COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..118090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(587..982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1020..1400) product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1489..2658 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2712..3299) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3475..4455 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4458..5069 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene yqeK CDS 5208..5717 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5763..6389) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6382..7155) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(7159..7779) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(7814..9196) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287155.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9619..10134) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene tadA CDS complement(10291..10626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(10692..12038) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12149..12859) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13089..13520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 13517..14950 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(15000..15659) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15738..15968) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(16048..16716) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(16768..17607) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene dapF CDS complement(17591..18910) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene lysA CDS complement(18933..20087) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 20272..21153 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene dapA CDS 21221..21988 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene dapB CDS 21992..22705 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene dapD CDS complement(22775..24757) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene nagE CDS complement(24769..25605) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(25882..26832) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(26851..28182) product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(28192..28866) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(29118..29606) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(29596..31035) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(31160..32842) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33288..34748 product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene msr(C) CDS 34845..35228 product DUF1093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(35311..36366) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 36650..37111 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(37164..37763) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(37844..38692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(38745..38957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(38971..39177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(39285..39773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 39953..40765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(40837..41268) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(41441..41782) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 41976..43676 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene ilvD CDS 43793..43969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(44008..44637) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 44894..45496 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(45681..47954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(47951..48607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(48748..49590) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(49987..50337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(50401..50709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(50947..51270) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(51297..51557) product PbsX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080583835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(51663..52037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(52335..53075) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(53078..54097) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(54100..54858) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(54855..55583) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(55601..56347) product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(56362..57564) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(57709..57864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(58278..59420) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene wecB CDS complement(59431..60645) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(60638..61885) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(61882..62379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(62414..63862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(63864..64874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(64864..65007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(64970..65803) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(65815..66939) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene wecB CDS complement(66942..68051) product type 8 capsular polysaccharide synthesis protein Cap8F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene cap8F CDS complement(68048..69070) product type 8 capsular polysaccharide synthesis protein Cap8E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene cap8E CDS complement(69073..70299) product type 8 capsular polysaccharide synthesis protein Cap8L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene cap8L CDS complement(70289..71161) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(71158..71775) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(71787..73604) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(73617..74381) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(74399..75103) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(75117..75902) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(75919..76848) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(76877..77737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(78065..79228) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(79435..80205) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 80396..82111 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 82104..83855 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(83905..85083) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(85517..85837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(85842..86222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(86478..86855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(86873..88045) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137604701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(88159..89715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(89728..91251) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137604703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(91251..93047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(93108..93566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(94028..95380) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(95377..96906) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(97261..97782) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(98045..98773) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(98896..99510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(99682..101175) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene glpK CDS complement(101431..102315) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene rsmA CDS complement(102341..102919) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rnmV CDS complement(102919..103686) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 103935..104534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 104730..105779 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 105928..106344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 106359..106925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 106954..107169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(107246..108556) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(108735..109445) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(109589..110860) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(110875..111483) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(111546..112475) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(112778..113146) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 113426..114052 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(114083..114916) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene msrA CDS 115331..115939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(116057..116566) product DinB family glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene gst CDS complement(116774..117778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 sequence02 source 1..243188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1942..2343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(2713..3537) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene lgt CDS complement(3676..3870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(4382..5341) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(5670..7499) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(8224..9603) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(9628..11067) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(11051..12397) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 12582..13304 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(13889..14608) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(14611..15360) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene chbG CDS complement(15350..16624) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene celB CDS complement(17197..17406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 note possible pseudo, internal stop codon CDS 17472..17639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(17697..18176) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rlmH CDS 18539..19846 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(19885..20496) product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(20622..21077) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287838.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(21124..21441) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(21504..22223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(22373..23131) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(23128..24051) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(24048..24260) product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(24247..25380) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(25548..26237) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(26464..26829) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(26932..27306) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(27978..28934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052190403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(29100..29336) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 29451..30224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(30453..30701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(30800..31114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(31191..31634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(31678..31992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(32014..33351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(33336..33833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(33982..34320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(34324..34509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(34524..37178) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(37165..37383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(37380..38381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(38525..38827) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 39027..39824 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 39875..41017 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(41115..42506) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene sufB CDS complement(42580..43062) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(43049..44284) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(44281..45576) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene sufD CDS complement(45590..46363) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene sufC CDS complement(46552..47403) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(47424..48110) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(48103..49137) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(49520..49858) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(49840..50214) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(50211..51395) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 51394..51576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(51573..51809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 tRNA 51947..52019 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(52141..52770) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene upp CDS complement(52907..54145) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(54269..55084) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(55160..55831) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(55828..56547) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(56590..57600) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 57832..58227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(58277..58717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(58683..59249) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(59312..60787) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(60888..61559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 61689..62417 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(62459..64117) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(64121..64723) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(64839..65834) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(65888..67234) product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(67231..67461) product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(67600..69327) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene yfcC CDS complement(69577..70512) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(70646..70894) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(71127..72203) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene pepA CDS 72405..72746 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 72895..73236 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(73304..74710) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene pepV CDS 74896..75720 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(75781..77643) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(77872..78747) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(78848..80620) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene aspS CDS complement(80675..81973) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene hisS CDS 82455..82880 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 83008..83178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(83270..83869) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 84191..85072 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 85096..86709 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(86750..87160) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene arsC CDS complement(87247..87810) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(87956..88540) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192732268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(88586..89326) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene truA CDS complement(89343..89921) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(89896..90621) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(90748..91107) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rplT CDS complement(91174..91374) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rpmI CDS complement(91484..92005) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene infC CDS complement(92253..92774) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(92863..94194) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 94462..95091 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(95092..95997) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(96103..96762) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 97032..97967 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene mvk CDS 97960..98949 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene mvaD CDS 98946..100043 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288233.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 100027..101064 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene fni CDS complement(101116..101919) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(101952..102794) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene kduI CDS complement(102805..103812) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(103813..104460) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(104562..105329) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(105440..105916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(106063..108657) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene adhE CDS complement(108865..109131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(109169..109534) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene yajC CDS complement(109617..110759) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748618.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene tgt CDS complement(111241..112272) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene queA CDS 112415..113302 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(113408..114436) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(114938..115822) product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene eepC CDS complement(115838..116908) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(116929..118575) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 118893..120056 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 120062..120700 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 120697..121617 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 121622..122287 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(122339..124162) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(124384..127089) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(127313..127597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(127658..128026) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(128040..129161) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene alr CDS complement(129177..129527) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene acpS CDS complement(129647..131173) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(131589..132938) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(133019..134101) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 134306..136036 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(136079..136525) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(136576..137451) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(137420..137923) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(138024..138689) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(139072..140568) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 140807..141484 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 141489..142796 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(142859..143872) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(143884..144624) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(144638..145729) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(145719..146825) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(146834..147922) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(147919..148182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(148229..149563) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(149688..150389) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(150677..151633) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174124611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(151673..152068) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(152144..152746) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(152840..153925) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(153942..155009) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(155021..155548) product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(155568..156908) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene celB CDS complement(156955..157902) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(158107..159405) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(159424..160143) product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(160155..161000) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(161118..161741) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289751.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene udk CDS complement(161819..162499) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(162512..163228) product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 163523..164137 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 164330..164647 product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289744.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(164702..165706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(165843..166976) product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene anmK CDS complement(166973..167851) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(167848..168111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(168244..169542) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 169753..171195 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(171217..173331) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene pnp CDS complement(173552..173821) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rpsO CDS 174025..174900 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(174951..175847) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene murQ CDS 176108..176671 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene def CDS complement(176732..177247) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(177249..178085) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(178099..178797) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(178912..180024) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(180162..181073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 181235..181531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 182057..183655 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 183720..184463 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 184593..185939 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 186095..187447 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene brnQ CDS 187545..189047 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 189158..189949 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(190237..191886) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 192139..192705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 193030..193419 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(193440..194462) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(194575..194943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(195014..195481) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(195478..196050) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(196062..197069) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ruvB CDS complement(197082..197672) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ruvA CDS complement(197894..198640) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(198714..199277) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 199399..200286 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(200415..200852) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene msrB CDS complement(200881..201435) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(201439..203451) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene mutL CDS complement(203467..206019) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene mutS CDS complement(206003..206389) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(206408..207205) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 207362..207883 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene lepB CDS 207998..208159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(208201..209424) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene pepT CDS complement(209498..209920) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene mgsA CDS complement(210035..210676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(210710..211486) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(211515..212153) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 212407..213012 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene rpsD CDS 213171..213614 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(214089..214331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 214463..215008 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(215063..215335) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(215435..216100) product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(216140..216649) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(216811..217563) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(217560..217784) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 217996..218727 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(218776..219672) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(219676..220047) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(220096..220662) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(220669..222213) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 222353..222802 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 222820..223227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(223282..225534) product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene gshAB CDS complement(225792..226799) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene ftsY CDS complement(226815..227645) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(227646..231233) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene smc CDS complement(231255..231941) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene rnc CDS complement(232120..234690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(234715..235542) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(235535..236455) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(236472..237704) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(237718..238617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(238629..240329) product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 240464..241186 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 241222..241824 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 242049..242978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 sequence03 source 1..248055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(479..1972) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene lysS CDS complement(2078..3076) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene dusB CDS complement(3073..3960) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene hslO CDS complement(4108..6198) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene ftsH CDS complement(6272..6817) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287415.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene hpt CDS complement(6836..8218) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene tilS CDS complement(8499..8954) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(8999..9409) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287409.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(9477..9746) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(9752..11338) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(11382..14906) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene mfd CDS complement(15058..15627) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pth CDS 15941..16939 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 17135..18535 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(18578..19303) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(19407..19901) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 20020..21816 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(21915..23192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(23431..24129) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(24336..25649) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(25833..26339) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene mreD CDS complement(26343..27200) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene mreC CDS complement(27358..27993) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(27994..28644) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287380.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene rpe CDS complement(28646..29521) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rsgA CDS complement(29834..30430) product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(30884..31189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(31540..31881) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(31881..32138) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001748109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(32212..33375) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(33372..34568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(34676..36211) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(36333..37868) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(37945..39222) product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(39223..42870) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 43419..44936 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(45038..45286) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(45410..46351) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 46569..47075 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(47234..49015) product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene opp2A CDS complement(49037..49954) product oligopeptide ABC transporter permease Opp2C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene opp2C CDS complement(49970..50926) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(50928..51872) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(51873..52877) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(53130..53378) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene acpP CDS complement(53505..54509) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene plsX CDS complement(54628..56658) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene recG CDS complement(56774..58450) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(58495..58857) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 59115..59303 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rpmB CDS 59683..62271 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(62311..63063) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene truA CDS complement(63144..63941) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(63931..64797) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(64773..65612) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(65872..66252) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rplQ CDS complement(66333..67271) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(67351..67740) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rpsK CDS complement(67768..68133) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rpsM CDS complement(68301..68519) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene infA CDS complement(68710..69354) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(69418..70713) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene secY CDS complement(70713..71153) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene rplO CDS complement(71196..71375) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene rpmD CDS complement(71390..71890) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene rpsE CDS complement(71911..72267) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene rplR CDS complement(72323..72859) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rplF CDS complement(72891..73289) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene rpsH CDS complement(73325..73510) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(73529..74068) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rplE CDS complement(74097..74408) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rplX CDS complement(74445..74813) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene rplN CDS complement(74872..75138) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rpsQ CDS complement(75162..75350) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rpmC CDS complement(75340..75774) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rplP CDS complement(75777..76433) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene rpsC CDS complement(76447..76794) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rplV CDS complement(76815..77093) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rpsS CDS complement(77136..77966) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rplB CDS complement(78004..78291) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rplW CDS complement(78291..78914) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rplD CDS complement(78944..79573) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rplC CDS complement(79600..79908) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rpsJ CDS complement(80215..80754) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(80757..81575) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene thiD CDS 81720..83141 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387088.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(83202..84389) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene tuf CDS complement(84539..86623) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene fusA CDS complement(86709..87179) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rpsG CDS complement(87248..87661) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rpsL CDS 87981..88655 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene rpiA CDS 88799..89383 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 89523..90209 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene gpmA CDS complement(90287..91087) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(91084..91965) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(92110..92814) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene deoD CDS complement(92828..93637) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(93977..95143) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene deoB CDS complement(95518..96471) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(96471..97622) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(97615..99186) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(99367..100473) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(100539..100934) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(100959..101621) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene deoC CDS complement(101633..102934) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(103061..104077) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(104224..104826) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(104831..105403) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 105582..106505 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene coaA CDS 106566..108131 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene guaA CDS complement(108199..109392) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(109419..109619) product DUF3173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(110115..110345) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(110342..110764) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 111296..111649 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(111993..113912) product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene tet(M) CDS complement(114289..115218) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(115235..116257) product bifunctional lytic transglycosylase/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(116254..118281) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(118278..120731) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(120715..121110) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(121181..122206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(122278..122778) product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(122840..123619) product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(123661..123882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(123879..124151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078056044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(124148..125332) product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene mobT CDS complement(125514..126917) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130244.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(126939..127712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(127722..128099) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(128120..128434) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(129260..129772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 note possible pseudo, frameshifted CDS complement(129769..130125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 note possible pseudo, frameshifted CDS complement(130118..131122) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(131224..131412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(131402..131971) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 132386..133408 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 133579..134211 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(134310..134618) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(134636..135292) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(135321..136220) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene gnd CDS 136444..137286 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(137356..139407) product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene ganA CDS complement(139423..141648) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(141694..142140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(142158..143462) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene celB CDS complement(143588..144625) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(144737..145876) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(145877..146971) product SagG family ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(146980..147921) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(147998..149125) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(149112..149756) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(149838..150533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 150670..153102 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(153150..153923) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(153920..154840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(154842..155177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(155179..155502) product PadR family transcriptional regulator LftR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene lftR CDS 155739..156998 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 157018..157374 product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 157407..157571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 tRNA 157647..157730 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(158032..158733) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(158951..160156) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(160225..161226) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(161407..161766) product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene comGG CDS complement(161738..162061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(162186..162395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(162478..162915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(162908..163243) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356991.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene comGC CDS complement(163240..164223) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene comGB CDS complement(164255..165196) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene comGA CDS complement(165389..166360) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(166456..167862) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene glmU CDS complement(168409..169227) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene purR CDS complement(169377..170210) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(170183..170863) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(170877..171821) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(172428..173636) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 173738..174127 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 174212..174601 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(174857..175819) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(176179..177525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(178524..179483) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 179686..180045 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(180246..181415) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(181941..182348) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene arsC CDS complement(182351..183433) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene arsB CDS complement(183443..184435) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene arsB CDS complement(184539..184862) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene arsD CDS complement(184936..186663) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene arsA CDS complement(186677..187042) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222021.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene arsD CDS complement(187020..187370) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 187631..187990 product Cd(II)-sensing metalloregulatory transcriptional repressor CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene cadC CDS 187987..190104 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(190325..191137) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 191299..192555 product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 192645..192842 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 192948..193997 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(194268..196880) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059153920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(196919..199636) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(199639..201708) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(201805..202266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(202340..202549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 note possible pseudo, frameshifted CDS 202681..203649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(204363..205430) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(205770..206540) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(206533..207468) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(207561..207734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(207763..209424) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(209439..210524) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene arsB CDS complement(210535..211593) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene arsB CDS complement(211685..213412) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene arsA CDS complement(213447..213824) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222021.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene arsD CDS complement(213799..214146) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(214334..215158) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 215377..215667 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 215715..216902 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(216994..217386) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene rpsI CDS complement(217402..217845) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rplM CDS 218247..219461 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731945.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 219561..220934 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene argH CDS complement(220981..221448) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(221543..222253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(223138..226788) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene rpoC CDS complement(226917..230534) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rpoB CDS 230934..231890 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(231943..232899) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene menA CDS complement(232911..233984) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(234204..235151) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 235409..237436 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 237526..237933 product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 237951..238499 product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 238519..239505 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 239669..240190 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(240301..241644) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene gor CDS complement(241702..242940) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(242955..243878) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(244040..246520) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(246527..246994) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 tRNA complement(247125..247200) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(247263..247338) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(247372..247447) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(247458..247543) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(247561..247632) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(247642..247714) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(247718..247801) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(247811..247885) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(247887..247961) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 sequence04 source 1..167216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 820..990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 1081..1719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 note possible pseudo, internal stop codon CDS complement(1798..3396) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 3737..4000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 note possible pseudo, frameshifted CDS 4366..5310 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 5307..6263 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 6260..7018 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 7029..7961 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(8008..9729) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene spxB CDS 9958..10902 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 11026..11298 product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 11298..11573 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 11706..11942 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene secG CDS 12124..12888 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 12888..15212 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene rnr CDS 15227..15688 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene smpB CDS 16000..16719 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene atpB CDS 16751..16963 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene atpE CDS 17182..17706 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene atpF CDS 17693..18238 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 18260..19816 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene atpA CDS 19831..20733 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 20760..22166 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene atpD CDS 22180..22602 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356559.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(22661..23323) product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 23563..23796 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 23894..25192 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene murA CDS 25206..25382 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 25792..26478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 26606..26884 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene yidD CDS 26901..27344 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 27401..28279 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 28482..29663 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 29746..30624 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 30625..31608 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 31589..32365 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 32365..33066 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 33070..33720 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 33866..34099 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 tRNA 34190..34273 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 34274..34348 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 34490..35479 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 35521..35676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 35663..36103 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 36133..36342 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene copZ CDS 36343..38511 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 38649..40709 product copper/silver-translocating P-type ATPase CopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene copB CDS 40931..41443 product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 41470..41757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(42096..42821) product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 42984..44165 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(44210..44413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 44592..45458 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(45492..46409) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 46501..46977 product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(47064..47465) product DUF4809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(47617..49347) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(49344..50051) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 50183..50686 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 50646..50984 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 50999..52417 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene ffh CDS 52476..52772 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(52840..54231) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(54426..55640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(55653..56531) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(56533..56913) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 57044..57631 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 57642..58163 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(58216..58770) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 58937..59212 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rpsP CDS 59224..59472 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 59632..59895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(59995..60795) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(60792..61898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(61921..63159) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 63345..65066 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene dnaX CDS 65083..65397 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 65422..66018 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene recR CDS 66066..66704 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene tmk CDS 66723..67052 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356367.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 67065..68012 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene holB CDS 68015..68833 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 68830..69183 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 69243..70112 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene rsmI CDS 70233..71351 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene dinB CDS complement(71402..72004) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene nrdG CDS complement(72033..74222) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene nrdD CDS 74504..75271 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 75261..77309 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 77435..78520 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 78539..79327 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 79401..80141 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 80154..81158 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(81209..82648) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene proS CDS complement(82976..84805) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 84989..85510 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 85663..85932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 tRNA complement(86056..86131) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(86270..86956) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(87048..87683) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 87907..88215 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rplU CDS 88243..88587 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 88600..88893 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rpmA CDS 89018..89902 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 89977..90522 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 tRNA 90671..90745 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 91223..91825 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 92084..94921 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 95134..95631 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 95724..96719 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 96760..97566 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 97587..98498 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 98659..99030 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 99128..99370 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 99506..100573 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 100739..101167 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 101157..101864 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 101930..103444 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 103645..104202 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene efp CDS 104220..104645 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 104638..105081 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene nusB CDS 105235..106089 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 106090..107427 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene xseA CDS 107471..107692 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 107689..108573 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 108588..109403 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 109432..109881 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 109897..111579 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene recN CDS 112081..112941 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 112962..113936 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 114117..114842 product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(115191..116147) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 116322..116690 product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 116795..117283 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene mraZ CDS 117305..118267 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene rsmH CDS 118269..118673 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene ftsL CDS 118674..120878 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 120896..121858 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene mraY CDS 121871..123256 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene murD CDS 123253..124344 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene murG CDS 124361..125413 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 125573..126892 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene ftsA CDS 126917..128155 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene ftsZ CDS 128168..128845 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 128860..129444 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene sepF CDS 129786..130568 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 130590..131348 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 131651..134443 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ileS CDS complement(134481..136004) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene zwf CDS complement(136010..136666) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(136783..138018) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 138265..138837 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(138903..139346) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 139513..140277 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene map CDS 140300..141214 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 141239..142423 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 142572..144638 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 144741..144902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(144952..145560) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 145744..149988 product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 150137..150841 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(150881..151513) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 151623..151910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 152020..152343 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 152445..153749 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 153746..154432 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 154575..155129 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene raiA CDS 155334..157844 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene secA CDS 158086..159108 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene prfB CDS 159222..159908 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene ftsE CDS 159901..160785 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ftsX CDS 160932..162380 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene cls CDS 162625..163479 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 163579..164499 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pstC CDS 164499..165383 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene pstA CDS 165396..166202 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene pstB CDS 166233..166991 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene pstB sequence05 source 1..16639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..766 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene phoU CDS 1008..2561 product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene liaX CDS 2647..2958 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 2958..3323 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(3381..3587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 3484..4419 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene hprK CDS 4432..5265 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene lgt CDS 5332..6351 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 6378..7274 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene galU CDS 7416..7862 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 7901..8539 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(8590..9690) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 9880..10881 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene ccpA CDS complement(10928..13342) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289443.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 13513..14424 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 14490..15383 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(15474..15881) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ndk CDS 16101..16322 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence06 source 1..29702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..1817 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 1817..3598 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 3710..4651 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene trxB CDS 4782..6509 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 6587..6880 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321425.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 7006..8256 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 8259..9317 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene thrC CDS 9314..10177 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene thrB CDS complement(10240..11091) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 11186..11614 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 11785..11961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 11995..12438 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 12597..13574 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 13601..15802 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 15802..16275 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ybeY CDS 16361..16654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 16670..17569 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene era CDS 17625..18404 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene recO CDS 18571..19770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 20330..21244 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene glyQ CDS 21246..23312 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene glyS CDS complement(23369..25231) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(25332..26006) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 26137..27849 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 27852..29621 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 sequence07 source 1..183273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..897 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(922..1614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(1611..2099) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 2489..3676 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 3789..3935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 4070..5905 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene lepA CDS complement(6000..7154) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(7170..7424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(7833..8411) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(8484..8951) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(8960..9271) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 9411..9683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 9665..9820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 9885..10412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 10415..10663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 10666..10848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 10915..11229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 11222..11992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 11976..12770 product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025480718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 12792..13688 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 13666..14046 product endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 14030..14302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 14305..14562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 14671..15090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 15145..15633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 15630..15848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 15845..16054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 16051..16437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 16437..16577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 16623..17018 product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 17015..17188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 17136..17324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 17324..17644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 17725..18138 product autolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 18480..19232 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene terS CDS 19225..20538 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 20551..22053 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 22058..23206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 23217..23438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 23444..23626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 23734..24321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 24324..25184 product capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112195514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 25202..25447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 25476..25868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 25865..26203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 26203..26535 product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 26535..26936 product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 26939..27406 product major tail shaft protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011527917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 27461..27901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 27911..28474 product bacteriophage Gp15 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 28475..31141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 31142..31972 product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 31981..33000 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 33001..34023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 34020..36017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 36303..36548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 36560..36859 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 36872..37882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 tRNA 37962..38037 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 38168..38839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 38836..39978 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(40012..40443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 41073..42035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(41925..42404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(42504..42770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(42781..43137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 43606..43746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 43768..44199 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(44846..45073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 note possible pseudo, internal stop codon, frameshifted CDS complement(45402..46928) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 47092..47610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 47651..48301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 48310..48618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 48605..50734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 52077..52454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 52728..53705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 53702..54298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 54411..55307 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 55311..56045 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(56119..57099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(57207..57908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(57975..58853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(58850..60049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(60046..61155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 61436..61930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 61941..62624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 62912..65605 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 65725..66159 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(66202..66648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(66757..67287) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 67440..67922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(67974..68570) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(68671..70131) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 70307..70852 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene lepB CDS 70982..74521 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 74514..78191 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene addA CDS 78256..78579 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 78913..79956 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene pheS CDS 79963..82383 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene pheT CDS complement(82446..83456) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene trpS CDS 83736..84467 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 84479..85291 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 85294..85941 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 85957..86613 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 86788..87594 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene racE CDS 87594..88934 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene rph CDS 88936..89448 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 89561..90058 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 90129..90626 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(90703..91617) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(91723..92478) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene fabI CDS 92769..93209 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene fabZ CDS complement(93267..94007) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 94176..95267 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(95332..96342) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene gap CDS 96541..97080 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 97073..98413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 98579..99892 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene obgE CDS 100038..100622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 100712..101644 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene rnz CDS 101660..102445 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002332402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 102455..102820 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 103045..105345 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene recJ CDS 105358..105870 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(105945..106160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(106282..106902) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene lexA CDS 107040..107282 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 107364..109358 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene tkt CDS 109574..110434 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 110539..111471 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene cysK CDS 111621..112073 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 112051..112437 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 112568..113266 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 113266..113919 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene nth CDS complement(113964..116282) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(116286..116918) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene recU CDS 116982..117524 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 117610..118029 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene gpsB CDS 118777..119952 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 119958..121457 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 121491..122129 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 122254..122613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 122625..122837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(122903..123223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 123340..124488 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 124549..125892 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(125967..126281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, internal stop codon CDS 126463..127515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 127826..130465 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene alaS CDS 130655..131803 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 131824..133287 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene cls CDS complement(133267..133683) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 133747..134169 product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 134328..135998 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 136216..136638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 136622..137302 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 137329..137796 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene lspA CDS 137789..138706 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 138956..139495 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene pyrR CDS 139508..140842 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 140793..141719 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 141739..143022 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 143019..144116 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 144095..147277 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene carB CDS 147365..148144 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 148144..149064 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 149061..149780 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene pyrF CDS 149777..150406 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene pyrE CDS 150507..151139 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 151157..151843 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 151850..152758 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(152755..154464) product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene efbA CDS complement(154513..154911) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 155128..155703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 156036..157052 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene trpX CDS 157053..157940 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 157937..158701 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 159083..159946 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene aroE CDS 159966..160991 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene aroF CDS 161020..162084 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene aroB CDS 162086..163252 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene aroC CDS 163265..164356 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289140.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 164372..165658 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene aroA CDS 165660..166169 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 166166..166996 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene pheA CDS 167100..168233 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 168316..169164 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 169360..169839 product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 169852..172077 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 172136..172732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 172778..173584 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene proC CDS 173603..174790 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene iadA CDS 174907..175953 product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 175950..176870 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 176881..177255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 177376..178101 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 178091..178765 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 178778..180634 product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(180720..180968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 181132..181914 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(182013..182420) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(182417..182656) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289715.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 sequence08 source 1..158268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..1454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1764..1964 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 2093..2392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 2550..5318 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 5450..5944 product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 5963..7153 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 7196..8494 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene asnS CDS 8697..8918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 9087..10235 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 10225..10956 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 10953..12125 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 12141..15455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 15539..19003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 19007..19960 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 19971..20918 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(21048..21197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 21769..22767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 23421..25358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 25507..27468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 27544..28914 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mltG CDS 29024..29506 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene greA CDS 29642..30373 product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene liaF CDS 30370..31467 product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene liaS CDS 31442..32071 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 32152..32817 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 32833..33147 product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 33223..34182 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(34197..35141) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(35220..36020) product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 36174..36629 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 36705..37313 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 37383..37853 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 37937..38137 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 38292..38690 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene tagD CDS 38816..39865 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641921.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 39911..40720 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 40945..42063 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 42370..44511 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287654.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 44658..44942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 44943..47006 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 47127..49001 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 49014..49958 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 50017..50496 product trimethoprim-sensitive dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene dfr CDS complement(50546..51199) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 51328..52170 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 52352..53245 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 53245..53886 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288396.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 53959..54480 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene msrA CDS 54473..54694 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 54875..56305 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 56343..56888 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene lepB CDS 56961..57827 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene ylqF CDS 57817..58584 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 58646..59512 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene dprA CDS 59643..61721 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene topA CDS 61793..63085 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene trmFO CDS 63259..64158 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene xerC CDS 64244..64789 product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene hslV CDS 64804..66201 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene hslU CDS 66220..67011 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene codY CDS 67024..67899 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(67964..68599) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene plsY CDS 68706..69131 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 69291..71321 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138821006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene parE CDS 71333..73798 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene parC CDS 74066..76312 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene pflB CDS 76404..77183 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene pflA CDS 77273..78199 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 78269..79072 product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 79180..79617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(79660..80265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(80389..80931) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 81142..81489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 81877..83820 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene glgB CDS 83801..84964 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 84954..86099 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene glgD CDS 86101..87537 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene glgA CDS 87616..90030 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 90027..90272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 90253..91827 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 91896..92666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(92703..92987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(93004..93537) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 tRNA complement(93923..94007) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 94065..94235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 94337..95554 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(95751..95936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357816.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 96072..96902 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381942.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 96979..98127 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene nagA CDS 98282..98983 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 98991..102401 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(102472..103071) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 103235..104137 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(104246..105199) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016628808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 105345..105863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 105955..106662 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 106670..107293 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 107312..107995 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 108249..108830 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 108831..110141 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 110302..110790 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene purE CDS 110783..111904 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene purK CDS 111919..113214 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene purB CDS complement(113315..115351) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(115469..115852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 116120..116854 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 116845..117099 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene purS CDS 117101..117781 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene purQ CDS 117778..119997 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene purL CDS 119982..121421 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene purF CDS 121434..122480 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene purM CDS 122489..123070 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene purN CDS 123051..124586 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene purH CDS 124609..125865 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene purD CDS 126047..126961 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 127156..128142 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene guaC CDS 128284..129381 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene wecB CDS complement(129433..130914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 131490..134084 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene mgtA CDS 134468..135577 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene pdhA CDS 135580..136557 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 136593..138200 product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 138208..139614 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene lpdA CDS 139722..139997 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 140002..140775 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 140910..142751 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene typA CDS 143077..143379 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 143383..144552 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 144574..147996 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 148015..149133 product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 149130..149561 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 149551..149889 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 149974..150528 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rsmD CDS 150530..151024 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene coaD CDS 151014..152045 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 152114..152506 product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 152519..152893 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 153207..153941 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 154053..156236 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 156233..156697 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 156834..158165 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene murC sequence09 source 1..129355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 154..963 product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(969..1685) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1859..2560) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene nagB CDS complement(2717..2905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(3000..4094) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(4095..5288) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(5298..6221) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene metA CDS complement(6653..7018) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rplL CDS complement(7079..7582) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene rplJ CDS complement(7839..8528) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356425.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rplA CDS complement(8632..9054) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene rplK CDS complement(9026..9199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 9338..10003 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene sdaAB CDS 10015..10890 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene sdaAA CDS complement(10988..12091) product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(12159..13034) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(13117..13659) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene nusG CDS complement(13761..13931) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene secE CDS complement(13943..14095) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene rpmG CDS 14239..14880 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene cbpA CDS complement(14930..15439) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(15514..15774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 16268..17236 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(17332..19863) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(19878..20534) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(20548..21051) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene trmL CDS complement(21298..22137) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 22212..22853 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(22910..24691) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(24678..26429) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 26542..27390 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(27424..28791) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene mgtE CDS complement(28807..29706) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(29703..30503) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(30509..31177) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 31403..31972 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 32062..32706 product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(32757..34571) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene pepF CDS complement(35994..36638) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(36853..37251) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene spxA CDS complement(37904..39619) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 39939..40652 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(40881..41033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(41217..44396) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(44452..47562) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(47544..48686) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(48789..49415) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 49549..50283 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 50273..50587 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(50601..51164) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene efp CDS complement(51239..52192) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 52278..52934 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(52989..53876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(53961..54869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(55077..56696) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(56727..58481) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(58478..59446) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(59488..60312) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(60312..61175) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(61241..62551) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 63211..64593 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene brnQ CDS complement(64671..65594) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(65622..66560) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(66710..67006) product phenylalanyl-tRNA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(67138..67269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(67276..67689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(68107..69513) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 69708..70445 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene nfsA CDS complement(70886..71071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 71689..72039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(72097..72993) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(73006..73665) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(73674..74453) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(74428..75363) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(75490..76338) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(76450..77883) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(77905..79311) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 79535..80449 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(80505..82400) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(82538..83377) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 83854..84021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 84626..84811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(84984..85187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(85287..85868) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene lepB CDS complement(86072..86236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 86295..86588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(86699..86860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(87268..87846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 87877..88860 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(88910..89944) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(90141..90974) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene prmC CDS complement(90967..92040) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene prfA CDS complement(92055..92627) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(92724..93236) product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(93285..94034) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 94180..94650 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(94692..95132) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(95169..95564) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(95606..95863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(95919..96434) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 96778..98184 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 98324..99676 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 99669..100364 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 100494..101123 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(101159..101980) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(102031..104205) product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 104537..106801 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 106913..107929 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(107973..108920) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene manA CDS complement(109059..110072) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(110293..111249) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(111279..114584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(114604..116751) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(116765..117559) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365532.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(117540..118430) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(118417..118926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(119086..120693) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(120712..121593) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(121605..122516) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(122869..123510) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(123920..124657) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(124659..125909) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(125911..126192) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(126205..126636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(126633..128276) product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene manR CDS 128633..129226 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 sequence10 source 1..113386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..1105 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1095..2270 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 2566..3837 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene serS CDS 3950..5410 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(5475..6134) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 6372..6695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289230.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 6732..7940 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(8039..9523) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene guaB CDS complement(9635..11389) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene recQ CDS complement(11517..12209) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(12283..13383) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene ychF CDS complement(13392..13574) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(13703..14590) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(14580..15344) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(15426..16142) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene rsmG CDS complement(16349..16993) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(17218..18171) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(18158..18388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(18560..20452) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(20713..20946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 note possible pseudo, internal stop codon CDS 21241..21855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(21991..22548) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(22743..23453) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837175.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(23450..23980) product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene paiA CDS complement(23995..24447) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(24641..24910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(25043..25252) product DUF3955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(25757..25966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(26007..26453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(26473..26934) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(27231..29132) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene mnmG CDS complement(29183..30580) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene mnmE CDS complement(30854..32236) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene nhaC CDS complement(32308..33750) product tyrosine-tyramine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene tyrP CDS complement(33820..35688) product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene tdc CDS complement(35979..37235) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286405.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene tyrS CDS complement(37761..39614) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(39630..42035) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(42036..42488) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(42935..43675) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(43693..44511) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(44535..44879) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rnpA CDS complement(44999..45133) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene rpmH CDS 45670..46998 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene dnaA CDS 47305..48435 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene dnaN CDS 48657..48896 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene yaaA CDS 48883..49995 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene recF CDS 49996..51942 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene gyrB CDS 52056..54521 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene gyrA CDS 54719..55267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 55442..55741 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene rpsF CDS 55789..56328 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ssb CDS 56357..56593 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rpsR CDS 56766..58718 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 58715..59164 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene rplI CDS 59411..60772 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene dnaB CDS 60985..62277 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 62492..63361 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(63420..64406) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 64773..65696 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rbsK CDS 65706..66704 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 66705..67307 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 67309..68571 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 68626..69576 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 69573..70394 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 70438..71532 product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 71553..72821 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(72938..74560) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 74891..75709 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(75777..75971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 76172..76528 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026217689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(76578..77825) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(77828..78628) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene proB CDS 79177..79692 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 79716..81086 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene radA CDS 81145..82266 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 82489..83946 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene gltX CDS 84293..84823 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene cysE CDS 84820..86229 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene cysS CDS 86226..86630 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 86614..87459 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene rlmB CDS 87456..87998 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 88062..88625 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 88739..88984 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 89055..89486 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(89537..89977) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene mscL CDS 90148..91413 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 91406..92704 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 92710..93435 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 93458..94357 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 94437..95015 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene pgsA CDS 95159..96400 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 96508..97551 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene recA CDS 97871..99427 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene rny CDS 99875..102427 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene mprF CDS complement(102465..103181) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene treR CDS complement(103217..103867) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene pgmB CDS complement(103919..106531) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 106877..108865 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene treP sequence11 source 1..8403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..780) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 950..1801 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene ispE CDS complement(2125..3360) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 3454..4356 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836624.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(4452..4766) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(4781..5050) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 5377..7044 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 7019..7315 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 7675..8256 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene thiT sequence12 source 1..93828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..231) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(479..1852) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rlmD CDS complement(1938..2978) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(2990..4420) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene gatB CDS complement(4417..5889) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene gatA CDS complement(5889..6194) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene gatC CDS complement(6284..7381) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(7371..9404) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene ligA CDS complement(9420..11654) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene pcrA CDS 11879..13417 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(13458..14927) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 15159..15914 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 15911..16825 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene pfkB CDS 16911..18815 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(18855..19019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(19024..20352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 20496..20660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(20657..21256) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene yihA CDS complement(21328..22569) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357154.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene clpX CDS complement(22812..24095) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene tig CDS complement(24213..25181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(25263..25967) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296311.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(25969..26997) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene sppA CDS complement(27016..27306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 27689..29497 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene glmS CDS complement(29588..30943) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene glmM CDS complement(30962..32065) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(32062..32952) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene cdaA CDS complement(33068..33280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(33168..36815) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene nifJ CDS 37012..37545 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(37595..38527) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene whiA CDS complement(38543..39538) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(39535..40419) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene rapZ CDS complement(40545..41273) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(41277..42533) product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(42776..45595) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene uvrA CDS complement(45606..47597) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene uvrB CDS 47849..50002 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361277.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 50004..50741 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(50867..52042) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene dnaJ CDS complement(52173..54002) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene dnaK CDS complement(54048..54593) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene grpE CDS complement(54641..55681) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene hrcA CDS complement(55841..57013) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene hemW CDS complement(57233..57985) product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene lieB CDS complement(57969..58868) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(58876..59478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(59786..60148) product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene adhR CDS complement(60317..61249) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene cysK CDS complement(61701..62639) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene ribF CDS complement(62709..63623) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene truB CDS complement(63770..64117) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene rbfA CDS complement(64139..66814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(66827..67105) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(67122..67418) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(67441..68625) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene nusA CDS complement(68647..69120) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rimP CDS complement(69636..70031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(70139..72082) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287651.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene thrS CDS complement(72427..72606) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(72777..73340) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(73358..75145) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(75234..76109) product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 76225..78495 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene helD CDS complement(78542..79207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 79477..79767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(79815..80534) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(80632..81795) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(81877..83316) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(83509..84243) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(84839..85429) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene yqeK CDS complement(85419..86060) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(86078..86389) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene yhbY CDS complement(86404..87513) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene yqeH CDS complement(87506..88036) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(88145..89047) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 89136..90728 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(90799..91248) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(91518..92645) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 tRNA 93405..93475 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 93614..93745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 sequence13 source 1..83381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(362..982) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1025..2689) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(2788..3288) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(3440..4906) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(4899..5390) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(5521..5964) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene dtd CDS complement(5971..8175) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(8274..8933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(8939..9691) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(9694..10638) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene prmA CDS complement(10684..11166) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(11159..11788) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 11951..13249 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 13662..13934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 14007..14477 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 14626..15147 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(15469..16929) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(17251..17598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 17788..19401 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 19501..20010 product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene yraA CDS 20204..20830 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(20885..22102) product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(22102..23283) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(23270..24358) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene serC CDS complement(24533..24835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(24850..26376) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(26673..26972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(27010..27582) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(27672..28175) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 28368..28895 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 29042..29452 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(29554..29808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(29965..30834) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(30910..32280) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene gntK CDS complement(32360..33778) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(33835..35142) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(35383..36072) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 36458..36940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 36950..37165 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(37211..38479) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene celB CDS complement(38736..39449) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(39576..39893) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(39899..40222) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(40237..41655) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(41870..42517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(42671..44170) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(44346..46814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(46789..47121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(47132..48058) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(48228..48911) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(49091..49720) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene trmB CDS complement(49800..50579) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(50708..51919) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(51912..52655) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 52798..53223 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 53224..53598 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 53710..54720 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(54825..57371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(57368..57715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(57718..58755) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(58832..59506) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(59581..60480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 61038..61877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(61904..62848) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(62845..65451) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(65448..66635) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(66786..67127) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(67175..69325) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 69524..70375 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(70453..71478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(71658..72407) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(72463..74103) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 74444..76171 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene ade CDS 76323..77813 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(77873..79984) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(80156..82570) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene leuS misc_feature complement(82869..>83381) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285913.1:LysM peptidoglycan-binding domain-containing protein locus_tag LOCUS_15610 sequence14 source 1..9132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1226..1873 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1889..2854 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 2848..3402 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285906.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(3455..4237) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(4249..5727) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(5857..7053) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene metK tRNA complement(7231..7304) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(7329..7404) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(7418..7488) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(7502..7576) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(7580..7655) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(7695..7770) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(7845..7934) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(7946..8019) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(8027..8116) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(8148..8221) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(8234..8304) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(8306..8382) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(8424..8499) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(8573..8662) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(8683..8758) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(8776..8851) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(8883..8955) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(8970..9043) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(9059..9132) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence15 source 1..80256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 953..1294 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1278..1715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 2006..2503 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 2943..3227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 3227..3403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 3745..3924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 4795..5292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(5513..6373) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(6649..6954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 7253..8653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 8653..9555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 9530..10648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 11900..12721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 12721..13455 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 13602..13910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(14874..15200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(15213..15620) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(16771..17478) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(17793..18095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(18125..18661) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 18763..19557 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 19720..21279 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 21357..22316 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 22320..23156 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 23149..24033 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 24026..24916 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 24916..25302 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 25463..26134 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 26399..27733 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 27726..30023 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 30155..31123 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 31363..32760 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 33027..34535 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(34755..35147) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(35304..36659) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 36906..37598 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024797200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 37600..38544 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 38555..39205 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene pcp CDS complement(39251..40435) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(40470..41411) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 41646..42242 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 42258..44684 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 44826..46064 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 46285..47391 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(47439..47918) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 48013..48987 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755022.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 49910..51022 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene xerS CDS complement(51298..51531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(51693..52241) product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131759.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(52254..52781) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(53089..53538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(53596..53937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(54311..55399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(55401..55931) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(56080..57123) product D-alanine--(R)-lactate ligase VanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene vanB CDS complement(57152..58255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(58397..59743) product VanB-type vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene vanS CDS complement(59740..60402) product vancomycin resistance response regulator transcription factor VanR-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene vanR CDS complement(60371..60601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 60850..61440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(61494..62375) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(62375..62797) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(62975..63691) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(63889..65640) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 65907..67169 product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(67941..69134) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(69342..69617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(69898..70917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(70973..71974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(72370..73557) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene trpB CDS complement(73899..74432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(74845..75063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(75082..76212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(76216..76590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(76694..77089) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 77219..77947 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 78126..79409 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(79498..79839) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 sequence16 source 1..69884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..894) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1208..3121 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 3308..3601 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(3721..4881) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(4891..5244) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 5362..6384 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 6397..6747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 6772..6933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(6990..8489) product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene eat(A) CDS complement(8739..9095) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(9377..9805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(10287..12968) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(13328..15334) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene metG CDS 15505..15780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 15848..16678 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(16844..17779) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(17796..18749) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(18822..19868) product oligopeptide ABC transporter ATP-binding protein Opp1D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene opp1D CDS complement(19874..20914) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(20914..21855) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 21942..22286 product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(22366..24033) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(24504..25055) product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene aac(6') CDS complement(25194..26261) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rlmN CDS complement(26383..28215) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383725.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(28205..28954) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(29175..31544) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(31700..32506) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(32503..33153) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(33180..33821) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 34317..34799 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(34840..35598) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 36376..38370 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 38499..38702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(38832..41195) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 41531..42640 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ugpC CDS complement(42732..43058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(43174..44688) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(44896..46461) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(46412..46864) product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(46854..47780) product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286024.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(47750..48637) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(48627..49958) product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(49974..51074) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(51110..51730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(51746..52705) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 52990..53880 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(53929..56142) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 56328..57317 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 57384..58832 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 58805..60325 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 60408..61796 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene uxaC CDS 61814..62527 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 62561..63256 product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 63243..64082 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 64098..65855 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(65903..67972) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(67905..68282) product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 68486..69784 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 sequence17 source 1..1112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..1051) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene nrdF sequence18 source 1..65258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..2465) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene nrdE CDS complement(2568..2792) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene nrdH CDS 3154..3618 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 3621..5774 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene feoB CDS complement(5959..6816) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(6809..7363) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(7725..8057) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(8133..8435) product MazG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 8753..9346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 tRNA complement(9485..9559) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 9920..10624 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene yycF CDS 10632..12458 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene walK CDS 12455..13753 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene yycH CDS 13754..14605 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 14654..15460 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(15503..16132) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(16211..16843) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 17076..17360 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene groES CDS 17383..19008 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene groL CDS 19128..19475 product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 19616..19888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 19899..20819 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(20913..21680) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 21832..22197 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 22372..23856 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 23853..24680 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene nadE CDS 24913..26724 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(26774..28420) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(28422..29258) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(29310..29780) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene nrdI CDS 29954..31387 product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 31486..32058 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(32095..32613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287073.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(32638..33507) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 33641..34321 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 34478..35461 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene pta CDS 35573..36046 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene tsaE CDS 36039..36563 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(36621..37154) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(37227..37985) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 38070..38981 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 39047..39946 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene murB CDS complement(40013..40657) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(40662..41216) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene coaC CDS complement(41213..41971) product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(41980..42960) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 43223..43765 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 43782..44864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 44877..45692 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 45689..46525 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 46522..47595 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 47813..48280 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(48353..49462) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene ald CDS complement(49593..50264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(50424..52358) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 52623..53270 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(53318..53662) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 53971..54867 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287744.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 54933..55778 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287743.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 55875..57758 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene asnB CDS 57847..59022 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene argJ CDS 59038..60171 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 60308..60574 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 60574..61005 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296503.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene ruvX CDS 61031..61348 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 61595..62110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 62334..63143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297190.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 63295..63819 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene rimM CDS 63809..64555 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene trmD CDS 64689..65036 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene rplS sequence19 source 1..63010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..405) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene trxA CDS complement(491..2851) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(2927..3475) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295088.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(3492..3932) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene zapA CDS 4125..5036 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene rnhC CDS complement(5094..6548) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 6701..7798 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 8099..8620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(8742..9428) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(9432..10508) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(10858..11250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 11416..11760 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 11750..12139 product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889650.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 12289..13851 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 13864..14292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(14289..14912) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(15038..15349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(15364..15714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 15961..16833 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 16938..17486 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(17615..19105) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene xylB CDS complement(19118..19951) product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene araQ CDS complement(19951..20865) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(20925..22244) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(22260..23867) product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene xynB CDS complement(23880..25187) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774172.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene xylA CDS 25370..26521 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(26588..27793) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(27812..28660) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(28675..29355) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(29355..30425) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(31156..33156) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 33288..34094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(34137..35057) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 35195..37444 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene metE CDS 37446..38318 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene metF repeat_region 38378..38941 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttggaagcattcaaaacagcatagctctaaaac CDS complement(39068..39733) product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene csn2 CDS complement(39720..40046) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene cas2 CDS complement(40058..40924) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene cas1 CDS complement(40925..44932) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene cas9 CDS complement(45585..47459) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(47741..50146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(50795..51658) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461681.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 51838..52188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 52395..53237 product Rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 53259..53534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 53629..54852 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(54884..55147) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(55246..56541) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene rho CDS complement(56538..57794) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(57965..58834) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(59156..60763) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(61010..62350) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene glnA CDS complement(62388..62762) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 sequence20 source 1..57729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..571 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 834..1181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1285..1821 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1954..3531) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(3725..5098) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(5202..6335) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 6462..6893 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(6932..7921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(8060..8593) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(8685..9839) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene mutY CDS complement(9832..10629) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene recX CDS 10736..12112 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene rlmD CDS complement(12120..12317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(12416..16771) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(16883..18601) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(18641..19909) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene rseP CDS complement(20056..20853) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(20853..21653) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(21804..22361) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene frr CDS complement(22364..23086) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356761.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene pyrH CDS complement(23219..24100) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene tsf CDS complement(24215..25012) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293880.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene rpsB CDS complement(25662..25889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(25889..26539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 26725..27027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(27723..27863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(28417..30822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(30882..31157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(31161..31823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(31824..32066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(32063..32644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(32641..32886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(32879..33097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(33094..33534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(34257..35144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(36034..36801) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099479831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(36887..37009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(37428..37661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 37906..38376 product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(38424..40115) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene argS CDS complement(40567..41511) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene arcC CDS complement(41628..42647) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene argF CDS complement(42724..43956) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene arcA CDS 44436..45107 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(45226..46233) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene tsaD CDS complement(46230..46700) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene rimI CDS complement(46693..47235) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene rimI CDS complement(47219..47932) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene tsaB CDS complement(48047..49033) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(49046..50524) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene galT CDS complement(50540..51529) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene galE CDS complement(51608..52768) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 52912..53079 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(53102..54901) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(54898..55251) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(55351..55749) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(55765..56730) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(56737..56943) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(57134..57499) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 sequence21 source 1..41108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 85..160 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 288..638 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(691..1308) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1395..2369) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2523..3164 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 tRNA complement(3657..3731) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 3891..3966 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(4072..5430) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(5432..5815) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 5986..7002 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 7111..8439 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 8564..9298 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(9358..10326) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 10417..11247 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 11256..12095 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 12107..12619 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(12642..13991) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 14326..16047 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 16191..17333 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 17437..18636 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene thiI CDS 18787..19443 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 19549..20046 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene tpx CDS 20379..23024 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 23130..23711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 23701..23850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 23960..25279 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 25272..25943 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 26005..26691 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene radC CDS 26835..27035 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(27097..27555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(27719..27943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(28010..29689) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(29691..29903) product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 30259..31992 product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene efrA CDS 31989..33755 product multidrug efflux ABC transporter subunit EfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene efrB CDS 33923..34873 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(34988..35581) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene clpP CDS 36227..36739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 36886..37632 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 37629..38546 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene miaA CDS 38543..39787 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene hflX CDS 39771..41030 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence22 source 1..37867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..831) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 1634..3400 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 3421..3900 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 3911..4807 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 4794..5603 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 5618..6019 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(6140..7054) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 7298..8578 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 8801..9718 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 9732..10577 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 10586..11017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 11230..13035 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 13127..14896 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 15145..15357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(15798..16232) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 16464..17216 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 17223..18410 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 18442..18942 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 18956..19786 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 19776..20591 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 20706..22628 product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 22644..23486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 23659..24018 product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(24181..26025) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 26145..26984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 27000..28679 product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(28731..29786) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 29971..30366 product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 30369..32177 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 32187..33338 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 33379..34659 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(34665..34910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 34909..35667 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 35679..36542 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 36574..37242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 37432..37860 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 sequence23 source 1..37233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..1974 product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002341496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2076..2789 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2782..3105 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 3116..3979 product virulence factor B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 4094..4576 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 4721..5611 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene xerD CDS 5626..6384 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 6371..6967 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene scpB CDS 7409..7591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 7518..8240 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 8581..9177 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 9637..11160 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 11304..12644 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(12720..12941) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 12975..13991 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 13984..15369 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 15443..16051 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 16134..16814 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene cmk CDS 16989..18203 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rpsA CDS 18399..19709 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene der CDS 19952..20227 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 20453..21319 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379188.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 21452..22843 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(22899..23483) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 23733..24002 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene rpsN CDS 24125..25162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 25171..26430 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 26590..27030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(27107..28006) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 28132..28509 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 28496..29707 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 29704..30063 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 30141..30593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 30784..30933 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rpmG CDS complement(31071..31997) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 32174..32977 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 32964..33947 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 33944..34921 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 35003..35542 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 35554..36255 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(36311..36943) product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 sequence24 source 1..29682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(757..1605) product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1612..2274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2366..4249) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(4583..5935) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(6065..6694) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(6696..8078) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292842.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(8071..9852) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(9868..10179) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(10169..11164) product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(11175..11753) product V-type sodium ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(11870..12340) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(12337..14316) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(14306..14626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(15097..16359) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(16360..17505) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 17662..18762 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(18972..20507) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene ahpF CDS complement(20520..21083) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene ahpC CDS 21348..21620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(21666..22415) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(22426..23052) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 23255..24604 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(24629..25369) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386601.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(25353..26363) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(26380..27363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(27356..28207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(28345..29394) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 sequence25 source 1..27634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1216) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene mnmA CDS complement(1365..1970) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(1983..2831) product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene yeaE CDS complement(2944..3285) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(3369..4511) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 4735..4926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(4841..5845) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(5862..6692) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(6676..7455) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(7448..8293) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(8298..8768) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(8782..9201) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(9275..12049) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(12223..13194) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(13303..13845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 14051..14587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 14724..16628 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(16689..16988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(17054..17596) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(17664..18359) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(18391..18684) product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene macP CDS complement(18689..19252) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 19458..20114 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286764.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 20203..21399 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286766.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(21450..22823) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(22855..23721) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(23811..24836) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(24846..25520) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(25649..25855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(25912..27414) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922400.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 sequence26 source 1..22208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..1338 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969590.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 1335..1691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(1736..2665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 tRNA complement(2816..2891) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2989..4170) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(4212..4625) product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(4622..4810) product DUF3188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(4833..5054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(5172..6608) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286601.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(6720..7040) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(7077..7400) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(7529..10249) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(10312..11583) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(11595..12599) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(12615..13340) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318601.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene sfsA CDS 13471..13833 product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 13944..14090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 14296..15600 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(15661..16017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 16286..17485 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(17520..18146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(18238..18741) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(18856..19626) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 19736..20014 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 20123..21049 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene yidC CDS 21171..22112 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 sequence27 source 1..22133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(679..1413) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(1427..2116) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2132..2971) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(3202..3987) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(3984..4850) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene accD CDS complement(4862..6220) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(6228..6656) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene fabZ CDS complement(6660..7139) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene accB CDS complement(7136..8377) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene fabF CDS complement(8393..9130) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene fabG CDS complement(9140..10060) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene fabD CDS complement(10176..10400) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(10455..11426) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(11423..11863) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 12125..13045 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(13135..13365) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(13463..14326) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(14399..15631) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(15647..16633) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(16626..16841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(17154..18881) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ptsP CDS complement(18881..19147) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(19123..19353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(19313..19504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 19884..21986 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 sequence28 source 1..21573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..833 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 826..1515 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 1671..4310 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene polA CDS 4324..5154 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mutM CDS 5157..5747 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene coaE CDS 5834..6160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 6379..6858 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene nrdR CDS 6876..8243 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 8243..9166 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene dnaI CDS 9182..9604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 9739..10443 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 10440..11558 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 11570..12799 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene pepT CDS 12957..13229 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 13239..14282 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 14412..17012 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356811.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene clpB CDS 17157..18698 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 18695..19666 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 19653..20978 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 20991..21458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 sequence29 source 1..19618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1409) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene eno CDS complement(1527..2282) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene tpiA CDS complement(2349..3539) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(3654..4655) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene gap CDS complement(4697..5734) product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(5954..7273) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene rpoN tRNA 7327..7400 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(7626..8231) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene rpoE CDS complement(8307..8738) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 8889..9704 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 9877..11247 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 11257..12072 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene yidA CDS complement(12134..12577) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 12743..13117 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 13141..13845 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(13910..15163) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(15156..16055) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(16072..16734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(16712..17047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(17050..17247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(17189..19312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 sequence30 source 1..14914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 1117..1836 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 1935..3587 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 3591..3809 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 3889..4773 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 4830..5111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305543.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 5294..5908 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene gmk CDS 5913..6218 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene rpoZ CDS 6444..8846 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287367.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene priA CDS 8858..9349 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene def CDS 9342..10295 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene fmt CDS 10288..11643 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene rsmB CDS 11659..12399 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 12396..14531 product serine/threonine protein kinase IreK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene ireK sequence31 source 1..13919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1242) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene rpoD CDS complement(1259..3118) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene dnaG CDS complement(3342..4178) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(4306..4932) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(5128..6315) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene tuf CDS 6559..6915 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(6961..7965) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 8156..8797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(8915..11311) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 11495..12646 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 tRNA complement(12788..12875) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(12905..12975) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(13011..13084) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(13089..13162) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(13194..13267) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(13269..13351) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(13352..13427) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(13458..13533) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(13543..13617) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(13629..13702) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(13709..13797) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(13843..13918) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 sequence32 source 1..12202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..376 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 816..1196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 note possible pseudo, frameshifted CDS complement(1490..2104) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2118..3080) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene kdgK CDS complement(3084..4232) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene dgoD CDS complement(4248..7301) product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene lacZ CDS complement(7320..8138) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(8140..8991) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(9065..10345) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(10454..11161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(11173..12141) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 sequence33 source 1..7352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(690..1583) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(1748..2071) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 2237..2467 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2486..3046 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 3191..3721 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 3845..4603 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 4596..6182 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 6260..6919 product type A-8 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene catA sequence34 source 1..6986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(548..1990) product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene gtfA CDS complement(1981..3402) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(3405..4703) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355207.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene genB CDS 4815..5540 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 5693..6535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 note possible pseudo, internal stop codon sequence35 source 1..6954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1541 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(1649..2398) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2395..3018) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(3029..3946) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(3967..5235) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(5248..5529) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723138.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(5526..5969) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(5990..6742) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 sequence36 source 1..3269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(195..3107) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence37 source 1..1772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(31..1586) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence38 source 1..2688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1978) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene ltrA sequence39 source 1..1806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 14..697 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 688..1596 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130