COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..533369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(614..1315) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1326..2276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2292..3554) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3702..4172) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383688.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4241..6412) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6571..7029 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7104..8075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8252..10618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 10733..11236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(11501..12364) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(12398..13072) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(13062..14135) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(14172..14942) product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 15642..15797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(16088..18667) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene gyrA CDS complement(18712..20658) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene gyrB CDS complement(20682..21821) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene recF CDS complement(21821..22054) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene yaaA CDS complement(22251..23381) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene dnaN CDS complement(23583..24995) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene dnaA CDS 25687..25821 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene rpmH CDS 25931..26287 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene rnpA CDS 26314..27147 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene yidC CDS 27098..27265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 27289..27918 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene lepB CDS 28334..29137 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(29286..29972) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(29959..30900) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(30909..31769) product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene isdE CDS complement(31776..32561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(32566..34140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(34616..37039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 assembly_gap 34628..34725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37247..37915 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 38206..39567 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(39955..40479) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 40657..41493 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 41884..42081 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene thiS CDS 42098..42748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 42759..43529 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 43543..44730 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene allC CDS 44732..45250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 note possible pseudo, internal stop codon CDS 45266..45958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 note possible pseudo, internal stop codon CDS complement(45986..46390) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 46482..47216 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47238..48248 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 48303..48872 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(48927..50681) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 50871..51020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(51117..51986) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(52427..52906) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rlmH CDS 53642..54985 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 55023..55841 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(56073..56771) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 56899..57270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 57280..57987 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 57987..58700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(58757..59440) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 59704..61011 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(61232..62227) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(62243..63391) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(63612..64574) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 64714..65310 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(65412..67010) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 67457..67639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 67632..68729 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 68881..69486 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(69578..70174) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 70597..71769 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 71789..72781 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(72843..73346) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(73429..74355) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(74371..75303) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 75529..76881 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(77074..77670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(77674..78129) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 78316..79251 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 79352..80041 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(80110..80349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(80365..81780) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(81967..83097) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 83324..84103 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84183..85712 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(85783..86136) product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(86081..87055) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(87069..87629) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 87841..89184 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene guaD CDS 89235..90575 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 90802..92154 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(92248..92937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 93445..94575 product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 94674..94931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 95062..95571 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 95682..96869 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 97027..97782 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(97889..98563) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 98800..99309 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 99327..100382 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 100385..101059 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 101258..102427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 102446..103612 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(103911..105221) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 105395..106237 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene proB CDS 106215..107465 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 107952..108626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(109164..110717) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene guaA CDS 111016..112095 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 112277..112951 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 112982..114421 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rlmD CDS 114559..115119 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 115181..116872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 116876..117700 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 118071..119441 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 119461..120621 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 120640..121569 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(121669..122526) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 122684..123265 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(123305..124057) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(124063..124764) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 125182..125994 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 126081..126356 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 126451..127347 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 127601..128752 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 128852..130297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 130365..130775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 131045..132394 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 132463..133356 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 133371..133586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 133867..134616 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 135058..135243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 135371..135553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 135571..135729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 135784..136437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 136463..136789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 note possible pseudo, frameshifted CDS 136825..138615 product peptide cleavage/export ABC transporter ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene comA note possible pseudo, frameshifted CDS 138625..140010 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 140292..140720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 140924..141859 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 141994..143364 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(143425..143760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(143730..143933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(144187..145248) product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 145471..146481 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 146662..147213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 147389..147901 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 148271..149671 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 149921..150631 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 150618..151310 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 151334..151804 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 151833..152660 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 152641..153462 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 153477..154547 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 154575..155570 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 155585..155998 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 156180..157652 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(157818..159665) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(159662..160327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 160463..160801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 160918..161622 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(161880..162365) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(162428..163345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 163736..165064 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 165171..165617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(165692..167083) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 167512..168282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 note possible pseudo, frameshifted CDS 168279..168920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 note possible pseudo, frameshifted CDS 169060..170049 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene ansA CDS 170073..170387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 170557..171126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(171123..171497) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 171630..172448 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene menB CDS 172538..173989 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 174268..174792 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130171.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 175013..176365 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 176574..177269 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 177269..178492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(178566..179267) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rpiA CDS 179393..180493 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102122.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene mutY CDS 180560..181459 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rihC CDS 181578..182297 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene rsmG CDS 182311..183081 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 183068..183973 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 183984..184169 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 184194..185297 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene ychF CDS 185309..186049 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642428.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 186083..186772 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 186791..187903 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 187934..188629 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(188751..189269) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 189468..190694 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 tRNA complement(190813..190886) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(190895..190979) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(191034..191861) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 192032..193477 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 tRNA 193616..193700 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 193709..193782 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 193977..194723 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 194805..196691 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 196827..197288 product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 197285..198205 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 198202..198894 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 198887..199669 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 199809..201440 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 201764..203134 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 203297..204637 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(204798..205880) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 206109..207722 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 207729..208424 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene araD CDS 208470..209894 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene araA CDS 210081..210929 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 211263..211496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 211510..211773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 212074..212805 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 212822..214303 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 214498..214992 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene ybaK CDS 215007..215708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 215729..216397 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 216486..217217 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 217364..219823 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 219946..220671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 220820..222715 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 222970..223410 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 223423..223794 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 223823..224092 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 224101..226020 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 226299..228992 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene adhE CDS 229092..229922 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 tRNA complement(230052..230125) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(230161..230234) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 230420..231091 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 231099..232385 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene hflX CDS complement(232594..233283) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 233422..234879 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 234900..235217 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 235242..235550 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 235616..237067 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 237114..238406 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene celB CDS 238570..238887 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 238989..240083 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 240269..241996 product multidrug ABC transporter ATP-binding protein/permease ErfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene erfC CDS 241986..243773 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 243967..244701 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(244755..245765) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 245944..247296 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 247316..249094 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 tRNA complement(249228..249301) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(249352..249425) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 249816..250538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 250563..251528 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene manA CDS 251681..253033 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 253038..253745 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 253981..254583 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 254603..255688 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene prfA CDS 255693..256553 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene prmC CDS 256556..257584 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 257614..258864 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 258910..259539 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene upp CDS 259837..261114 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 261479..262189 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene atpB CDS 262228..262446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 262472..262987 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene atpF CDS 262987..263529 product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene atpH CDS 263596..265107 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene atpA CDS 265125..266006 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 266053..267453 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene atpD CDS 267471..267887 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 268027..268680 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 268691..269974 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene serS tRNA 270232..270316 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 270338..270410 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 270417..270489 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 270521..270597 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 270757..271233 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 271235..273724 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 273991..277596 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 277744..281400 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene rpoC CDS 281542..282738 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 282876..284072 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 284157..285005 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 285135..285536 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 285550..286380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 286395..287648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(287567..287743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 287788..289017 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(289066..289242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(289321..290706) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 290669..290836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(290924..292729) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 292923..293195 product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 293188..293823 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 294061..295557 product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene eat(A) CDS 295656..296621 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 296634..297251 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 297229..297759 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene tadA CDS 298046..299779 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene dnaX CDS 299804..300112 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 300139..300738 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene recR CDS 300738..301001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 301135..301779 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene tmk CDS 301794..302123 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 302133..303137 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene holB CDS 303134..304012 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rsmI CDS 304012..304755 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 304794..305786 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene galE CDS 306019..306744 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567077.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene tsaB CDS 306728..307312 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rimI CDS 307296..307751 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rimI CDS 307755..308780 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene tsaD CDS complement(308871..309860) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 310323..310631 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rpsJ CDS 310721..311347 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rplC CDS 311372..311995 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rplD CDS 311995..312282 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rplW CDS 312299..313132 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rplB CDS 313188..313469 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rpsS CDS 313486..313833 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rplV CDS 313847..314515 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene rpsC CDS 314517..314936 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene rplP CDS 314936..315142 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rpmC CDS 315166..315432 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene rpsQ CDS 315478..315846 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rplN CDS 315879..316187 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rplX CDS 316218..316760 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene rplE CDS 316804..317202 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene rpsH CDS 317234..317770 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene rplF CDS 317858..318214 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene rplR CDS 318235..318738 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rpsE CDS 318750..318935 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rpmD CDS 318977..319411 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene rplO CDS 319411..320718 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene secY CDS 320715..321284 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 321377..321592 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene infA CDS 321628..321747 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene rpmJ CDS 321801..322166 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rpsM CDS 322199..322585 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rpsK CDS 322637..323581 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 323620..324006 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rplQ CDS 324313..324528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 324503..324727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 324714..325586 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(325634..326326) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(326329..327375) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(327441..328274) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(328700..329362) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 329501..330976 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 331004..331828 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene nadE CDS complement(331913..332929) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 333134..334546 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene cysS CDS 334909..335388 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057799316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 335589..336443 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene kdsA CDS 336427..337380 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004339582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 337654..338577 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 338558..339835 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 339845..340930 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 340923..344099 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene carB CDS 344120..345085 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 345105..345812 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pyrF CDS 345815..346435 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene pyrE CDS 346493..346918 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 346902..347735 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rlmB CDS 347852..348406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 348474..348623 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene rpmG CDS 348645..348815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 348919..349476 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene nusG CDS 349620..350045 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene rplK CDS 350140..350829 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene rplA CDS 351049..351552 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rplJ CDS 351640..352005 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplL CDS complement(352054..352290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 352440..353258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 353481..353780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 note possible pseudo, frameshifted CDS 353831..354214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 note possible pseudo, frameshifted CDS 354216..355076 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 355060..356004 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 356275..357954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(358187..358789) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 358983..359825 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 359795..360667 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 360660..361463 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 361476..362225 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene truA CDS 362384..362827 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rplM CDS 362854..363246 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rpsI CDS 363409..364197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 364308..366248 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 366449..367273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 367660..368847 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 368921..369562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 369616..369984 product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 370207..371844 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 371869..372948 product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 373067..373219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 373279..373893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 373909..374139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 374431..375579 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene dgoD CDS 375598..376587 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 376605..377228 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 377272..378606 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 378707..379378 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 379895..381406 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene glpK CDS 381406..383217 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene glpO CDS 383217..383984 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene tpiA CDS 383996..384688 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 384876..387221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 387263..388126 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 388151..389488 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(389649..390191) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 390459..391331 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643949.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 391466..391894 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 392126..392629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 392653..393360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 393380..393883 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 393986..394876 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(394967..395425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 395590..396984 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 396977..397366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 397353..397802 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 397816..399153 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 399186..399473 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 399615..401111 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene xylB CDS complement(401166..401663) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 401861..403552 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 403555..404133 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(404361..405200) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 405332..405574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 405596..406777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(406831..407121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 407326..410175 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene uvrA CDS 410254..410373 product putative metal homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 410575..411468 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rapZ CDS 411465..412463 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 412490..413452 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene whiA CDS 413542..414135 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene clpP CDS 414507..415502 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 415593..416741 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(416885..417058) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene rpmF CDS 417443..417880 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 418142..418576 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 tRNA 418682..418755 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 419016..420701 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene alsS CDS 420759..421475 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene budA CDS 421592..422599 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 422814..424895 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 425187..426563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 426636..427178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 427235..427513 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 427615..428157 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101073.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 428171..429544 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene radA CDS 429564..430676 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 430801..432297 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene gltX CDS 432456..434825 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene secA CDS 434912..436027 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene prfB CDS complement(436122..437141) product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 437236..438006 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 438048..438530 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 438806..439759 product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(439830..441017) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 441177..441530 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003602575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 441830..442870 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 442877..445300 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene pheT CDS 445414..446565 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene mltG CDS 446717..448537 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene recQ CDS complement(448594..449079) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene greA CDS complement(449193..451835) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 452017..454068 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 454142..454705 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 454698..455369 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 455389..455601 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 455699..456667 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699875.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 456909..457736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 457899..458288 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(458367..458549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 458623..459252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 459255..460178 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene miaA CDS 460244..460591 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 460626..461972 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene glnA CDS 462112..462990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 462992..464005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704088.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 464006..464515 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 tRNA 464585..464660 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(464766..466541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 466872..467174 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rplU CDS 467200..467511 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rpmA CDS 467717..468895 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 468888..470567 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene menD CDS 470564..471370 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene menH CDS 471395..472507 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene menC CDS 472559..473644 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 473646..474095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 474111..474731 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 474734..476110 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 476132..476800 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 476810..477586 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 477702..478844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 478943..479815 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 479828..480745 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene pstC CDS 480747..481640 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene pstA CDS 481658..482488 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene pstB CDS 482502..483260 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene pstB CDS 483306..483980 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene phoU CDS 484066..484860 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene recX CDS 484942..485496 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 485669..487240 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 487237..487446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 487596..488048 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 488073..489359 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 489719..489994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 490114..490566 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 490811..491656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 491787..492515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(492601..493257) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 493374..493994 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 494340..497006 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 497172..498491 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 498580..500523 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 500755..501030 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene groES CDS 501075..502694 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene groL CDS 502906..504741 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 505013..505996 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 506075..507223 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476153.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 507382..507909 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 507902..509044 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene yqeH CDS 509048..509362 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene yhbY CDS 509390..510028 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 510018..510617 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene yqeK CDS 510617..510985 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rsfS CDS 510985..511731 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 511746..512927 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 512941..513486 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 513577..516204 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mutS CDS 516218..518254 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene mutL CDS 518274..518732 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 519061..521040 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene thrS CDS 521208..521939 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 522120..522617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 522642..523178 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 523348..524238 product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 524223..525485 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene xseA CDS 525487..525705 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564675.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 525711..526571 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 526574..527422 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 527409..527852 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 527877..529568 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene recN CDS 529643..530260 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene gmk CDS 530257..530457 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene rpoZ CDS complement(530498..531160) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 531293..531880 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 531950..532348 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 532367..532753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 sequence02 source 1..236193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(441..4757) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(5130..6842) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(6941..8197) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rseP CDS complement(8363..9154) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(9151..9954) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(10088..10912) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(10902..11333) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 11466..12263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 12312..12593 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 12595..13491 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(13551..14087) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene hpt CDS complement(14090..15382) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(15612..18188) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(18351..20084) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene ezrA CDS complement(20324..20935) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rpsD CDS complement(21169..21873) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(21879..23054) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene nagA CDS complement(23304..25289) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(25424..26233) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ybjI CDS complement(26253..28784) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 tRNA complement(28917..28991) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(29067..29858) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene proC CDS complement(29970..31154) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644656.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(31183..31392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(31405..32385) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 32568..33938 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(33987..34796) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(34960..35916) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(35919..37043) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(37048..38598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(38819..39898) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 40336..41388 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(41447..42778) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(42984..43763) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene kduD CDS complement(43784..44242) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(44365..46566) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(46566..48533) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(48722..49738) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 49910..50926 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene adhP CDS 51225..52670 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(52740..53384) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(53389..54492) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(54492..55214) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(55387..56301) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(56382..56555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 57038..57505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 note possible pseudo, internal stop codon CDS complement(57606..57863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(58336..59205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(59283..60092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(60535..60879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 note possible pseudo, internal stop codon, frameshifted CDS complement(60939..61091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(61269..61436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(62341..63153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(63386..63604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(63772..63939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(64514..65233) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(65312..66325) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(66361..67179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(67567..68754) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(68975..70030) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(70185..71057) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475606.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ispE CDS 71198..71581 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(71628..72887) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(73058..74233) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(74340..75755) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702157.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene dnaB CDS complement(75917..76369) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene rplI CDS complement(76388..78394) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(78648..79601) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(79601..80722) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(80722..81753) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(81768..82688) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(83017..84633) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(84630..84815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(84956..85612) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(85609..86262) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(86259..87107) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(87119..87853) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(88021..88827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(88827..89291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(89295..89870) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(90262..91677) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pepV CDS complement(91761..92609) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 92769..93824 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(94550..95479) product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(95510..96529) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene trpS CDS complement(96624..98927) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene helD CDS complement(99009..99371) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(99382..100899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(101045..102592) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(102861..104123) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(104432..106042) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(106234..106839) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rpoE CDS complement(106919..107755) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene yidA CDS complement(107780..109141) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 109246..109689 product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(110008..111225) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(111325..112125) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(112234..113052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(113053..114372) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene yycH CDS complement(114359..116242) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene walK CDS complement(116328..117029) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene yycF tRNA 117310..117385 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(117440..118291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(118291..119442) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 tRNA 119748..119823 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 119922..119995 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(120072..120527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(120621..120863) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene rpsR CDS complement(120914..121468) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ssb CDS complement(121540..121839) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene rpsF CDS complement(121969..122913) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(122978..123964) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(124094..125473) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene glmU CDS complement(125487..126341) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene purR CDS complement(126497..126967) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(127074..128540) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene zwf CDS complement(128666..130177) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene glpK CDS 130376..131575 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(131677..135468) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene addA CDS complement(135468..139034) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(139294..140697) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene pepV CDS complement(140770..142101) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(142368..143795) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene gndA CDS complement(143893..144207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(144364..144501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 144690..145085 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 145258..146178 product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(146246..147511) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(147852..149843) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 tRNA complement(149868..149942) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(150109..152523) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene leuS CDS 152681..153373 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 153333..153845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(153915..154793) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(154818..156239) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(156260..157534) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(157693..158676) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(158945..160321) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rlmD CDS complement(160702..161889) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(162108..162647) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(162804..163856) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(164140..164610) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(164755..165591) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(165747..166877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 167298..167864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 167868..168749 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(168867..170525) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020901749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(170821..172641) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene spxB CDS 173176..174063 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene murQ CDS 174082..176058 product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 176086..176928 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(176991..177590) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene dhaL CDS complement(177609..178595) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene dhaK CDS complement(178605..179003) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene dhaM CDS complement(179456..180649) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene metK CDS complement(180908..182464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(182631..183779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 note possible pseudo, frameshifted CDS complement(183814..184530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 note possible pseudo, frameshifted CDS complement(184545..186590) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 186716..187726 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(187810..188316) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 188426..188809 product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene hxlR CDS complement(188899..189576) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(189646..190476) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 190721..192202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(192313..193266) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(193332..194354) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rfbB CDS complement(194441..195580) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(195917..196801) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(197032..198138) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene ugpC CDS complement(198182..200023) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(200043..200408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(200415..201257) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(201278..202186) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(202225..203487) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 203704..204630 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 204642..205373 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 tRNA complement(205496..205581) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(205621..205706) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(205755..205828) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(205842..205914) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(205953..206027) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(206034..206109) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(206110..206184) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 206420..206490 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(206548..208077) product accessory Sec system glycosyltransferase Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene asp1 CDS complement(208083..209675) product accessory Sec system glycosyltransferase Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene asp1 CDS complement(209702..210571) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(210825..211397) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(211403..212707) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 213107..214282 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(214393..215739) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(215795..216265) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(216624..216959) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(217071..218171) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(218559..219593) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(219724..220983) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene tyrS CDS complement(221588..222277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(222404..223312) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene gnd CDS 223466..224308 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(224368..225024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(225040..225291) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 225491..225844 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(225954..226910) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(226914..228545) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 228651..229526 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(229592..229918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 tRNA complement(229975..230050) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 rRNA complement(230061..230169) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(230377..231321) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene ppx CDS complement(231346..233493) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(233490..235031) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(235677..236033) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 sequence03 source 1..227463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..516 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(849..1340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(1427..1753) product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 1907..2137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(2357..2887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(3504..3893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 4717..4845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 5005..5859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 5807..6010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 6128..6442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 6668..7504 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene mutM CDS 7504..8097 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene coaE CDS 8122..9474 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 9481..10461 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene dnaI CDS 10461..11576 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 11579..12355 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 12446..13135 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 13151..14632 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 14680..15681 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 15795..16739 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene yidC CDS complement(16811..17362) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185961073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(17472..18512) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene fni CDS complement(18518..19588) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(19582..20565) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene mvaD CDS complement(20593..21573) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene mvk CDS 21777..24608 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 24692..25210 product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 25243..26538 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene asnS CDS 27152..27892 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(27935..30265) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(30262..30888) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene recU CDS 30997..31560 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 31655..32086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 32585..33718 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 33750..36023 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene pcrA CDS 36039..38087 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene ligA CDS 38120..39313 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 39414..40049 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 40163..42178 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene uvrB CDS complement(42277..42531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(42534..42959) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 43079..43777 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 43783..44892 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 44876..45538 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene trmB CDS complement(45673..46098) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 46206..47102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 47178..48125 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 48312..49733 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene pepV CDS 49950..50765 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene thiD CDS 50765..51385 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene tenA CDS 51444..51743 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 51972..53246 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 53722..54516 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(54584..56269) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(56333..57706) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 57904..58905 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene ccpA CDS 58925..60106 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(60614..61099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(62027..62671) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(62915..63469) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(63688..64920) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene purD CDS complement(64934..66463) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene purH CDS complement(66466..67050) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene purN CDS complement(67050..68066) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene purM CDS complement(68093..69553) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene purF CDS complement(69538..71772) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene purL CDS complement(71765..72451) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene purQ CDS complement(72448..72711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(72718..73455) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(73458..74579) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene purK CDS complement(74572..75063) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645861.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene purE CDS complement(75309..75692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(75685..77013) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 77189..77740 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(77814..77975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(77997..78959) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(78963..79088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 79267..79854 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 79882..80622 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene yaaA CDS complement(80750..81481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 81724..82584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(82683..83501) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 83717..84130 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(84222..85952) product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(86114..86941) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(87363..88031) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 88262..90208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 90386..91162 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(91242..92576) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(92658..93503) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(93520..95370) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(95360..95734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(95927..97609) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene dld CDS complement(97786..98751) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(98890..99969) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 100134..100784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(100865..101809) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(101914..104130) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(104316..104585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 104841..106622 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene lepA CDS complement(106678..107178) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(107385..108716) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(108846..109418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(109563..111068) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(111084..112250) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(112275..113696) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(113841..114656) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 114852..115508 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(115549..116658) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(116861..119785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 120096..120626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 120574..121134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 121192..121545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(121611..122810) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(122947..123216) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rpsN CDS complement(123219..123368) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene rpmG CDS complement(123554..124186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(124326..127763) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(127923..128096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(128160..129392) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene pepT CDS complement(129408..130205) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(130192..130893) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(131041..132321) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(132347..132487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(132509..134212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 134334..134810 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(134879..138085) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(138087..139259) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(139283..140428) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(140561..141067) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(141064..141879) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(142035..142310) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(142517..143827) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene der CDS complement(143980..145197) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rpsA CDS complement(145303..145968) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene cmk CDS complement(146078..146710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(146802..148244) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(148251..149306) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(149614..150192) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(150483..151250) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(151250..151891) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene scpB CDS complement(151881..152675) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(152672..153037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(153062..153970) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene xerD CDS complement(153972..154844) product S1 RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 155089..155640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(155697..156662) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(156756..156932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(157076..157522) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene dtd CDS complement(157522..159753) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(159899..163270) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene dnaE CDS complement(163391..163579) product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(163677..164174) product trimethoprim-sensitive dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene dfr CDS complement(164176..166077) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(166084..167301) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(167398..168222) product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(168451..170271) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene glmS CDS complement(170787..171971) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(172160..173272) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(173468..174025) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene frr CDS complement(174030..174752) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene pyrH CDS complement(174774..175655) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene tsf CDS complement(175832..176608) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene rpsB CDS complement(176763..177041) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(177034..177798) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 177890..178528 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(178667..178903) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(178976..179230) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 179366..179968 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene lexA CDS complement(180007..180624) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 180777..181817 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(181990..183972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(183973..184941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(185195..186928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(187047..189017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(189018..190061) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(190237..192219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(192256..193221) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(193292..193807) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(193812..196118) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene recJ CDS complement(196135..197115) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene rnz CDS complement(197258..198001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(198017..198292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(198372..199292) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(199402..201234) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene dnaK CDS complement(201300..201845) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene grpE CDS complement(201861..202886) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene hrcA CDS complement(203113..204162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(204247..205188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(205379..206284) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(206289..207188) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(207277..208206) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(208289..209743) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(209795..210859) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(211024..212202) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene glf CDS complement(212277..213050) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(213065..214441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(214455..215090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(215205..215828) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(215858..216640) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene map CDS complement(216819..217214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(217130..218230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(218502..219461) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(219733..221217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(221308..221640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(221772..224096) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021036893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 224268..224597 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(224676..225512) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(225533..226267) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 repeat_region 226399..226764 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattcgaaccaattaatctgacatacatctaaagc CDS complement(226801..227244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 sequence04 source 1..183410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(131..202) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(293..1339) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene queA CDS complement(1358..2368) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene ruvB CDS complement(2383..2973) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene ruvA CDS 3380..4609 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(4673..5296) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(5370..6071) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(6162..7472) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene obgE CDS complement(7564..9357) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene uvrC CDS 9482..9607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(9727..10968) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(10961..11863) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(12003..14834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(14878..15393) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene trmL CDS complement(15512..16663) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(16760..17788) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(18060..20144) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene glyS CDS complement(20146..21060) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene glyQ CDS complement(21369..22160) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene recO CDS complement(22206..23114) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene era CDS complement(23140..23565) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(23549..24031) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene ybeY CDS complement(24034..25020) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(25112..25552) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(25629..25814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(25936..26817) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(26963..28768) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene aspS CDS complement(28771..30081) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene hisS CDS complement(30378..31262) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(31387..31827) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(31950..33116) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(33136..34335) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene coaBC tRNA 34544..34617 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 34644..34717 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 34745..34818 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 34900..34988 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(35836..36264) product autolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706497.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(36793..37392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(37572..38540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(38537..39250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(39235..39780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(39964..40362) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(40392..40583) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(40829..40975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(40968..41321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(41635..43200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(43197..44102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(44086..44352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(44342..44611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(44719..45078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(45075..45482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(45500..45760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(45960..46094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(46182..46742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(46822..47688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(47708..47902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 48047..48421 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 48578..48718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(48744..48896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 48982..50136 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(50669..53269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(53678..53869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(53995..54303) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(54321..54884) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(54993..55832) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 55994..56599 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(56652..57698) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004046647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 57872..58270 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(58369..59238) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(59265..59945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(59965..60375) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(60408..60725) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 60871..61305 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 61423..62742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 62758..63339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(63421..64761) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(64797..66269) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(66622..67626) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene ccpA CDS 67886..68986 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(69055..69615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(69640..70038) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(70156..71973) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene pepF CDS complement(72029..73066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(73210..73968) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(74129..74527) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene spxA CDS complement(74663..75670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(75702..76205) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene psiE CDS complement(76410..76916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(76981..77709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(77696..77902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(77907..78743) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 78909..79298 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene mscL CDS 79500..80135 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(80205..81620) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(81847..83358) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene glpK CDS complement(83473..83658) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(83669..84640) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(84808..86094) product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(86186..86539) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rplS CDS complement(86648..87391) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene trmD CDS complement(87394..87900) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rimM CDS 88029..88691 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(88735..89007) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene rpsP CDS complement(89098..90546) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene ffh CDS complement(90551..90892) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046870843.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(90898..92109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(92122..95676) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene smc CDS complement(95686..96384) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene rnc CDS complement(96509..96751) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene acpP CDS complement(96810..97844) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene plsX CDS complement(97943..99979) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene recG CDS complement(100106..101794) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(101819..102181) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(102324..102524) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene rpmB CDS complement(102643..103311) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(103311..103970) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene rpe CDS complement(103997..104911) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene rsgA CDS complement(104934..106895) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene pknB CDS complement(106895..107635) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(107672..109042) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rsmB CDS complement(109035..109985) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene fmt CDS complement(110051..112471) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene priA CDS complement(112611..113798) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(113905..114912) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(114978..115274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(115258..115695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(115668..115877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(115852..116223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(116246..116581) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene comGC CDS complement(116578..117570) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015640611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(117521..118429) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene comGA CDS complement(118563..120014) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(120257..120979) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(121032..123566) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(123547..124215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(124233..124895) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(124991..127783) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene ileS CDS complement(128064..128705) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(128720..129505) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(129514..129777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(129789..130241) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene sepF CDS complement(130253..131512) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene ftsZ CDS complement(131542..132930) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene ftsA CDS complement(133039..134022) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(134056..135150) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene murG CDS complement(135153..136514) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene murD CDS complement(136578..137573) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene mraY CDS complement(137609..139792) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(139794..140183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(140208..141152) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene rsmH CDS complement(141193..141627) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene mraZ CDS complement(141899..142279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(142299..143042) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(143042..143995) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene prmA CDS complement(144183..145604) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pyk CDS complement(145855..147330) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(147383..147517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 147788..148435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(148511..150172) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(150323..151156) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(151153..151803) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(151815..152459) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(152788..153408) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene mreD CDS 153558..154184 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(154258..155103) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene mreC CDS complement(155235..156239) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(156324..156758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 156869..157213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(157288..158115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(158218..158586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(158574..158963) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(158978..159748) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(159755..160642) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(160650..161636) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene trpX CDS complement(161951..162907) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene nrdF CDS complement(162940..165111) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene nrdE CDS complement(165197..165433) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene nrdH CDS 165695..166144 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene nrdI CDS 166160..166813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 166832..167089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(167185..167817) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(168267..168608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(168638..169333) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(169362..169643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(169653..170216) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(170234..170443) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(170459..170833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 170950..171072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(171140..172264) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene purK CDS complement(172291..172854) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(172942..174699) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene cydC CDS complement(174696..176426) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene cydD CDS complement(176536..177549) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene cydB CDS complement(177553..179025) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 179276..180208 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(180254..181096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 tRNA complement(181593..181682) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(181705..181780) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(181792..181863) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(181885..181959) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(181966..182041) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(182066..182141) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(182178..182267) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(182287..182362) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(182378..182451) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(182478..182553) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(182598..182673) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(182680..182765) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(182767..182839) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(182842..182917) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(182967..183040) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(183042..183116) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 rRNA complement(183128..183234) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence05 source 1..158284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..3307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 note possible pseudo, frameshifted CDS complement(3454..6138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(6433..7542) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene wecB CDS complement(7544..8671) product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(8692..9297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 note possible pseudo, frameshifted CDS complement(9294..9956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 note possible pseudo, frameshifted CDS complement(10005..10160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(10160..10549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 note possible pseudo, internal stop codon CDS complement(10565..11017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(11302..12249) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(12350..13795) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene gatB CDS complement(13795..15252) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene gatA CDS complement(15252..15563) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene gatC CDS complement(15829..16647) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(16661..19039) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(19261..20076) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(20078..20695) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(20688..21002) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(21175..22569) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(22962..23447) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(23551..24540) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(24580..25554) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 25926..26489 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 26494..27909 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 27902..28570 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(28757..29458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(29448..30179) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene aroD CDS complement(30139..30684) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(30686..31978) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene aroA CDS complement(32004..33182) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene aroC CDS complement(33189..34250) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene aroB CDS complement(34255..35241) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene aroF CDS complement(35243..36055) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(36161..36838) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(36843..37523) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(37695..38309) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(38539..39726) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 39924..40661 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(40788..41852) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(41941..43125) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(43168..43908) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene dapB CDS complement(43914..44789) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene dapA CDS complement(44804..45955) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(45974..46684) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene dapD CDS complement(46711..47997) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene lysA CDS complement(48010..49125) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene alr CDS 49496..50851 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(50958..51980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(52020..53012) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 53352..53891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(54062..54376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 54558..55214 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(55341..55976) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(56156..57493) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(57520..58512) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(58631..59179) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(59393..60763) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene rlmD CDS complement(60874..61761) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene htpX CDS complement(61776..62345) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(62488..64212) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700629.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(64314..64997) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rpiA CDS complement(65182..65967) product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057868922.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene accA CDS complement(65970..66815) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene accD CDS complement(66826..68202) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene accC CDS complement(68204..68635) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene fabZ CDS complement(68648..69112) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene accB CDS complement(69112..70347) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene fabF CDS complement(70438..71160) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene fabG CDS complement(71172..72104) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene fabD CDS complement(72121..73068) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(73099..73338) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(73382..74353) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(74365..74823) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(74826..75287) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene fabZ CDS complement(75518..75757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(75905..76693) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(76693..77538) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024128025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene citG CDS complement(77531..78085) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057787567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene citX CDS complement(78175..79713) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene citF CDS complement(79703..80617) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene citE CDS complement(80617..80910) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene citD CDS complement(80900..81952) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092462393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene citC CDS complement(81979..82965) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(83012..84157) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(84415..85353) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(85634..86929) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene purB CDS complement(87071..87988) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(88058..90526) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(90523..91608) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(91670..92182) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene pyrR CDS complement(92381..93286) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(93287..93658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 93747..94136 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(94120..95472) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene nhaC CDS complement(95995..96237) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(96354..98177) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene lepA CDS complement(98260..98388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 98506..99138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(99196..100644) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene cls CDS complement(100725..102245) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(102256..103176) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(103282..103899) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene thiE CDS complement(103862..104695) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(104695..105213) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene thiW CDS complement(105467..106363) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(106569..107789) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(107895..108905) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene gap CDS complement(109201..109413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(109535..109990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(109977..110363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 tRNA 110518..110591 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(110992..112095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(112088..112408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(112401..112883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(112883..113134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(113137..113532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(113547..118100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(118097..118918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(118918..121542) product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(121546..121791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(121866..122318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(122413..122991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(123004..123363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(123360..123719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(123722..124003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(124003..124338) product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(124391..124816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(124891..125757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(125776..126291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(126456..127400) product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(127387..128961) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(128966..130249) product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(130249..131097) product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(131208..131384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(131391..131654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(131788..132216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(132197..133204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(133305..133484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(133727..134170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(134326..135630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(135655..136506) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(136752..137138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(137119..137571) product endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(137571..137729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(137732..138472) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(138479..139324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(139334..139888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(139851..140561) product putative HNHc nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(140561..141196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(141212..141631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(141624..141812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(142012..142245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(142259..142459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(142462..142863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(142866..143627) product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 143705..143917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(143922..144065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(144078..144308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 144567..144914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 144924..145403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 145457..146110 product Ltp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 146272..147357 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(147869..148762) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(148840..149511) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(149539..149886) product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(149975..150922) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(150942..151748) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(151785..152759) product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 152980..155781 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(156083..156385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(156443..156994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS complement(157050..157466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 tRNA complement(157579..157664) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(157689..157762) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(157765..157838) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(157865..157940) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(157941..158015) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 rRNA complement(158024..158132) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence06 source 1..111611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..96 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 97..171 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 179..254 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 280..355 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 380..455 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 466..537 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS 688..1317 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1352..2185 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene racE CDS 2212..2808 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 2811..3329 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(3385..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 4344..4961 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 4983..5801 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 5803..6720 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 6736..8115 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene mgtE CDS 8281..8967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 8985..10115 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene nusA CDS 10128..10427 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 10417..10722 product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 10734..12947 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene infB CDS 12986..13339 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rbfA CDS 13466..14377 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene truB CDS 14441..15379 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ribF CDS 15399..17093 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 17196..17831 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 17873..18289 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 18464..19330 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 19511..20356 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 20471..21355 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 21342..21959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 21956..22177 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 22199..23074 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ylqF CDS 23064..23831 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 23881..24747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 24871..27021 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene topA CDS 27033..27959 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene xerC CDS 28039..28920 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(29014..29637) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010494164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene plsY CDS 29832..31859 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene parE CDS 31866..34322 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene parC CDS 34400..35326 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(35459..36076) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 36323..37576 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 37578..39311 product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 39329..39502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 39734..41080 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 41450..42283 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 42297..42827 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene msrA CDS 42841..43785 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(43870..45549) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(45553..45765) product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 46073..46555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 46600..47187 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene def CDS 47191..47481 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 47485..48270 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 48344..50188 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene typA CDS 50351..51568 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 51572..51883 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 51883..52437 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene rsmD CDS 52442..52918 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640809.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene coaD CDS 52921..53964 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 54212..55210 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 55226..56362 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 56365..57345 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 57338..58639 product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 58642..60048 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene lpdA CDS 60083..60880 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 61055..62686 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 63537..64313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 note possible pseudo, internal stop codon CDS 64303..66267 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 66271..68142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 68146..68835 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 68844..70004 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 70058..70693 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 70713..71516 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene map CDS 71649..72665 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(72776..74689) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 74923..76395 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 76457..77440 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 77751..78458 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene treR CDS 78476..78964 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 78982..80496 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025016545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 80521..82827 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 82834..83505 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene pgmB CDS 83711..84028 product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 84180..84563 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 84651..85217 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 85622..86716 product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 86766..87647 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(87873..88550) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 88775..90019 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 90134..91171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 91189..91701 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 91865..92287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(92300..92842) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 93046..94026 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 94051..94239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 note possible pseudo, internal stop codon CDS 94291..94614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 note possible pseudo, internal stop codon CDS 94887..95288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 95313..95681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 95675..95959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 96053..96568 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 96645..97400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 97543..98037 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 98534..99061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 99072..99275 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 99433..100341 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 100341..101111 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 102030..102272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 103116..103370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 103376..103603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 103624..103971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 103995..104426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 104436..105455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 105766..106074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 106088..106873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 106876..107556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 107549..107896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 107889..109304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 109389..109658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 109753..109923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 110253..111431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 sequence07 source 1..96794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..1478 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1468..2145 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 2298..2858 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene raiA CDS 2971..3417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 3419..5605 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 tRNA 5760..5843 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS complement(5992..6174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 tRNA 6401..6490 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 6524..6599 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 6604..6693 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 6773..8356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 8552..10117 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rny CDS 11079..12116 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 12271..13023 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 13036..14826 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(14900..15037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 15109..15987 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 16116..16376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 16499..16681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 17173..18849 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 18924..20258 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 20350..20913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 21079..21834 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 22250..22384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 22427..22981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 22999..23196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 23237..23746 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 24180..25091 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 25331..25834 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 tmRNA complement(26355..26716) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 26912..27898 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene guaC CDS 28003..29055 product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene mscY CDS 29218..30576 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 30615..32693 product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 32721..33968 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene codA CDS 34289..35005 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 35026..35925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 36051..37085 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 37201..38544 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 38706..39272 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene efp CDS 39372..39809 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 39806..40225 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene nusB CDS 40473..40934 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene infC CDS 40960..41154 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene rpmI CDS 41221..41769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(41821..42210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 42538..42957 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene rpsL CDS 42977..43447 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene rpsG CDS 43578..45701 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene fusA CDS 45831..46943 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 46933..47751 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 47741..48562 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 48565..49650 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 49739..50518 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(50595..50939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(51079..51528) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 52091..52264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 52406..52789 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 52805..53734 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene hprK CDS 53843..54862 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 54870..55745 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene galU CDS 55907..56860 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene trxB CDS 56968..57585 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 57674..58645 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 58678..58863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 59047..59313 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 59352..61079 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ptsP CDS 61384..63063 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674766.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 63231..64439 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382263.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 64511..65848 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 65858..66697 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 66710..67813 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene ugpC CDS 67829..69580 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 69670..70443 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene tpiA CDS complement(70516..71220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 71517..72875 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene eno CDS 73009..73248 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene secG CDS 73323..75680 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rnr CDS 75701..76171 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene smpB CDS 76416..77864 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 77864..78601 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(78688..79236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 79359..80024 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 80148..81128 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene pta CDS 81240..82217 product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 82343..82804 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene tsaE CDS 82804..83316 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 83329..83862 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 83876..84769 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene murB CDS 84792..86849 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 86858..87691 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene cdaA CDS 87693..88661 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674353.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 88669..90027 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene glmM CDS 90027..90341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 90494..91741 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 91738..92775 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 92775..93773 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 93787..94041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 94158..96353 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 sequence08 source 1..72083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 607..810 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 834..1787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1790..6028 product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 6093..6383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(6502..6708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(7307..7843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 note possible pseudo, frameshifted CDS complement(7840..7995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(7988..8149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 8497..10491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 10472..11764 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 11788..12333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(13659..13949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 14168..14347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(14285..14485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(14494..14679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(14679..15110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(15107..15370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 15782..16027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 16017..18245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 18242..18853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 18850..20736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 20733..23867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 23886..26141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 26161..26679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 27056..27256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 27316..28308 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 note possible pseudo, frameshifted CDS 28573..28911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 28912..29556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 29575..31527 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 31529..31753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 31757..32986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 32994..33401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 33408..33995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 33967..34566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 34594..34896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 35087..35458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 35490..37328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 37451..37720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 37713..37901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 37951..38427 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 39028..40128 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(40779..41087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(41657..42013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 42309..45446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 assembly_gap 45323..45419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 46140..46337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 46444..46647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 46999..48030 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 48444..50321 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene dnaG CDS 50332..51465 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene rpoD CDS 51571..52788 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 52914..53627 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 53646..55016 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 55039..55674 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene udk CDS 55696..56769 product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene pepA CDS 56801..57439 product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 57452..57811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 57918..59258 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene murC CDS 59359..60078 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(60152..61003) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 61258..63957 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene polA CDS complement(64035..64223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 64462..66357 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 66335..67297 product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 67227..67445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 67432..68133 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene pnuC CDS 68649..68969 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(69049..69414) product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 69617..69871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 70110..70439 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 70552..70677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 70761..71396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 note possible pseudo, frameshifted sequence09 source 1..67792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..2034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(2038..3675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(3672..5732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(5747..8797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(8804..9286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(9279..10775) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(10800..11237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(11265..12488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(12526..12972) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene tagD CDS complement(12998..16987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(17007..17744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(17806..18195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(18215..19039) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(19045..20322) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(20338..21207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(21200..22033) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(22279..22614) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(22692..24185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(24358..24801) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene msrB CDS complement(24803..25333) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene msrA CDS complement(25378..26031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 26195..27433 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(27550..28653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(28800..29696) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(29774..29974) product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene cspC CDS complement(30237..30989) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(30996..32543) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(32875..33630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(34016..34960) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene coaA CDS complement(34966..37248) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene helD CDS complement(37458..38600) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene recA CDS complement(38676..39161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(39284..39868) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene pgsA CDS complement(39890..40825) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(40887..42176) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(42169..43431) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(43656..45158) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(45321..47072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(47054..47608) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(47732..49168) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(49158..49625) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(49789..51321) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene gntK CDS complement(51419..52390) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(52404..54734) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(54724..55917) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(56028..56372) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(56429..58624) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(58626..59093) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene argR CDS complement(59242..60927) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene argS CDS complement(60927..61235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(61347..62873) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(62879..63502) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(63505..64851) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(64909..66060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(66835..67557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 sequence10 source 1..66367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..2026) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene lysS CDS complement(2138..3031) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene hslO CDS complement(3138..5180) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene ftsH CDS complement(5238..5834) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene hpt CDS complement(5930..6904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(7015..7386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(7517..7795) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(7795..9384) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(9389..12889) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene mfd CDS complement(12907..13473) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene pth CDS complement(13620..15200) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166034979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(15428..16384) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(16508..19030) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 19168..19770 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(19835..20560) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297012.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(20634..21278) product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene cbpA CDS 21548..21757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 22250..22960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(23256..23678) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 23869..24840 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117118241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(24911..25540) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(25544..25993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 26264..27184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(27259..28080) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(28375..29319) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182746.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rbsK CDS 29828..30031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(30928..31296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(31561..32223) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(32234..32977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(33477..34862) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(34992..35387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 35510..36400 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(36658..37596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(37589..38218) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(38208..38531) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 38650..38937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(38989..39420) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(39421..40188) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(40284..41834) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(41903..42697) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene phnE CDS complement(42697..43479) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene phnE CDS complement(43483..44247) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene phnC CDS complement(44362..45294) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(45544..51636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(52170..53444) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(53623..54579) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(54602..55075) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 55307..55555 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(55629..56972) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(57163..58530) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(58581..59477) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene rsmA CDS complement(59474..60040) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene rnmV CDS complement(60037..60849) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(61114..63060) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(63149..65152) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene metG CDS complement(65415..65924) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 sequence11 source 1..46424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 105..179 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 183..257 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(332..1423) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1572..2558) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(2995..4005) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060776566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(4080..4262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 note possible pseudo, internal stop codon CDS complement(4495..6003) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(6030..6188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(6231..6629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(6634..7005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 7179..7373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 7425..7673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 7675..7815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(7790..8107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 8195..8938 product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 8974..9315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 9351..9611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 9592..9846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 9887..10084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 10068..11216 product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 11219..12037 product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021732641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 12038..12736 product putative HNHc nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 12714..13034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 13224..13751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 13752..14189 product endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674670.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 14191..14397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 14440..14865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 15149..15577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 15727..16446 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 16497..17231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 17314..17448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 17448..18362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 18337..19578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 19578..20993 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 20993..21607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 21610..22494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 22497..22769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 22891..23520 product DUF4355 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 23536..23856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 23870..24880 product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 24894..25601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 25615..25941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 25953..26393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 26396..26773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 26760..27260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 27253..28329 product DUF3383 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 28348..28749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 28851..29213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 29185..29427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 29455..34440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 34452..35012 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 35012..35350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 35350..36216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 36217..36585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 36585..36929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 36919..38073 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 38066..38659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 38663..41839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 41862..42254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 42259..42525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 42515..42838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 42831..43838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 44026..44496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 44489..45832 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence12 source 1..41626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(813..1967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 2869..3048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(3792..4964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(4946..5299) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002498952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene mobC CDS 5967..8081 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(8295..8462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 note possible pseudo, internal stop codon, frameshifted CDS complement(8540..8959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 note possible pseudo, internal stop codon, frameshifted CDS complement(9791..11017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 11721..11888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(12392..12547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(12949..13140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(13160..13396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(13468..14259) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(14373..14936) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241732.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(15097..15636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(15893..16756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 16767..17651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(17766..18155) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 18284..18910 product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene hxlA CDS 18925..19455 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene hxlB CDS 19448..20797 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(21050..21553) product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene yfkM CDS complement(21573..21773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 21664..22044 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(22205..22387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 note possible pseudo, frameshifted CDS complement(22380..22802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, internal stop codon, frameshifted CDS 22878..23228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 23225..23509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(23740..24156) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene arsC CDS complement(24467..24826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(25103..26092) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(26166..26345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(27368..27523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(27536..27679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(27673..27819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(28103..28516) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 28900..30750 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 30814..31050 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 31052..31603 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 31620..32312 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(32484..33074) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(33382..35145) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(35575..36162) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(36340..37095) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene fetB CDS complement(37092..37742) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(37739..37978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(38232..38438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 assembly_gap 38466..38561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39230..41497 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057717560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 sequence13 source 1..27023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..737) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene trxA CDS complement(810..3194) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(3234..3773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(3773..4003) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(4137..4763) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene yihA CDS complement(4776..6023) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene clpX CDS complement(6252..7541) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene tig CDS complement(7782..8969) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene tuf CDS complement(9173..10096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(10198..12126) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(12344..12598) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene rpsT CDS complement(12656..12925) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene rpsO CDS complement(13067..14092) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene holA CDS complement(14168..14548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 note possible pseudo, frameshifted CDS complement(14601..16298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 note possible pseudo, frameshifted CDS complement(16406..17086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(17182..17454) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(17527..17811) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(17823..18257) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene ruvX CDS complement(18283..18534) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(18580..21228) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene alaS CDS complement(21554..22912) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(22912..23862) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(23969..25084) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene dinB CDS complement(25203..25562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(25602..26747) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921852.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene tgt tRNA complement(26926..27000) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 sequence14 source 1..20657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(496..717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(919..1167) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003680323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1879..2052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2125..3030) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 3421..4593 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 4685..4903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(4995..5585) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(5968..6270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 assembly_gap 6359..6456 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6530..7210 product IS6-like element ISS1N family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(7302..9959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(10008..10574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 10801..11481 product IS6-like element ISS1N family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(11650..12231) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(13524..14855) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(14933..15904) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(15905..17431) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(17578..19611) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(19750..19914) product copper chaperone TcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene tcrZ CDS complement(19915..20370) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 sequence15 source 1..18525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 note possible pseudo, internal stop codon, frameshifted CDS complement(595..1167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1160..2314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(2811..4046) product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene mobV CDS complement(4848..5759) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674064.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 6244..7002 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168722861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 7366..8382 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 8386..9114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 9161..9544 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(9690..9992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(10219..11550) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(11568..11696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(11709..12356) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(12375..13319) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene trxB CDS complement(13538..13861) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(13882..14196) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene trxA CDS complement(14210..14491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(14617..15261) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(15192..15536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(15610..15774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(16753..17193) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(17225..17719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 sequence16 source 1..6342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 note possible pseudo, internal stop codon CDS complement(681..845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(980..1471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 note possible pseudo, internal stop codon, frameshifted CDS 2226..2417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 note possible pseudo, internal stop codon CDS complement(2571..3944) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(3984..5513) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(5674..5910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 sequence17 source 1..4737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..924 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1364..2980 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2997..4163 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(4358..4639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 sequence18 source 1..4678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 23..1485 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 assembly_gap 1519..1551 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 1739..4650 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence19 source 1..4446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(540..770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 note possible pseudo, internal stop codon CDS complement(801..968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1397..3493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(3552..3761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(3778..4092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(4105..4230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 sequence20 source 1..1987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..1057 product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(1254..1640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 sequence21 source 1..1002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence24 source 1..472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 116..191 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 196..270 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 sequence27 source 1..353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 139..213 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 sequence29 source 1..235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@