COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..282612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(568..969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1198..3399) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3558..3740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4065..4571 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594621.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene ybaK CDS complement(4614..4751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4911..5090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5250..5423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 5522..6742 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7221..7607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(7699..8172) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene ribE CDS complement(8174..9388) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(9381..9986) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene ribE CDS complement(9986..11032) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene ribD CDS complement(11699..12259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 12419..13399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 13389..14240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14327..15163) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15153..16886) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(16883..17899) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(17913..18986) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19157..21217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 21342..22337 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(22401..23222) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23563..23877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(24025..25269) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(25479..26300) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 26546..29320 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(29378..30961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022638009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(30954..31718) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(31831..32493) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 32684..33493 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(33531..34220) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(34360..34863) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(35062..35568) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(35878..37506) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37582..37758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37806..37940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(38042..38776) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(38875..39627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 39790..40197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 40468..41856 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene uhpT CDS complement(42074..42694) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547751.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(42717..43232) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(43323..44186) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 44295..45179 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 45313..45720 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(46091..47053) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47056..47208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(47324..47548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 47478..47888 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(48020..49270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(49847..50875) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gap CDS 51002..51877 product LysR family transcriptional regulator YofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene yofA CDS 52263..53123 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(53240..54049) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 54192..54602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(55015..55398) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(55411..56397) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(56518..57210) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene pgmB CDS complement(57276..59519) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(59585..60688) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene ugpC CDS complement(61452..62264) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(62264..63124) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(63149..64462) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(64646..65941) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(65954..67615) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(67710..68657) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 69287..70576 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(70773..71144) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(71280..71660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 71958..72110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(72257..81679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(81775..83097) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 83223..83921 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(84004..84918) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(84993..85742) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene pnuC CDS complement(86114..86677) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ahpC CDS 87296..87952 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 87974..88492 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(88537..88962) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 89101..89391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(89504..91444) product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(91519..92298) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 92425..93201 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(93202..93372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 93518..93979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 94214..94693 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 94808..95161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 95633..95845 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(95911..96513) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96878..97444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 97457..98107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 tRNA complement(98396..98484) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(98523..99041) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565731.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(99064..101373) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene recJ CDS complement(101496..102098) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 102694..103686 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene galE CDS complement(103787..105097) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(105435..107279) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene lepA CDS complement(107392..108528) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene dnaJ CDS complement(108653..110515) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene dnaK CDS complement(110552..111124) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene grpE CDS complement(111143..112189) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene hrcA CDS 112367..112882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(113036..113968) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene ribF CDS complement(114063..114971) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene truB CDS complement(115579..115938) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene rbfA CDS complement(116409..119369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(119383..119679) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(119679..119993) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(120003..121229) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene nusA CDS complement(121240..121707) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene rimP CDS complement(121832..126133) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(126172..127878) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(127893..129161) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rseP CDS complement(129184..129978) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(129997..130740) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(130746..131303) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene frr CDS complement(131293..132027) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene pyrH CDS complement(132200..133078) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene tsf CDS complement(133150..133950) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rpsB CDS complement(134077..134358) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(134348..135076) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 135139..135762 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(136063..137319) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene purD CDS complement(137335..138876) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene purH CDS complement(138873..139457) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene purN CDS complement(139454..140473) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene purM CDS complement(140485..141891) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene purF CDS complement(141876..144086) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene purL CDS complement(144086..144760) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene purQ CDS complement(144761..145009) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene purS CDS complement(145019..145726) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(145731..146861) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene purK CDS complement(146854..147336) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene purE CDS complement(147576..147797) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(147860..148102) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 148198..148821 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene lexA CDS complement(149175..150344) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(150344..151429) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene serC CDS 151983..152603 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(152736..154082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(154316..154996) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(155027..155674) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(155687..156619) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(156634..156978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(157501..158385) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(158409..158870) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(158905..159813) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(160121..161107) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 161262..162122 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 162209..162643 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 162664..163218 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 163352..165151 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 165287..165829 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 165813..166874 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 166879..167571 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(167749..168102) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rplS CDS complement(168217..168945) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene trmD CDS complement(168945..169460) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rimM CDS complement(169521..169793) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rpsP CDS complement(170194..170931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(170928..171794) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(172161..173597) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene ffh CDS complement(173607..173948) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(173951..175453) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101483.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene ftsY CDS complement(175463..179008) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene smc CDS complement(179022..179711) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rnc CDS complement(180695..180937) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene acpP CDS complement(180951..181952) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene plsX CDS complement(181965..183998) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene recG CDS complement(184440..186122) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(186148..186516) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 186714..186899 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rpmB CDS 186998..187819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(187883..188953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(189086..190231) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(190703..191479) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(191502..191975) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057799316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(192002..192856) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(193651..194310) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(194307..194981) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene rpe CDS complement(194996..195886) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene rsgA CDS complement(195890..197854) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene pknB CDS complement(197855..198604) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(198624..199955) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rsmB CDS complement(199942..200892) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene fmt CDS complement(200906..203314) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene priA CDS complement(203870..204124) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene rpoZ CDS complement(204131..204742) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene gmk CDS 204922..205242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(205234..206931) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene recN CDS complement(207500..208324) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(208335..209183) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(209186..209422) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(209415..210764) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene xseA CDS complement(210757..211605) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(211644..212048) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene nusB CDS complement(212054..212473) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(212497..213060) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene efp CDS complement(213199..213471) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rpmA CDS complement(213484..213828) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(213831..214142) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rplU CDS complement(214264..215829) product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069635112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 216218..216415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(216776..217024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(217168..218568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 218757..218942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 219153..219275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 tRNA 219421..219495 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(219539..220216) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 tRNA 220409..220484 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(220659..221618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(221709..222692) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(222931..223062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(223488..224738) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(224731..225654) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene miaA CDS 225740..225934 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(226602..227009) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(227022..227984) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(227981..228217) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(228210..228887) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(228871..229440) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(229490..229639) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699868.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rpmG CDS complement(229727..231835) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(231862..232158) product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(232208..232687) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene greA CDS complement(232790..233953) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene mltG CDS complement(234007..236412) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene pheT CDS complement(236417..237463) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene pheS CDS complement(237757..238518) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 238584..238859 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 238918..239940 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene yidC CDS complement(240712..241638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(241828..242799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(243017..244129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(244126..244812) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 245485..245706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(245606..247030) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene gndA CDS complement(247100..247654) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(247654..248751) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(248763..249494) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(249494..249850) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rsfS CDS complement(249852..250454) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene yqeK CDS complement(250447..251085) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(251701..252015) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene yhbY CDS complement(252026..253153) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene yqeH CDS complement(253140..253667) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(253744..254100) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rplT CDS complement(254136..254333) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene rpmI CDS complement(254348..254773) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene infC CDS complement(255361..256380) product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 256473..256913 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(256925..257248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(257278..257469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(257557..259515) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene thrS CDS complement(259816..260724) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene dnaI CDS complement(260727..262100) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(262112..262585) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene nrdR CDS complement(262607..263200) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene coaE CDS complement(263197..264024) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene mutM CDS complement(264034..266691) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene polA CDS complement(267322..268722) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(268830..270029) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135960345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 270306..271496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(272081..273412) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene murC CDS complement(273421..274053) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(274689..275015) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 275140..275454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(275466..276113) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene trmB CDS complement(276132..277349) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(277349..278083) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 278173..278601 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 278603..278896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 279003..279908 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 280617..281078 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 281132..282499 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 sequence02 source 1..271304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 184..837 product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(1302..1727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 note possible pseudo, internal stop codon CDS complement(1776..2507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 note possible pseudo, internal stop codon CDS 2783..4126 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(4821..5504) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(5571..6005) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 6207..7553 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(9106..9975) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene fba CDS 10949..12091 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene wecB CDS complement(12610..13068) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(13071..13526) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 14299..15057 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene map CDS 15073..16032 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 16032..16940 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene galU CDS complement(17518..17802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 17896..19050 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 19047..20288 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 20288..21442 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(23121..23921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(24097..24576) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 25769..28942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(29101..30132) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 30645..31496 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(31808..32164) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 32473..32670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(32612..32848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(32909..33898) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(33898..35343) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(35343..36527) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 36675..37541 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 37531..37884 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 38538..39248 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(39289..41460) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(41475..43439) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 43686..45149 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 45175..46155 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 46179..47255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 note possible pseudo, internal stop codon CDS 47307..47858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 note possible pseudo, internal stop codon CDS complement(47956..49338) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rlmD CDS 49407..50177 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene recX CDS 50694..51227 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 51415..54366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 54513..56939 product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 57206..57790 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 57868..58263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 58602..61391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(61446..62201) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(62201..62896) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(62929..63711) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119327301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(63790..64713) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene cysK CDS complement(64727..65521) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(66237..66698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 67587..68939 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 69612..71189 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 71596..72591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 73248..74600 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene brnQ CDS complement(74650..75594) product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 76445..76885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(77615..80074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(80459..83020) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 83162..83752 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 84079..85359 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene rpoN CDS 86035..86964 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(87043..87537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(87593..88759) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(88874..90301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(90471..91190) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(91206..91943) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene deoC CDS complement(92163..92498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(92541..93107) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(93228..93464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(93921..94943) product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(95441..95611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 95649..97538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(98512..100713) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 101041..101307 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 101307..103028 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene ptsP CDS 103296..104000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 104029..104556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(104622..105197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 105453..108467 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 110081..110416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 110413..111174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(111627..111782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 112111..112839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 112962..114272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 115134..116126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 117025..117801 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 117811..118164 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene folB CDS 118169..118651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 note possible pseudo, frameshifted CDS 118656..119231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 note possible pseudo, internal stop codon, frameshifted CDS 119245..120537 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 120538..121629 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene folP CDS 121613..122137 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 122864..124249 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene ltrA CDS complement(124371..125273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(125397..126785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(126939..128111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(128305..129057) product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(129057..129899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 130616..131464 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 131558..131851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 131930..132415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 132536..133018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 133426..135666 product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene nrdJ CDS 136521..136943 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 136957..139005 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 139299..139526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(139790..140074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 140269..141012 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 140987..142096 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 142112..142762 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(143131..144123) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(144133..144807) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 145397..146167 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 146148..148148 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(148800..149252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 149298..150023 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 150282..150680 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene spxA CDS 150997..153474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 153722..156205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 156560..157231 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 157415..157696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 157686..157949 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(158062..158391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 158541..158825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 158850..159143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 159482..160360 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(160388..161035) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 162094..162747 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 162747..163559 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 163546..164466 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 164459..165832 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene mgtE CDS complement(166125..166811) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(167459..168298) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(168330..169346) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 169731..170630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 171348..171857 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene trmL CDS 171868..172329 product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 172732..175140 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 175137..176414 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180259804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 176416..177654 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 177658..178380 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 178446..179288 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 179944..180528 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pgsA CDS 180552..181094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 181183..182319 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene recA CDS 182468..184033 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003657913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene rny CDS 184142..185236 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 185377..186132 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(186447..187085) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 187117..187266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 187413..188426 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 note possible pseudo, internal stop codon, frameshifted CDS 188717..189103 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 189200..189748 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene raiA CDS 189961..192321 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene secA CDS 192482..193477 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene prfB CDS 193477..194142 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 194144..195793 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 195892..196767 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 196769..197689 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene pstC CDS 197689..198576 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene pstA CDS 198580..199386 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene pstB CDS 199686..200834 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 201038..201796 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene pstB CDS 201809..202501 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene phoU CDS 202557..202814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 203887..204846 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene hprK CDS 204846..205655 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene lgt CDS 205721..206662 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene trxB CDS 207040..207291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 207427..209145 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 209878..211170 product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 211185..212429 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 212876..214885 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene uvrB CDS 214888..217749 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene uvrA CDS complement(217788..219254) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(219521..221545) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057880580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 221674..222588 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rapZ CDS 222575..223609 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene yvcK CDS 223609..224538 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene whiA CDS complement(224856..226577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(226769..228160) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(228779..229294) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 229443..230378 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 230399..231175 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(231393..231980) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene clpP CDS complement(232136..233263) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(233350..234225) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 234353..235261 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 235254..236894 product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene mdcA CDS 236896..237693 product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene mdcB CDS 237882..238181 product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 238171..239835 product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene mdcD CDS 239823..240467 product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 240713..241297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 note possible pseudo, frameshifted tRNA complement(241795..241866) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 242101..243147 product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 243182..244210 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene gap CDS 244332..245546 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 245566..246318 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene tpiA CDS 246403..247704 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene eno CDS 248428..249486 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 249502..251043 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 251120..251356 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene secG CDS 251415..252152 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 252161..254491 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rnr CDS 254497..254967 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene smpB CDS 255152..255841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 256322..257287 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 257323..259122 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 259376..261184 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(261244..263457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 263715..264362 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 264830..265324 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 265404..266603 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 266596..267630 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 267630..268673 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 268673..270739 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 sequence03 source 1..270592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 235..346 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 654..1151 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 1464..3077 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 3328..4518 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830884.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 4532..5428 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 5438..5914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 5914..6756 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 6756..7139 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(7192..9540) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(9730..12045) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 12300..12740 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(12829..13614) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(13933..14958) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene nrdF CDS complement(14974..17151) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene nrdE CDS complement(17132..17506) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene nrdI CDS complement(17506..17736) product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 18006..18632 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(19271..19480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 19564..20121 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674722.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 20335..21048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 22095..22754 product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(22810..24141) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(24154..25467) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(25483..25995) product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161023296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 26289..26453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(28115..29041) product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene opp1F CDS complement(29041..30087) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(30104..31129) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(31131..32063) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(32086..33723) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(33865..35157) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene hflX CDS 35668..35949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 36285..37535 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(37530..37736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 38448..38798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(38812..39399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(39469..40071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(40185..40934) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(40931..41758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(42226..43521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 43717..43929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 44275..44421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(44477..45073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 45260..45634 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 45627..46355 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 46348..47100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 47116..47826 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 47823..48596 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 48636..49385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(49610..49738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 49805..50002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 50342..50530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 50615..51472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 51531..52382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 52397..52948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(53132..54064) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(54420..55877) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 56635..57387 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 57402..59192 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 59887..60627 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 60639..61466 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 61463..62101 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 62115..62768 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 63459..64862 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene nhaC CDS 65613..66524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 66537..67214 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 67207..68358 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 68367..68819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 69142..69630 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 69966..71657 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 71756..72520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(72600..74294) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(74469..74630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(74788..75447) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(75584..76234) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 76347..76967 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 76972..77412 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 repeat_region 77473..78960 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggttcttaagtaattgagatgacatacttctaaaac CDS complement(78981..79685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(79682..79987) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene cas2 CDS complement(79992..80867) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene cas1 CDS complement(81020..85090) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene cas9 CDS 85261..85944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 85944..86780 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587710.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(86817..87218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(87833..88147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(88545..89540) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(89568..90512) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene lacC CDS complement(90921..91436) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene lacB CDS complement(91454..91888) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene lacA CDS complement(91906..92670) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 92941..93453 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 93471..93776 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 93804..95222 product PTS glucitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 95955..97334 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 97356..99359 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(99707..100612) product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(101002..101289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 101471..102787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 103161..103925 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 103928..104395 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 104828..106726 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 106869..107099 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 107099..107653 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 107667..108353 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 108936..109592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 109723..110439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 110432..111028 product exosortase family protein XrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene xrtG CDS 111058..112362 product putative glycosyltransferase, exosortase G system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 112359..112739 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 112752..114296 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 114447..115217 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(115282..117828) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 118122..120443 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene helD CDS 120663..124292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(124346..124777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 124968..126299 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(126370..127509) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 127818..128516 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(128946..129581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(129592..130140) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 130275..131201 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene coaA CDS 131275..132825 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene guaA CDS complement(132990..133334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 133824..134834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 134879..135985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 136246..136725 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014124664.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene tnpA CDS 137875..138252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 138480..139718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 139980..140873 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(140917..143355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(143636..143800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 144022..146772 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(146871..147173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 147680..149479 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene glgB CDS 149485..150630 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 150627..151799 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene glgD CDS 151792..153228 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene glgA CDS 153266..155671 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 155685..157502 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(157608..158270) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 158416..159489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(159595..159939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 160184..161215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 161228..161902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 161924..162604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 162627..163787 product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 163798..164754 product DUF4767 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 164796..165359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 165386..166558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(166673..166972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 167330..168154 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 168267..168734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 168807..169691 product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 169800..170636 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(170764..171048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 171294..172178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 172292..173233 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 173418..175280 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 175283..176155 product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 176185..178113 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 178335..178643 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 178679..179917 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 179948..180286 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 180298..181752 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 181777..183690 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 183897..184811 product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene yhfZ CDS 184824..185183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 185176..185541 product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 185614..186906 product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 186930..187814 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 187807..188904 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 188907..190073 product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 190075..191304 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 191552..192091 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(192130..192936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(192956..193561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(193669..196194) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 196739..197176 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 197193..197687 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 197731..198582 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 198585..199433 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 199562..199867 product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(200044..201279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(201432..202049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(202062..202472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(202469..203356) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 203466..204005 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 204021..204887 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(205167..206030) product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 206155..206904 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(206953..207411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(207481..208401) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 208492..209139 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 209212..209445 product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 210012..211049 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 211062..211658 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 212070..212948 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 213046..213417 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 213437..213931 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(214003..215193) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 215716..218247 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 218453..220657 product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 221057..223849 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(223946..224122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 224141..224881 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567413.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 224881..225732 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 225729..226661 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 226899..227693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 227706..228491 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 228503..229654 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(229692..230390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 230468..230908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 231038..231490 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 231493..232242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(232387..232614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 232654..233166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 233293..233928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 233953..234327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 234518..237604 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 237613..237855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 note possible pseudo, internal stop codon CDS 237958..238812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 note possible pseudo, internal stop codon, frameshifted CDS 238803..239219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 note possible pseudo, frameshifted CDS 239212..240432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(240463..240963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 note possible pseudo, internal stop codon CDS complement(241018..241389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 note possible pseudo, internal stop codon CDS complement(241470..242477) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 242683..242841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(242893..243900) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene asnA CDS complement(244367..244852) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 244965..245813 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 245908..247593 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(247637..248254) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 248379..249830 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 250003..253431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 253752..254024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 254540..255598 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 255614..258790 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene carB CDS complement(258834..262001) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(261998..263188) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(263320..264729) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 264966..267167 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(267232..268074) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641536.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(268246..268500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 268660..268842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 268907..269431 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 269469..270053 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 sequence04 source 1..242659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..1858) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(2387..3553) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 4142..5593 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(5665..5805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(6262..8970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(8980..10275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 10349..11275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(11553..11984) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(12050..12895) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(13251..14537) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(14560..15945) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene dnaB CDS complement(15952..16407) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene rplI CDS complement(16426..18429) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(18529..19071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(19061..19261) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(19476..19712) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene rpsR CDS complement(19734..20336) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ssb CDS complement(20374..20670) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene rpsF CDS complement(21381..23954) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene gyrA CDS complement(23971..25920) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene gyrB CDS complement(25920..27041) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene recF CDS complement(27045..27254) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene yaaA CDS complement(27494..28630) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene dnaN CDS complement(28789..30165) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene dnaA CDS 30668..30808 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rpmH CDS 30876..31217 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rnpA CDS 31251..32093 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene yidC CDS 32240..33628 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene mnmE CDS 33923..35845 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene mnmG CDS 36329..38863 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057784170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 38878..39786 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 40032..41222 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 41215..41757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 42095..43306 product chloride channel family chloride transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(43458..44291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 44452..45789 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(45912..46616) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene nagB CDS 46796..47644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 47829..48644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 48669..48986 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573334.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(48996..49547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 49672..49842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 50281..50841 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(50838..52910) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(53053..55080) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(55596..55787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 56025..56747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 note possible pseudo, internal stop codon CDS complement(56797..57594) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(57694..58881) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(58963..60111) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(60121..60708) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 61261..61416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(61451..62389) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(62447..64363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 64489..65694 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(65751..66665) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 66751..67722 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 67819..68151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(68255..69994) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene cydC CDS complement(69991..71724) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene cydD CDS complement(71724..72737) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene cydB CDS complement(72734..74176) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(74891..75970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(76001..76810) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene thiD CDS 76945..77703 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 77721..78248 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(78699..79406) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475557.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 79688..80455 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene proC CDS 80871..81464 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 81546..82730 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 82755..82874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(82984..83658) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 83718..85040 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(85591..86097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 86460..87194 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 87513..87962 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 88106..88645 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 89051..89797 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene yaaA CDS complement(89932..90474) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 90666..93005 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 93096..93272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 93462..93737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(93955..94557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 94760..95668 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 95674..97296 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(97653..98180) product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene paiA CDS complement(98192..98626) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 98792..99517 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene rsmG CDS 100095..100871 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 100852..101721 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 101731..101994 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 101998..103101 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ychF CDS 103117..103869 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 104159..104578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(104579..105460) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 106341..108119 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 108133..109548 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(109805..110131) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(110159..110356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 110845..111531 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 111534..112622 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 112650..113888 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 114249..115778 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 115783..116520 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 116594..117154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 118179..119054 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 119057..119722 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 119726..120523 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 121035..121442 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(121619..122341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(122480..123352) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 123522..124508 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 124643..125998 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 126319..127671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 127683..129104 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(129145..129621) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(129777..131393) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(131935..132306) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 132734..132889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(132894..133205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 133354..133707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 133839..135317 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene guaB CDS complement(135683..139429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(139689..139889) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(140133..141521) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 142044..143213 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(143251..144189) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 144386..145801 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 145844..146134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(146071..146457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 146611..147258 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(147415..148833) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286847.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 149180..150061 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(150101..153643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 153812..154606 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene sufC CDS 154618..155805 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene sufD CDS 155777..157006 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 157003..157449 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 157442..158833 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene sufB CDS 158920..160092 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 160122..160442 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 160848..161981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 162330..163541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(163605..164354) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(164351..165241) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(165238..166245) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene trpX CDS 166628..167704 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 167704..168456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 168677..170020 product 6-phospho-alpha-glucosidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 170117..172000 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054718926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 172073..172837 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 172850..173341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 173364..173840 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 173919..175592 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 175667..177049 product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 177209..178765 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 178873..180210 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 180269..181036 product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene glvR CDS complement(181445..182308) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(182372..183013) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(183410..184330) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 184664..185101 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(185456..186262) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 186650..187402 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(187883..188605) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 189184..190395 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 190445..192076 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(192278..193192) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 193387..194166 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 194859..195794 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 195927..197426 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene glpK CDS 197484..199259 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene glpO CDS 199306..200256 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160994791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 201043..201942 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 201962..203410 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 203423..204478 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 204482..205381 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene murQ CDS 205390..206262 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 206443..207276 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 207278..208150 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 208169..208621 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 208632..209039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(209086..209517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 209625..210080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 210463..211158 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 211477..212754 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 212764..213027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 213024..214112 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 214117..215229 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 215231..216328 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 216331..217065 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 217076..218068 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(218293..219468) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 219713..220129 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(220141..221919) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 222270..222578 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(222757..223746) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(223893..224498) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(224500..225597) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 225787..226056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(226348..227232) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 227771..228406 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 228509..228880 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 228904..230829 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(231031..231537) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(231628..233031) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101342.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 233147..234094 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene mmuM CDS 234486..236069 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 236319..237080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(237466..237870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 238280..239233 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 239233..239685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 239794..240351 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 tRNA complement(241055..241129) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 241652..242353 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene yycF sequence05 source 1..185512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..783 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 844..1689 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 2111..3175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 3529..4137 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(4198..4767) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 5206..5658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(6052..7863) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(8026..8976) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(8992..9951) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(9951..10922) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(10919..11935) product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene opp2D CDS 12689..13183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 13454..13708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(14414..14689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 14748..17075 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 17528..18337 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 18351..19097 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 19233..20627 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 20652..22088 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 22097..22996 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 23182..25488 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 25622..26863 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 26860..28242 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene argH CDS 29018..30190 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 30147..31661 product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 31658..32641 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 32634..32768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 33048..33575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(33609..34031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 34129..34368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(34423..34980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 35084..35728 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(35996..36727) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(36727..37539) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(37543..39045) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(39556..39735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(39850..40020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(40246..40419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(40419..40613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 40801..42681 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(42756..44138) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(44135..44827) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 45383..45805 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 45925..46461 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 46466..47884 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 47971..48954 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 49420..50148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(50198..50995) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(50998..51663) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(51660..52568) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(53256..53672) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene arsC CDS complement(53665..54126) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 54319..55008 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 55022..55723 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(56081..56356) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 56521..56850 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 57549..57818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(57861..58349) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 58505..59527 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(60265..60993) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 61154..62551 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 63178..64194 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene tdcB CDS 64590..66026 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 66435..67106 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene sdaAB CDS 67121..67987 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene sdaAA CDS 68345..69769 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 70349..70882 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(71495..72604) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571839.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 72792..72944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 73004..73171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 73548..74282 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 74485..75009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(75139..76077) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 76884..77873 product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 78549..79277 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 79379..81730 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 82435..82620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(83647..84036) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(84090..85298) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 86341..87309 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 87334..88284 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 88232..88987 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 89610..90047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 90135..91511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(91783..92586) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 92652..93764 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 93844..94335 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 94772..95320 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 95557..96045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 96048..96863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 96865..97539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 98371..98895 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 99298..100467 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 100482..102392 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene asnB CDS 102972..105263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 105459..106823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 107448..108668 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 108686..109150 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 109752..111695 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 112299..114245 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 114808..116058 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187289197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 116725..117426 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 117437..119815 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 119977..120681 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 120726..121172 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 121810..122133 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 122136..122546 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 122556..123191 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 123443..124531 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 124524..125465 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 125465..126295 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 126295..127647 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(127744..128673) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 128781..129677 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 129670..130893 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 131134..134025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(134285..135004) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 135934..136878 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 137297..137491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 137733..138131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(138459..139058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(139039..140286) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(141086..141508) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(142041..142853) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene proB CDS 142947..143234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 144555..144830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 144904..145656 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(145628..147016) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(147016..147441) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(147968..149425) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 149537..149905 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(149902..150423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 151107..152831 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(153144..153347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 153575..154939 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 154959..156416 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 156732..157082 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 157868..158116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(158253..158423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(158423..158794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(159111..159722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(159946..160800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 161325..161579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(161999..162286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 162888..164093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 164333..165472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 165472..166257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(166317..167186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 167987..168193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 168207..168419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 168788..170269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 170493..170957 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014124664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene tnpA CDS 171549..172052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(172361..173353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 173796..174818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 174853..175293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 175421..176392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 176499..176906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(177140..177571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(177626..177868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(178039..179739) product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069635112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 181526..183286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 note possible pseudo, internal stop codon CDS 183311..183799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(183837..184028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 sequence06 source 1..27167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(661..1113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1244..1603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071742188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 2084..3091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 3233..4252 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 4380..5015 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 5673..6770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(7016..7198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 7614..7853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 8519..10249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 10745..11446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 11443..12288 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 12436..13203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 13308..13859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 13895..14263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 14269..14703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 14882..15376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 15482..16447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 17145..18572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 18589..19386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 19400..20455 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 20529..22025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 22563..23252 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(23795..25879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 26109..26753 product type A-8 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene catA sequence07 source 1..209939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 556..630 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 667..751 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 813..888 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 897..968 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 1714..4218 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 4470..8078 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567588.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 8103..11771 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rpoC CDS 12222..13043 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 13937..14350 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rpsL CDS 14398..14865 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene rpsG CDS 14912..17008 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene fusA CDS complement(17210..17617) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(17962..19167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 19454..19762 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene rpsJ CDS 19794..20429 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene rplC CDS 20447..21070 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene rplD CDS 21070..21357 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene rplW CDS 21374..22207 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene rplB CDS 22243..22524 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rpsS CDS 22539..22895 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene rplV CDS 22913..23590 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rpsC CDS 23594..24025 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rplP CDS 24015..24209 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rpmC CDS 24232..24507 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene rpsQ CDS 24537..24905 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rplN CDS 24938..25180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 25197..25739 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rplE CDS 25756..25941 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 25972..26370 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene rpsH CDS 26401..26931 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rplF CDS 26957..27313 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene rplR CDS 27332..27832 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rpsE CDS 27850..28035 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rpmD CDS 28066..28506 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rplO CDS 28506..29801 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene secY CDS 29816..30469 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 30566..30784 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene infA CDS 30958..31323 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene rpsM CDS 31345..31731 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rpsK CDS 31795..32733 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 32764..33144 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rplQ CDS 33941..34774 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 34750..35604 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 35608..36405 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 36409..37155 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene truA CDS 37281..37724 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene rplM CDS 37738..38130 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene rpsI CDS 39069..41627 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211121229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 41983..42501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(42534..43637) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 43814..44548 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 44561..45382 product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene sppA CDS 45400..45906 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 46491..47699 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene trpB CDS 47692..48456 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene trpA CDS 48908..49747 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 49764..50558 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(50625..52391) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(52410..53087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 53875..54144 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene rpsN CDS 54104..54262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 54356..55885 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 56106..57542 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861839.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 57535..58971 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 59024..61141 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 61183..62040 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 62136..63521 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 63523..64908 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(65224..65850) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(65864..66616) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(66728..68155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(68402..69205) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 69355..70209 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(70591..71463) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene thrB CDS complement(71450..72940) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene thrC CDS 73053..74228 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 74228..75556 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(75900..76775) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 76953..77996 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 78006..78761 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene phnC CDS 78761..79552 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene phnE CDS 79549..80400 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 80419..81213 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene phnX CDS 81207..82298 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene phnW CDS complement(82342..83007) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 83200..83445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 83682..85442 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060684316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 85544..85867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(85958..86752) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene pstB CDS complement(86764..87651) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene pstA CDS complement(87652..88569) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene pstC CDS complement(88647..89549) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 89936..90676 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(90779..93430) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 94082..96061 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene nagE CDS 96681..97361 product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 98164..99138 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 99185..100000 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 100020..100931 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 101040..101432 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 102106..102648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 102994..104916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 104969..105712 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(105747..106451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 106684..106893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 107561..108439 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 108782..109456 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 109777..110634 product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(111071..111358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 111502..112320 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(112623..112910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 113144..113662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(113974..116058) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(116479..118902) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(119582..120925) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(120939..121628) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rpiA CDS complement(121629..121931) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 122372..122914 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 123030..124316 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene radA CDS 124330..125604 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 125585..127081 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene gltX CDS 127168..128580 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene cysS CDS 128573..128986 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 128967..129740 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rlmB CDS 130128..130688 product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 130759..130908 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene rpmG CDS 130923..131108 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene secE CDS 131204..131749 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene nusG CDS 132421..132843 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene rplK CDS 132947..133627 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene rplA CDS 133832..134335 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene rplJ CDS 134377..134745 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene rplL CDS 134816..135418 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 135980..136294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 136296..136772 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene tadA CDS 136985..138694 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene dnaX CDS 138706..139035 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 139035..139634 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene recR CDS 139636..139923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 140608..141258 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene tmk CDS 141262..141588 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 141591..142544 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene holB CDS 142556..142921 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 142936..143811 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene rsmI CDS 143811..144554 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 144768..145289 product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 145357..146079 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene tsaB CDS 146054..146593 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene rimI CDS 146604..147626 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene tsaD CDS 148085..148351 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 148361..149704 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 149810..150520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(150548..151399) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(152012..153922) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 154059..154709 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 154730..155698 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene manA CDS 156213..157493 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(157942..158568) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 158711..158995 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene groES CDS 159047..160678 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene groL CDS 161270..161842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(161894..164413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(164638..167121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 167295..168107 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101924.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 168181..168876 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 169250..170053 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 170067..172712 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene mutS CDS 172996..174927 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene mutL CDS 174931..175518 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene ruvA CDS 176168..177061 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene ruvB CDS 177128..178165 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene queA CDS 178175..179317 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene tgt CDS 179408..179890 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene yajC CDS 180252..180404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 180837..182273 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene zwf CDS 182346..183422 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene dinB CDS 183415..184371 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 184372..185718 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 186491..189127 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene alaS CDS 189191..189448 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 189449..189883 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene ruvX CDS 189894..190205 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 190585..191127 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 191179..193533 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 193603..193914 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene trxA CDS 194126..194290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(194620..195099) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 195214..196041 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene racE CDS 196016..196615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 197018..197428 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 197431..197736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(197767..197952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(198234..199334) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 199507..200508 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene ccpA CDS complement(201239..201544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(201792..204542) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(204954..206351) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene pepV CDS complement(206417..207847) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 208827..209162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 209162..209779 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence08 source 1..191601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(753..2717) product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 2939..5638 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 6188..7525 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(7542..8582) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 9114..10091 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 10158..10964 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 11073..11867 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(11933..12643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(12672..13280) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(13292..13861) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 13993..14712 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(14750..15421) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(15411..16994) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(16928..17857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 18026..18406 product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(18667..19455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(19466..20365) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(20352..21050) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(21059..21838) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(21838..22746) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(23236..24099) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(24220..24588) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene dhaM CDS complement(24591..25178) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene dhaL CDS complement(25192..26184) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene dhaK CDS complement(26540..27229) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 27384..28211 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(28493..29854) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 30316..31995 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(32033..34129) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(34142..34363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 34670..36388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 37098..38495 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene brnQ CDS 38464..38988 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 39428..40300 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(40600..41469) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(41471..42856) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(42869..44338) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(44342..46042) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(46057..46659) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(47305..48759) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(48793..49719) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(49735..50709) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(51008..53761) product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236023556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(54169..55026) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(55511..56620) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene ugpC CDS complement(57371..60061) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(60075..61367) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016173124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 61489..62532 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 62535..64691 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(64753..65373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(66036..67376) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(67432..67650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 68165..70315 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 70903..73044 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(73217..73840) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(73925..75919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(76078..77445) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(77568..78317) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 78416..79192 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(79241..80200) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(80335..82197) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(82223..82726) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rpiB CDS complement(82728..83378) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene rpe CDS 83807..84808 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(84851..85315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(85329..86075) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(86170..87540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(87577..88503) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(88700..89695) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 89865..91334 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(91498..92172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 92488..93036 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(93139..95769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(95864..96055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 96250..97440 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene coaBC CDS complement(97479..97886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(97886..98458) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(98471..99943) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(100061..100336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(100880..103201) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rep CDS complement(103167..104081) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 104228..105019 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(105088..105282) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(105300..105485) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(105566..105988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(106064..106888) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(107360..107647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(107685..107984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(108134..108955) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(109110..109799) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(109803..110861) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(111004..111828) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(112781..114172) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(114355..115224) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(115226..116719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(116724..117053) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(117088..118488) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(118490..118798) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(118948..119646) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(120278..120940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 121188..121748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(121805..122449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 tmRNA 122592..122954 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(123354..123944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(124137..124931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(125002..125739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(125763..126251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(126307..126660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 127032..127355 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642643.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(127625..128152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(128130..128357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(128605..128868) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(129214..129399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(129653..130207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(130211..130372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(130695..131189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(131290..131484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(131489..131770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(131921..133087) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(133180..133947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 134307..136760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(136933..137571) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 137880..139061 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(139155..139361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(139366..139788) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 139932..140252 product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 140344..140661 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 140742..141605 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013854628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 141978..143057 product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027777.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 143050..145035 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 145050..146891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 146909..148768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(148815..150059) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(150218..150592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(150916..153525) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene adhE CDS complement(153813..155489) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(156000..157196) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(157207..158220) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(158280..158498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(158488..158934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(158912..159193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(159177..159593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(159623..159991) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(159991..161004) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene comGB CDS complement(160970..161938) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene comGA CDS complement(162016..162750) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(162863..166459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(166683..167201) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(167201..168796) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(169352..171163) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene glmS CDS complement(171962..173314) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene glmM CDS complement(173335..174423) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(174401..175264) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene cdaA CDS complement(175340..177466) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(178357..179259) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene murB CDS 179369..180130 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 180134..180670 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(180952..181416) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(181413..181874) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene tsaE CDS complement(181884..182852) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene pta CDS complement(182852..183547) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 183631..184509 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 184513..185061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(185350..186663) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(186696..187955) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene celB CDS complement(187971..188924) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(189012..190031) product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(190073..191290) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 sequence09 source 1..167385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..1064) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1274..2125) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 2881..3744 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(3774..4697) product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(4694..5410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(5400..7775) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100960.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 8441..8995 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(9125..9964) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(9965..10531) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(10682..11104) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(11117..11461) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene crcB CDS complement(11458..11877) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene crcB CDS complement(11937..12839) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene gnd CDS complement(12963..13526) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 13751..15139 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(15352..16107) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(16409..18118) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(18168..19838) product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(19966..20313) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 20762..20974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(20906..21721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(21728..22390) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 22711..25044 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(25066..25251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(25313..25468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(25480..25644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(25740..27896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(28048..28242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(28325..28882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 note possible pseudo, internal stop codon CDS complement(28982..29533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 note possible pseudo, internal stop codon CDS 30047..30421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(30765..31745) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(31760..32140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 32607..32846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(32891..33853) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(34102..34722) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(34838..35647) product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene bltR CDS complement(35682..36029) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(36032..37792) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 38005..38799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(39052..40002) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(40290..41051) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 41118..41882 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 42841..43749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 43742..44365 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(44346..44573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 45214..47154 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 47892..49256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 49892..51862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 52014..53993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(54423..55166) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(55474..56634) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene nagA CDS complement(56763..56984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(57225..58385) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene nagA CDS complement(58992..60164) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(60193..62208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(62201..62626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(62641..63456) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(63443..64381) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(64406..64894) product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(64925..65641) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(66002..66940) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(67072..68688) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(68858..69769) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(70401..71456) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 71631..72575 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 73944..76667 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(77032..77742) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 77812..78567 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 78609..81368 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 81399..81848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 81854..82552 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 83269..84735 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene cls CDS complement(84835..85245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(85366..87894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 88233..88880 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene pcp CDS 89106..89750 product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(89880..90146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 90301..90927 product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(91257..92519) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(93081..95168) product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 95415..96863 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(96956..97237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(97900..98097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 98467..98655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(99800..100102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(100252..100446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 100700..101020 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 101289..101489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 101949..102134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 102344..102541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(102746..103213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 103636..105000 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 105601..106371 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(106634..108034) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(108670..109512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(109540..109899) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 110070..110507 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(112108..113058) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(113299..114003) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(114013..114621) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 114840..116171 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(116598..118475) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 118617..119519 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 119717..122104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(122141..122902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(123164..125332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(125600..126379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(126503..127795) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 128679..130115 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 130223..130690 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene greA CDS 130874..131791 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 132494..133486 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 133730..134737 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 135160..136164 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 136761..137891 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 138635..139018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 139063..139443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 140122..141495 product multidrug efflux MFS transporter MdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene mdrM CDS 141593..142669 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(142776..142910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(143660..145129) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(145160..145330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(145664..146527) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095006144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(146817..147746) product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(147848..148492) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 149334..149756 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 149769..150707 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014554495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 150828..151409 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(151572..152702) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(152722..153465) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene argB CDS complement(153493..154719) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene argJ CDS complement(154737..155762) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene argC CDS complement(156786..158132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 158295..159194 product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(159525..160004) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene rlmH CDS complement(160624..161997) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(162368..163174) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(163164..163976) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(163977..165290) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene yycH CDS complement(165280..167175) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene walK sequence10 source 1..160470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1654 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1870..2430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(2470..3159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(3243..4571) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(4580..5080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(5080..5886) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 6312..8276 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 8602..9435 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 9838..10746 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 10832..11743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(11782..12492) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene budA CDS complement(12511..14190) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene alsS CDS 14302..14733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(15266..15943) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 16510..16950 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 16976..18631 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 18804..19814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(19998..20408) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 20720..21529 product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 21604..21936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 21947..22765 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 22890..23426 product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 23755..24267 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286354.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 25246..26010 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 26012..26758 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 26755..27540 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 27556..28218 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 28215..29015 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 29030..30097 product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene waaB CDS 30110..30976 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 30970..32115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 32115..33230 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene glf CDS 33236..34663 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 34647..35603 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 36113..36979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 37136..38434 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 38449..39615 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 39728..41029 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065904166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 41022..41342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 41335..41712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(41768..42127) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 42259..44178 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(44311..45648) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(46164..46805) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 47273..48034 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015825263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(48337..48834) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 48947..49459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 49574..50041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 50167..51036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 51149..52258 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 52343..53323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 53329..54456 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 54617..56725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 56852..59344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 59463..62033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(62122..62769) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(63120..63389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(63527..63718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(63737..65041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 65505..66953 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 67921..69210 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene serS tRNA 69274..69348 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 69434..69506 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 70157..70858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 70878..71060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(71283..71513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 72218..75427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(75479..76471) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(76490..77032) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 77271..78275 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 78298..79137 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(79737..81563) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 81982..82911 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160994791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 82979..83587 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 83598..84854 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 86890..88242 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 88591..88917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 89029..89358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 90373..92904 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 93019..94527 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene glpK CDS 94567..96069 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene glpK CDS 96214..97689 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 97785..97949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 tRNA 98437..98521 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 98525..98598 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 98730..99431 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(99416..99583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 100097..101491 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(101787..102515) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 102574..103650 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 103992..105464 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 105466..106284 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene nadE CDS 106393..107586 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 107588..109039 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 109032..110012 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 110018..110452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 110572..110916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 tRNA 110952..111040 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(111126..111521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(111548..116020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 116596..117429 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 117567..118067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 118436..118963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(119479..119934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 119984..121951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 122045..122530 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 122520..123968 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(123996..125399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 126070..126516 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rbsD CDS 126529..127437 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene rbsK CDS complement(127434..127568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 127623..127823 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 128255..129454 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 129854..130054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 130017..130664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 130719..131300 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 131320..132450 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 132454..133749 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene purB CDS 134262..134414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 134537..136777 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene pcrA CDS 136793..138811 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene ligA CDS 138822..139955 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 139969..140268 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641341.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene gatC CDS 140268..141725 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene gatA CDS 141725..143155 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene gatB CDS 143168..144196 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 144256..145614 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene rlmD CDS 146168..146359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 146450..146662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(146926..147672) product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(147673..149019) product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(149060..149956) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(149956..151284) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(151354..152694) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 152819..153814 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 153816..155042 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 tRNA 155089..155164 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 155472..155654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 155705..156211 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(156422..156853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 157012..157461 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646084.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 157470..158099 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 158174..158344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 158359..159819 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 sequence11 source 1..136458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..766) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rpsD CDS 1711..3399 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ezrA CDS 3475..4620 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 4630..5847 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene thiI CDS 6698..9346 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 9753..11018 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 11027..11665 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene radC CDS 11760..12761 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 13259..14119 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene mreC CDS 14119..14661 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700469.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene mreD CDS 14658..15326 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 15329..16126 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641491.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene minD CDS 16310..16891 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene thiT CDS 17311..17742 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene mraZ CDS 17732..18682 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene rsmH CDS 18698..19063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 19060..21228 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 21243..22208 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene mraY CDS 22225..23598 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene murD CDS 23599..24705 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene murG CDS 25103..25801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 25877..27229 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene ftsA CDS 27269..28525 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene ftsZ CDS 28540..28956 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 28971..29237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 29243..30037 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 30050..30799 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 30981..33758 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene ileS CDS 33772..33990 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 34671..35240 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 35241..35537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 35548..36237 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 36250..37398 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 37452..37787 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 37801..38919 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene mnmA CDS 39424..40074 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 40082..40747 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640835.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 40734..43139 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 43258..43779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 44100..44378 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 44504..45871 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 46031..46507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 46592..46960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(47085..48812) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 48917..49480 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 49661..49867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 50031..50267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 50257..50625 product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene mazF CDS complement(51238..52194) product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(52387..54078) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(54082..54294) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(54284..54466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(54432..54992) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565220.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene def CDS 55911..56909 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 57061..58164 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene pdhA CDS 58167..59144 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 59169..60461 product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 60468..61895 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene lpdA CDS complement(61970..62152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 62506..62796 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 62783..63562 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 63637..65478 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene typA CDS 65930..67108 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 67113..67376 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 67376..67927 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rsmD CDS 67929..68420 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene coaD CDS 68427..69482 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 69522..70145 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 71112..72401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 72376..73389 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene holA CDS complement(73474..73722) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene rpsT CDS 74182..74451 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565267.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rpsO CDS 74625..76322 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 76360..77307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 77513..78703 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565275.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene tuf CDS 78926..80212 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene tig CDS 80352..81599 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene clpX CDS 81648..82232 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene yihA CDS complement(82552..83127) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 83461..84705 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene tyrS CDS 85078..86025 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 85982..87256 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 87270..87968 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene pyrF CDS 87968..88606 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene pyrE CDS 88606..89757 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 89920..90813 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 90823..91602 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(91761..93347) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(93444..93707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 94077..94565 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 94820..95170 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 95163..96518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(96558..97100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 97268..98773 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 98804..100138 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 100790..102094 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene aroA CDS 102175..102996 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 103533..103841 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 103940..104275 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 104281..105726 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 105754..107211 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 107885..108658 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 108800..110101 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene celB CDS 110127..111209 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 111269..112432 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 112914..113528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 note possible pseudo, internal stop codon CDS 113598..114041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 note possible pseudo, internal stop codon CDS 114779..115423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(115480..116826) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(116826..117989) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene guaD CDS 118764..119618 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 119630..119980 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 120019..121755 product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 121774..123198 product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003589794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene lacG CDS 123726..124538 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 124590..125450 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 125648..126361 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 126563..126781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 126787..128112 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(128207..129052) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674212.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 129282..130493 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(130583..131308) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(131634..132689) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 132957..134240 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 134254..135393 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(135670..136116) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence12 source 1..128344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..724 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 814..2349 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene gntK CDS 2955..3623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(3918..4226) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 4655..6082 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 6142..7026 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(7545..7979) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 8727..9422 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 9425..9610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(9659..10369) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 10506..11366 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(11381..11824) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641849.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 12000..12941 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 12941..14461 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050337793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 14767..15444 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 15577..15852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 15982..16434 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 16434..16955 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 16957..17670 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 17767..18168 product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene arsC CDS complement(18308..19504) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(19613..20368) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642747.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 21238..21849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 21914..22957 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(23306..23617) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 23825..24529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 24530..25144 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 25157..25984 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101964.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(26098..27141) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 27868..28575 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287482.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 28562..28888 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 28968..29918 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 30013..31179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 31192..31806 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 32498..33601 product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 33818..35578 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 35568..37367 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 37467..38333 product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 38334..39509 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(39662..40162) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 40274..40960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 41232..42674 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 42661..43959 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene celB CDS 44004..45308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 45528..46172 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 46311..47924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(47944..48489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(48563..49252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(49336..50052) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 50432..51823 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene asnS CDS 52074..52391 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 52384..52944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 52925..53086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(53138..54136) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(54267..54878) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(54982..56157) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 56353..58131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 58448..59443 product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(59499..60413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 60686..61006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 61226..61420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 tRNA 61580..61651 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(61753..62346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 62621..62947 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 62958..64388 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 64434..65966 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene yjeM CDS 66116..67573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 67702..69342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 69593..70402 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 70395..71195 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 71219..71695 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 71711..72547 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 72560..73468 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355340.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene murQ CDS 73543..74334 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088270774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 74485..75549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 75553..76182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 76214..77026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(77083..77757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 78011..80548 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(80618..81853) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(81866..82678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(83136..84044) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895747.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene htpX CDS complement(84057..84605) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 85359..86435 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101633.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 86669..87493 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 87683..89455 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 89595..90113 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(90129..90755) product NUDIX hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(90816..91643) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(91947..92684) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 92804..93184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 93210..95015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 95187..95663 product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 95656..96216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(96444..97043) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966784.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 97162..98586 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 98827..99081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 tRNA complement(99327..99401) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(99473..99691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(99688..100386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 100483..102204 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644665.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 102204..104081 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641422.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 104630..105616 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(105675..107018) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 107173..107754 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 107780..108877 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene prfA CDS 108900..109703 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene prmC CDS 109706..110716 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 110729..111358 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564957.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene upp CDS 111446..112156 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene atpB CDS 112180..112392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 112477..112995 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene atpF CDS 112982..113530 product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene atpH CDS 113546..115093 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene atpA CDS 115111..116028 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 116049..117497 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene atpD CDS 117515..117943 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 118671..118904 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 118930..120252 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene murA CDS 120358..121347 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 121356..121538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 121543..121833 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene yidD CDS 121846..122067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 122080..123282 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 123292..123585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 123689..124546 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(124642..125115) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(125202..125480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(125470..126771) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 126823..127422 product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 127631..127837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 sequence13 source 1..118920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..1061) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 1383..1532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 1543..3636 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 3707..3973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 4206..6893 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(6997..7743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 8115..8369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(8420..9292) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(9724..11514) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene recQ CDS complement(11616..12104) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 12186..12740 product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 12975..13454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 13548..14375 product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 14390..14959 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 15390..16592 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 16589..17224 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 17227..18153 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 18153..18815 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(19020..19910) product ribose transporter RbsU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002447102.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene rbsU CDS complement(20242..21180) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(21205..22164) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(22258..24699) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene parC CDS complement(24710..26713) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene parE CDS 26922..27554 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene plsY CDS 27801..28502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(28577..29239) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 29473..30441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(30505..31383) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(31394..32833) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene hslU CDS complement(32852..33376) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565422.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene hslV CDS complement(33392..34291) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene xerC CDS complement(34291..36378) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene topA CDS complement(36490..37308) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene dprA CDS complement(37358..38131) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(38121..38975) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene ylqF CDS complement(38999..39223) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640574.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(39236..39847) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(39832..40680) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(40724..41566) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 42612..43262 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(43259..43747) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475879.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(43758..44708) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(44719..46623) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(46709..46879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(46951..47415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(47469..48671) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(49176..50015) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(50008..51099) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299925.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(51110..51928) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(51921..52652) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034565176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(52789..54066) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(54235..55656) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene nhaC CDS complement(56512..57759) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565365.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(57831..58106) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(58293..59606) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene der CDS complement(59622..60281) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene cmk CDS complement(60346..61503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(61586..62137) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(62954..63679) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(63666..64211) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene scpB CDS complement(64214..64939) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(64939..65325) product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(65336..66256) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene xerD CDS complement(66269..67138) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(67389..68195) product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(68401..70170) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene pyk CDS complement(70238..71197) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene pfkA CDS complement(71297..74620) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene dnaE CDS 74723..74920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 74958..75338 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(75628..76362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(76426..76608) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene rpmF CDS complement(76696..77010) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(77023..77820) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(77835..78761) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene rnz CDS complement(78775..80703) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(80718..81992) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene obgE CDS 82194..82946 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 82947..83867 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene pfkB CDS 83886..85829 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 86505..87017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 87014..88321 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(88442..88876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 89266..90462 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(90669..91238) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(91606..92124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 92355..92747 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(92835..94202) product PTS glucitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(94317..95156) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene map CDS complement(95175..96992) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene uvrC CDS 97782..97934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(97918..98094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(98069..98665) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(98767..99294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(99431..100135) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(100499..101029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(101169..103094) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576585.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(103098..104027) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene pfkB CDS 104484..105233 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(105257..108130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(108504..108890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(108954..109265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 109473..109934 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(110733..111611) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 111715..113337 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 113720..114685 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563892.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 114970..115749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(116039..116368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(116430..118679) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 sequence14 source 1..103088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..448) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567734.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(524..1405) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene rsmA CDS complement(1392..1973) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene rnmV CDS complement(1976..2737) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2737..4755) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene metG CDS complement(5415..6128) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(6678..7634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 7665..8171 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(8172..9113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(9536..10300) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene fetB CDS complement(10293..10937) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(11204..12271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 12312..14081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 14247..15020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 15302..15757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 15760..16476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 16827..16982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(17026..17757) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(17757..19259) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286343.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(19286..19723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(20392..21408) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene trpS CDS 21741..24014 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene helD CDS complement(24173..24838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 25319..26392 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(26455..27432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 note possible pseudo, internal stop codon CDS complement(27442..28224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 note possible pseudo, internal stop codon CDS complement(28699..29568) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674381.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 29903..30868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 31174..31620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 31649..32419 product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848318.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 tRNA complement(32529..32602) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(32656..33177) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 33294..33944 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701679.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(34470..35264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(35322..36254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(36247..36909) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(36899..37216) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(37275..37451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 38368..39021 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 39034..39672 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 39692..40546 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(41167..42120) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(42328..42531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 43143..43616 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 43627..44178 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262077.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(44122..44337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 44671..45849 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641738.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(45893..47164) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(47181..48182) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(48209..48970) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene fabG CDS complement(48989..50551) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(50573..51121) product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene glpP CDS complement(51204..52013) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 52421..53074 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 53067..53858 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 53982..54431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(54507..55091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 56456..56890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 56899..57333 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(57330..57818) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(57954..58742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(58772..59896) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(60627..61490) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189838.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(61714..62619) product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(62633..63493) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(63486..64697) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(65434..66402) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(66404..67201) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(67211..68335) product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(69065..70333) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564029.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene dltD CDS complement(70337..70576) product D-alanine--poly(phosphoribitol) ligase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene dltC CDS complement(70588..71799) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene dltB CDS complement(71792..73312) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene dltA CDS complement(73333..73482) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640708.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 74789..75640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 75795..76856 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 77147..77794 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(78409..79140) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(79209..80867) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(80947..81129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 81895..82437 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(82493..83176) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(83765..84997) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene codA CDS 85201..86556 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(87035..88453) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 88525..89049 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(89113..89961) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(89967..90500) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(91006..92634) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(93222..94844) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(95532..96140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(96169..97089) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(97207..98316) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(98714..100600) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 100807..100998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(100975..102858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 sequence15 source 1..86328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..1339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2142..3008) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 3146..4807 product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene efbA CDS complement(4834..7236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(7227..8315) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(8339..8860) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704375.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene pyrR CDS complement(8961..9875) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(9859..10320) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene lspA CDS complement(10320..12002) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(11986..12384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 12412..12816 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 12882..13895 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642650.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 14001..14945 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(14942..16057) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594527.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(16778..17470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(17515..18066) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 18134..18772 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene recU CDS 18765..21203 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(21334..21981) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101938.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(21983..22606) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706143.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(23016..23495) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(23891..26701) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(26728..30408) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene addA CDS complement(30401..33898) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 34001..34951 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene mvk CDS 34944..35909 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene mvaD CDS 35934..37013 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 37006..38052 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene fni CDS complement(38049..39401) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(39406..40380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(40737..41498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 42199..42864 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene lepB CDS 42901..43086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(43161..43766) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 43878..44579 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 44590..47142 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(47235..48428) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674878.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(48477..48662) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(48769..49299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(49537..51021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(51033..52265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(52779..54023) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644443.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene pepT CDS complement(54037..54828) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(54828..55517) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(55526..56722) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(57548..58663) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565648.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene rpoD CDS complement(58687..60513) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene dnaG CDS complement(60967..63027) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660846.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene glyS CDS complement(63020..63931) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene glyQ CDS complement(64460..65218) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene recO CDS complement(65218..66132) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674526.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene era CDS complement(66135..66536) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(66640..67110) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene ybeY CDS complement(67126..68103) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(68606..68788) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene rpsU CDS 68913..69734 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(69795..70694) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245775.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(70785..71663) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(71731..72204) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene msrA CDS complement(72250..72693) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene msrB CDS complement(73362..75131) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene aspS CDS complement(75134..76405) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene hisS CDS 77500..78801 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 78903..79430 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 79911..80105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(80205..80600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(80833..81456) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(81459..81896) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene dtd CDS complement(81897..84131) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674533.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(84219..84557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(84568..85317) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(85298..86215) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene prmA sequence16 source 1..52243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(365..1435) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene rsgA CDS complement(1930..2868) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(2861..5293) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(5296..6459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(6520..6861) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(6871..8943) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 9560..10474 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(10546..11466) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(11479..13173) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene argS CDS complement(14055..14996) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene arcC CDS complement(15031..16137) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286711.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(16448..17860) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene arcD CDS complement(18143..19180) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene argF CDS complement(19241..20470) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene arcA CDS complement(20946..21428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 tRNA 21594..21664 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(21770..22318) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(22606..22728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 22915..23070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 23224..23505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(23645..24082) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214357293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(24345..24956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(24965..26338) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(26869..28197) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564632.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene glnA CDS 29104..30081 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(30669..31637) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(31748..34171) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 34750..35442 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563812.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 35492..36739 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 36757..37203 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(37238..37633) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene mscL CDS 37782..38186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 38330..38641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 38725..39222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 39215..39556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 tRNA complement(40019..40103) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 40171..41013 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(41074..42747) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(43712..46126) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene leuS CDS complement(46382..47635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 47716..48366 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(48313..49788) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(49863..51056) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene metK CDS 51224..51898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 sequence17 source 1..47541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..1754) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene lysS CDS complement(1770..2774) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene dusB CDS complement(3431..4312) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene hslO CDS complement(4370..6565) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene ftsH CDS complement(6648..7193) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene hpt CDS complement(7190..8524) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene tilS CDS complement(8585..9001) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(9025..9417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(10063..10302) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(10305..11870) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(11872..15396) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene mfd CDS complement(16025..16582) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene pth CDS 17170..18153 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 18270..18932 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene cbpA CDS complement(19411..19605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(19687..20805) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene ald CDS complement(21230..22342) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene alr CDS complement(22343..22702) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene acpS CDS complement(23414..24961) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(25045..26409) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475711.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 26500..27732 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362074.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(27756..28004) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(28434..29888) product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene eat(A) CDS complement(30027..30311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 note possible pseudo, internal stop codon CDS complement(30414..31523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 note possible pseudo, internal stop codon CDS complement(31770..33050) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(33091..34704) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(34870..35523) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene rpoE CDS complement(35570..36010) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 36744..37556 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390086.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 37556..38899 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 39347..41047 product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene glpD CDS 41679..42089 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene mscL CDS complement(42632..43663) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(43980..44963) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(44978..46366) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene glmU CDS complement(46441..47283) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene purR sequence18 source 1..19396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 2..76 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 89..181 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(259..726) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 tRNA 909..983 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1070..2035) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene dapF CDS complement(2052..3410) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 3534..3725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 3814..5097 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene lysA CDS 5113..5817 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene dapD CDS 5820..6977 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546881.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 6977..7846 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546883.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene dapA CDS 7858..8631 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene dapB CDS 9008..10192 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 10217..11284 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 11738..13060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 13316..15526 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene nrdD CDS 15456..16037 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene nrdG CDS 16320..18119 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(18114..18737) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 tRNA 18863..18935 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 18939..19013 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence19 source 1..15713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..891) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(911..2698) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene fucI CDS complement(2703..4121) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 4306..5088 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588546.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(5194..7536) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(7555..9075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 note possible pseudo, frameshifted CDS complement(9095..9577) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(9607..10311) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643703.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene treR CDS complement(10670..11236) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(11427..11930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 12172..12657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 12738..13409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 tRNA complement(13606..13691) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(13735..13805) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(13825..13898) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(13906..13979) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(13997..14069) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(14076..14160) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(14163..14237) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(14242..14317) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(14338..14413) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(14446..14535) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(14582..14655) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(14662..14751) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(14758..14833) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(14847..14917) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(14967..15042) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(15063..15138) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(15175..15248) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(15256..15331) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(15363..15438) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(15450..15525) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(15537..15623) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(15638..15709) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 sequence20 source 1..6095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1655 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 1665..2267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2264..3040 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674293.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 3033..3641 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566809.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(3809..4462) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(4544..5536) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 5617..6003 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 sequence21 source 1..1823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 196..1757 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence22 source 1..2938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..1893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 438..1814 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene ltrA sequence24 source 1..1564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..1330) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138936980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 sequence25 source 1..1248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(709..1185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 sequence26 source 1..1230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..1151 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330