id gnl|my_center|LOCUS_36950 134171 134860 gene locus_tag LOCUS_36960 134171 134860 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257137.1 protein_id gnl|my_center|LOCUS_36960 134871 137630 gene locus_tag LOCUS_36970 gene secA 134871 137630 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615621.1 protein_id gnl|my_center|LOCUS_36970 137940 137722 gene locus_tag LOCUS_36980 137940 137722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 138328 138864 gene locus_tag LOCUS_36990 138328 138864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278051.1 protein_id gnl|my_center|LOCUS_36990 140018 139101 gene locus_tag LOCUS_37000 140018 139101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 140357 140022 gene locus_tag LOCUS_37010 140357 140022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 142347 140305 gene locus_tag LOCUS_37020 142347 140305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 143286 142723 gene locus_tag LOCUS_37030 143286 142723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 144013 143546 gene locus_tag LOCUS_37040 144013 143546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 145541 144027 gene locus_tag LOCUS_37050 145541 144027 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220794.1 protein_id gnl|my_center|LOCUS_37050 146887 145715 gene locus_tag LOCUS_37060 146887 145715 CDS product [cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185977.1 protein_id gnl|my_center|LOCUS_37060 147426 147001 gene locus_tag LOCUS_37070 147426 147001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 147802 147458 gene locus_tag LOCUS_37080 147802 147458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 148212 147802 gene locus_tag LOCUS_37090 148212 147802 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628813.1 protein_id gnl|my_center|LOCUS_37090 148447 149427 gene locus_tag LOCUS_37100 148447 149427 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890625.1 protein_id gnl|my_center|LOCUS_37100 150475 149738 gene locus_tag LOCUS_37110 150475 149738 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070118.1 protein_id gnl|my_center|LOCUS_37110 152658 150475 gene locus_tag LOCUS_37120 152658 150475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 152867 154321 gene locus_tag LOCUS_37130 152867 154321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_37130 154399 154677 gene locus_tag LOCUS_37140 154399 154677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291938.1 protein_id gnl|my_center|LOCUS_37140 154684 155844 gene locus_tag LOCUS_37150 154684 155844 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804576.1 protein_id gnl|my_center|LOCUS_37150 155844 156746 gene locus_tag LOCUS_37160 155844 156746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 156782 157243 gene locus_tag LOCUS_37170 156782 157243 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069646.1 protein_id gnl|my_center|LOCUS_37170 157253 158161 gene locus_tag LOCUS_37180 157253 158161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161189.1 protein_id gnl|my_center|LOCUS_37180 158148 158927 gene locus_tag LOCUS_37190 158148 158927 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622788.1 protein_id gnl|my_center|LOCUS_37190 158937 160595 gene locus_tag LOCUS_37200 158937 160595 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620377.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence73 >Feature sequence74 376 1722 gene locus_tag LOCUS_37210 376 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1728 2546 gene locus_tag LOCUS_37220 1728 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 2533 5643 gene locus_tag LOCUS_37230 2533 5643 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620776.1 protein_id gnl|my_center|LOCUS_37230 5643 6323 gene locus_tag LOCUS_37240 5643 6323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_37240 6320 7684 gene locus_tag LOCUS_37250 6320 7684 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_37250 7971 9032 gene locus_tag LOCUS_37260 7971 9032 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112918.1 protein_id gnl|my_center|LOCUS_37260 9989 9117 gene locus_tag LOCUS_37270 gene prmC 9989 9117 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164603.1 protein_id gnl|my_center|LOCUS_37270 10069 9997 gene locus_tag LOCUS_t00320 10069 9997 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10715 10071 gene locus_tag LOCUS_37280 10715 10071 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367409.1 protein_id gnl|my_center|LOCUS_37280 11770 10715 gene locus_tag LOCUS_37290 11770 10715 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918546.1 protein_id gnl|my_center|LOCUS_37290 13030 11795 gene locus_tag LOCUS_37300 13030 11795 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455556.1 protein_id gnl|my_center|LOCUS_37300 13673 13032 gene locus_tag LOCUS_37310 13673 13032 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255127.1 protein_id gnl|my_center|LOCUS_37310 16358 14241 gene locus_tag LOCUS_37320 gene fusA 16358 14241 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102023.1 protein_id gnl|my_center|LOCUS_37320 16525 18015 gene locus_tag LOCUS_37330 16525 18015 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182753.1 protein_id gnl|my_center|LOCUS_37330 18073 19098 gene locus_tag LOCUS_37340 18073 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 19107 20006 gene locus_tag LOCUS_37350 19107 20006 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_37350 20017 20532 gene locus_tag LOCUS_37360 20017 20532 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675940.1 protein_id gnl|my_center|LOCUS_37360 20626 21324 gene locus_tag LOCUS_37370 20626 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433142.1 protein_id gnl|my_center|LOCUS_37370 22173 21313 gene locus_tag LOCUS_37380 22173 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 22258 22806 gene locus_tag LOCUS_37390 22258 22806 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771339.1 protein_id gnl|my_center|LOCUS_37390 22853 23773 gene locus_tag LOCUS_37400 22853 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475812.1 protein_id gnl|my_center|LOCUS_37400 23942 24856 gene locus_tag LOCUS_37410 gene cysK 23942 24856 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_37410 25135 26736 gene locus_tag LOCUS_37420 gene topA 25135 26736 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583876.1 protein_id gnl|my_center|LOCUS_37420 26773 27765 gene locus_tag LOCUS_37430 gene hemH 26773 27765 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080011809.1 protein_id gnl|my_center|LOCUS_37430 29085 27817 gene locus_tag LOCUS_37440 gene hemG 29085 27817 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260297.1 protein_id gnl|my_center|LOCUS_37440 30436 29087 gene locus_tag LOCUS_37450 gene hemN 30436 29087 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982947.1 protein_id gnl|my_center|LOCUS_37450 31481 30423 gene locus_tag LOCUS_37460 31481 30423 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132417.1 protein_id gnl|my_center|LOCUS_37460 32767 31478 gene locus_tag LOCUS_37470 32767 31478 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075137.1 protein_id gnl|my_center|LOCUS_37470 33615 32764 gene locus_tag LOCUS_37480 gene hemB 33615 32764 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448660.1 protein_id gnl|my_center|LOCUS_37480 35261 33729 gene locus_tag LOCUS_37490 35261 33729 CDS product uroporphyrinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086812.1 protein_id gnl|my_center|LOCUS_37490 36124 35246 gene locus_tag LOCUS_37500 36124 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269768.1 protein_id gnl|my_center|LOCUS_37500 36294 36701 gene locus_tag LOCUS_37510 gene msrB 36294 36701 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_37510 37141 36716 gene locus_tag LOCUS_37520 37141 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 37682 38293 gene locus_tag LOCUS_37530 37682 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 39062 38466 gene locus_tag LOCUS_37540 39062 38466 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088543.1 protein_id gnl|my_center|LOCUS_37540 39861 39067 gene locus_tag LOCUS_37550 gene cobA 39861 39067 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930524.1 protein_id gnl|my_center|LOCUS_37550 40176 41945 gene locus_tag LOCUS_37560 40176 41945 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830607.1 protein_id gnl|my_center|LOCUS_37560 41958 43628 gene locus_tag LOCUS_37570 gene cysI 41958 43628 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_37570 44712 43801 gene locus_tag LOCUS_37580 44712 43801 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_37580 45784 44714 gene locus_tag LOCUS_37590 45784 44714 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_37590 46280 45873 gene locus_tag LOCUS_37600 46280 45873 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_37600 47836 46604 gene locus_tag LOCUS_37610 47836 46604 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_37610 48744 47836 gene locus_tag LOCUS_37620 gene cysD 48744 47836 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_37620 49481 48750 gene locus_tag LOCUS_37630 49481 48750 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_37630 50653 49589 gene locus_tag LOCUS_37640 50653 49589 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510777.1 protein_id gnl|my_center|LOCUS_37640 51472 50660 gene locus_tag LOCUS_37650 gene cysW 51472 50660 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808268.1 protein_id gnl|my_center|LOCUS_37650 52296 51469 gene locus_tag LOCUS_37660 gene cysT 52296 51469 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002072999.1 protein_id gnl|my_center|LOCUS_37660 53371 52319 gene locus_tag LOCUS_37670 53371 52319 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842616.1 protein_id gnl|my_center|LOCUS_37670 53878 54198 gene locus_tag LOCUS_37680 53878 54198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37680 54211 54393 gene locus_tag LOCUS_37690 54211 54393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 54692 55477 gene locus_tag LOCUS_37700 54692 55477 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_37700 55888 55484 gene locus_tag LOCUS_37710 55888 55484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 57557 56028 gene locus_tag LOCUS_37720 57557 56028 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786864.1 protein_id gnl|my_center|LOCUS_37720 58749 57643 gene locus_tag LOCUS_37730 58749 57643 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431183.1 protein_id gnl|my_center|LOCUS_37730 58841 60565 gene locus_tag LOCUS_37740 gene ilvB 58841 60565 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272051.1 protein_id gnl|my_center|LOCUS_37740 60562 61050 gene locus_tag LOCUS_37750 gene ilvN 60562 61050 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680556.1 protein_id gnl|my_center|LOCUS_37750 61111 62886 gene locus_tag LOCUS_37760 61111 62886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 63921 62980 gene locus_tag LOCUS_37770 gene trxB 63921 62980 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_37770 64577 63993 gene locus_tag LOCUS_37780 64577 63993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 64615 65523 gene locus_tag LOCUS_37790 gene xerD 64615 65523 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_37790 65523 65957 gene locus_tag LOCUS_37800 65523 65957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377010.1 protein_id gnl|my_center|LOCUS_37800 66220 66441 gene locus_tag LOCUS_37810 66220 66441 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673486.1 protein_id gnl|my_center|LOCUS_37810 66500 67033 gene locus_tag LOCUS_37820 gene hslV 66500 67033 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_37820 67041 68468 gene locus_tag LOCUS_37830 gene hslU 67041 68468 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273640.1 protein_id gnl|my_center|LOCUS_37830 70140 68500 gene locus_tag LOCUS_37840 gene pabB 70140 68500 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217385.1 protein_id gnl|my_center|LOCUS_37840 71210 70365 gene locus_tag LOCUS_37850 71210 70365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013261.1 protein_id gnl|my_center|LOCUS_37850 71280 71528 gene locus_tag LOCUS_37860 71280 71528 CDS product lipoyl domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837773.1 protein_id gnl|my_center|LOCUS_37860 71525 72400 gene locus_tag LOCUS_37870 71525 72400 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697455.1 protein_id gnl|my_center|LOCUS_37870 72434 73486 gene locus_tag LOCUS_37880 72434 73486 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190880.1 protein_id gnl|my_center|LOCUS_37880 73537 74232 gene locus_tag LOCUS_37890 73537 74232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667222.1 protein_id gnl|my_center|LOCUS_37890 74343 74711 gene locus_tag LOCUS_37900 74343 74711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 74725 75114 gene locus_tag LOCUS_37910 74725 75114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 75217 75540 gene locus_tag LOCUS_37920 75217 75540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 75633 76247 gene locus_tag LOCUS_37930 75633 76247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 78491 76848 gene locus_tag LOCUS_37940 gene groL 78491 76848 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029966.1 protein_id gnl|my_center|LOCUS_37940 78801 78514 gene locus_tag LOCUS_37950 gene groES 78801 78514 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146552.1 protein_id gnl|my_center|LOCUS_37950 79800 78982 gene locus_tag LOCUS_37960 79800 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 81442 79847 gene locus_tag LOCUS_37970 81442 79847 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_37970 82244 82531 gene locus_tag LOCUS_37980 82244 82531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 82650 84932 gene locus_tag LOCUS_37990 82650 84932 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208652719.1 protein_id gnl|my_center|LOCUS_37990 85592 84924 gene locus_tag LOCUS_38000 gene narL 85592 84924 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705094.1 protein_id gnl|my_center|LOCUS_38000 85831 85652 gene locus_tag LOCUS_38010 85831 85652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 85830 86300 gene locus_tag LOCUS_38020 85830 86300 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164879.1 protein_id gnl|my_center|LOCUS_38020 86388 86597 gene locus_tag LOCUS_38030 86388 86597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 86640 87353 gene locus_tag LOCUS_38040 86640 87353 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227585.1 protein_id gnl|my_center|LOCUS_38040 87366 88346 gene locus_tag LOCUS_38050 87366 88346 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972005.1 protein_id gnl|my_center|LOCUS_38050 88537 91302 gene locus_tag LOCUS_38060 gene greA 88537 91302 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064092.1 protein_id gnl|my_center|LOCUS_38060 93089 91275 gene locus_tag LOCUS_38070 93089 91275 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025175910.1 protein_id gnl|my_center|LOCUS_38070 93242 93802 gene locus_tag LOCUS_38080 gene lptE 93242 93802 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469242.1 protein_id gnl|my_center|LOCUS_38080 93830 94297 gene locus_tag LOCUS_38090 93830 94297 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_38090 94297 95412 gene locus_tag LOCUS_38100 gene tgt 94297 95412 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577236.1 protein_id gnl|my_center|LOCUS_38100 95506 95841 gene locus_tag LOCUS_38110 95506 95841 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_38110 95900 97351 gene locus_tag LOCUS_38120 95900 97351 CDS product lipoprotein LipL71 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843317.1 protein_id gnl|my_center|LOCUS_38120 97424 98290 gene locus_tag LOCUS_38130 gene nadC 97424 98290 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266735.1 protein_id gnl|my_center|LOCUS_38130 98290 100350 gene locus_tag LOCUS_38140 98290 100350 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_38140 101656 100340 gene locus_tag LOCUS_38150 101656 100340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 101776 103602 gene locus_tag LOCUS_38160 101776 103602 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_38160 103603 104688 gene locus_tag LOCUS_38170 103603 104688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042628.1 protein_id gnl|my_center|LOCUS_38170 104699 106288 gene locus_tag LOCUS_38180 104699 106288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_38180 106285 107070 gene locus_tag LOCUS_38190 106285 107070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 107461 107051 gene locus_tag LOCUS_38200 107461 107051 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643584.1 protein_id gnl|my_center|LOCUS_38200 108559 107483 gene locus_tag LOCUS_38210 gene leuB 108559 107483 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799846.1 protein_id gnl|my_center|LOCUS_38210 109770 108562 gene locus_tag LOCUS_38220 109770 108562 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995952.1 protein_id gnl|my_center|LOCUS_38220 111530 109767 gene locus_tag LOCUS_38230 111530 109767 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015897.1 protein_id gnl|my_center|LOCUS_38230 111667 112665 gene locus_tag LOCUS_38240 111667 112665 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433710.1 protein_id gnl|my_center|LOCUS_38240 112662 113423 gene locus_tag LOCUS_38250 112662 113423 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944038.1 protein_id gnl|my_center|LOCUS_38250 113891 113460 gene locus_tag LOCUS_38260 113891 113460 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_38260 114109 115206 gene locus_tag LOCUS_38270 114109 115206 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_38270 115395 115634 gene locus_tag LOCUS_38280 115395 115634 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_38280 115631 116023 gene locus_tag LOCUS_38290 115631 116023 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405519.1 protein_id gnl|my_center|LOCUS_38290 116209 116137 gene locus_tag LOCUS_t00330 116209 116137 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 116301 116228 gene locus_tag LOCUS_t00340 116301 116228 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 117569 116382 gene locus_tag LOCUS_38300 gene hemW 117569 116382 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582256.1 protein_id gnl|my_center|LOCUS_38300 117568 118065 gene locus_tag LOCUS_38310 117568 118065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 118117 118190 gene locus_tag LOCUS_t00350 118117 118190 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 118220 118795 gene locus_tag LOCUS_38320 118220 118795 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366622.1 protein_id gnl|my_center|LOCUS_38320 118957 119322 gene locus_tag LOCUS_38330 118957 119322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099422.1 protein_id gnl|my_center|LOCUS_38330 119475 120701 gene locus_tag LOCUS_38340 119475 120701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982317.1 protein_id gnl|my_center|LOCUS_38340 121327 120698 gene locus_tag LOCUS_38350 121327 120698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616810.1 protein_id gnl|my_center|LOCUS_38350 122615 121455 gene locus_tag LOCUS_38360 122615 121455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_38360 123263 122730 gene locus_tag LOCUS_38370 123263 122730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 123177 123398 gene locus_tag LOCUS_38380 123177 123398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 124150 123395 gene locus_tag LOCUS_38390 gene modA 124150 123395 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 protein_id gnl|my_center|LOCUS_38390 124841 124161 gene locus_tag LOCUS_38400 gene modB 124841 124161 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_38400 128034 125728 gene locus_tag LOCUS_38410 128034 125728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 128329 128045 gene locus_tag LOCUS_38420 128329 128045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 128903 128331 gene locus_tag LOCUS_38430 128903 128331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 129838 129035 gene locus_tag LOCUS_38440 129838 129035 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_38440 130137 130460 gene locus_tag LOCUS_38450 130137 130460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 131231 130530 gene locus_tag LOCUS_38460 131231 130530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 133458 131335 gene locus_tag LOCUS_38470 133458 131335 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_38470 133619 135811 gene locus_tag LOCUS_38480 133619 135811 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 protein_id gnl|my_center|LOCUS_38480 137608 135824 gene locus_tag LOCUS_38490 137608 135824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 140038 137786 gene locus_tag LOCUS_38500 gene purL 140038 137786 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409813.1 protein_id gnl|my_center|LOCUS_38500 140530 140054 gene locus_tag LOCUS_38510 140530 140054 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704507.1 protein_id gnl|my_center|LOCUS_38510 140655 141017 gene locus_tag LOCUS_38520 140655 141017 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701366.1 protein_id gnl|my_center|LOCUS_38520 141055 142830 gene locus_tag LOCUS_38530 gene mutL 141055 142830 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516444.1 protein_id gnl|my_center|LOCUS_38530 142943 143521 gene locus_tag LOCUS_38540 142943 143521 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378484.1 protein_id gnl|my_center|LOCUS_38540 143526 144080 gene locus_tag LOCUS_38550 143526 144080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 144971 144081 gene locus_tag LOCUS_38560 144971 144081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010627.1 protein_id gnl|my_center|LOCUS_38560 145292 145002 gene locus_tag LOCUS_38570 gene raiA 145292 145002 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701011.1 protein_id gnl|my_center|LOCUS_38570 145425 146105 gene locus_tag LOCUS_38580 145425 146105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 146102 147691 gene locus_tag LOCUS_38590 146102 147691 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_38590 147842 149143 gene locus_tag LOCUS_38600 147842 149143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 150227 149148 gene locus_tag LOCUS_38610 150227 149148 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437834.1 protein_id gnl|my_center|LOCUS_38610 150955 150224 gene locus_tag LOCUS_38620 150955 150224 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_38620 151563 151036 gene locus_tag LOCUS_38630 151563 151036 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114482.1 protein_id gnl|my_center|LOCUS_38630 154001 151575 gene locus_tag LOCUS_38640 154001 151575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 156069 154039 gene locus_tag LOCUS_38650 156069 154039 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266629.1 protein_id gnl|my_center|LOCUS_38650 156391 156056 gene locus_tag LOCUS_38660 156391 156056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 156746 156384 gene locus_tag LOCUS_38670 156746 156384 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 protein_id gnl|my_center|LOCUS_38670 157365 157535 gene locus_tag LOCUS_38680 157365 157535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680