COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..74734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..965 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1061..1792) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1792..3270) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3444..3881 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4164..5888 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5958..6857) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7054..7701 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7927..8127 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8258..9013 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9024..9482 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9561..10226 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10299..10487 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(10547..11344) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11387..11929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 11950..12471 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 12818..14287 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 14418..15059 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 tRNA 15180..15254 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 15295..15379 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 15383..15457 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(15563..16609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 16772..18007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 note possible pseudo, frameshifted CDS 18067..18684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 note possible pseudo, internal stop codon, frameshifted CDS 18804..19079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19247..20002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 19932..20426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(20470..21792) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 tRNA 22759..22830 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 22843..22918 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(22976..23752) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23847..24755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 24915..25424 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 note possible pseudo, internal stop codon CDS 25653..26330 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26333..26584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 26768..27205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 note possible pseudo, internal stop codon CDS 27549..30182 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238573.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene acnA CDS 30297..31442 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene citZ CDS 31458..32717 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene icd CDS complement(32763..33350) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(33352..33645) product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 33819..33953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(34068..35414) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(35430..35696) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 36026..38875 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39221..39688 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 39706..42180 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 42309..42908 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 43149..46763 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 46807..50454 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rpoC CDS complement(50520..50963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 51485..51898 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rpsL CDS 51913..52383 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rpsG CDS 52511..54607 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene fusA CDS 54933..55241 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rpsJ CDS 55277..55942 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rplC CDS 55961..56587 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene rplD CDS 56587..56874 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene rplW CDS 56903..57748 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rplB CDS 57791..58072 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rpsS CDS 58089..58436 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rplV CDS 58449..59120 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rpsC CDS 59123..59557 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rplP CDS 59547..59753 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rpmC CDS 59777..60043 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene rpsQ CDS 60096..60464 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene rplN CDS 60498..60806 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rplX CDS 60835..61377 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rplE CDS 61396..61581 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 61616..62014 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rpsH CDS 62043..62579 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene rplF CDS 62618..62974 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rplR CDS 62995..63495 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rpsE CDS 63509..63691 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rpmD CDS 63723..64157 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene rplO CDS 64157..65455 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene secY CDS 65484..66143 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 66274..66492 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene infA CDS 66535..66654 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rpmJ CDS 66685..67050 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rpsM CDS 67077..67466 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rpsK CDS 67557..68501 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 68532..68915 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene rplQ CDS 69102..69923 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 69905..70768 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 70768..71568 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 71577..72335 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563878.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene truA CDS complement(72384..73154) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene kduD CDS 73421..73864 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rplM CDS 73878..74270 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene rpsI sequence002 source 1..58703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..1771) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(2320..2874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(3283..3717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(3757..4002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(4027..5304) product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(5335..5637) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(5657..6739) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(6751..7206) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 7362..9434 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642905.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 9521..9838 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 9991..10440 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 10610..10795 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 10816..11250 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(11299..12426) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 12607..12897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 12890..13156 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(13292..13630) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(13661..13924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 14093..14260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(14196..14858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(14931..15602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 15776..16096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(16142..16888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(16987..17673) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 17846..18025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 18470..19048 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(19125..20963) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene lepA CDS complement(21065..21529) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene ribH CDS complement(21542..22720) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(22710..23315) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene ribE CDS complement(23316..24374) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene ribD CDS complement(24699..25136) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(25145..25504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 note possible pseudo, frameshifted CDS complement(25488..26054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 note possible pseudo, frameshifted CDS complement(26038..26181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 note possible pseudo, frameshifted CDS complement(26264..27205) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(27226..28029) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(28155..30674) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(30806..31132) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(31463..32608) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene dnaJ CDS complement(32872..34731) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene dnaK CDS complement(34771..35340) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene grpE CDS complement(35355..36395) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene hrcA CDS 36623..37000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(37041..37838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 37969..38517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(38514..39236) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(39214..39900) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 40058..40516 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 40679..40813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(40892..41848) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene ribF CDS complement(41860..42765) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene truB CDS complement(42931..43287) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rbfA CDS complement(43376..46006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(46021..46326) product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(46319..46615) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(46644..47732) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene nusA CDS complement(47751..48224) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rimP CDS complement(48345..48620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 note possible pseudo, frameshifted CDS complement(48638..49063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 note possible pseudo, internal stop codon, frameshifted CDS 49134..49364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(49312..53622) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(53703..55415) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(55447..56718) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene rseP CDS complement(56755..57540) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(57575..58351) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 sequence003 source 1..55262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..976) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(973..2091) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(2299..2928) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene upp CDS complement(3004..4236) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(4313..5323) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(5329..6186) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene prmC CDS complement(6179..7261) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene prfA CDS complement(7283..7822) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 8002..8424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 8522..9865 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 9865..10572 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(10613..10774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(10808..12415) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(12513..13526) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(13542..15377) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(15370..17112) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(17146..17592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 17904..19238 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(19399..20436) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(20623..20793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 21001..22323 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 tRNA complement(22390..22464) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(22518..22847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 tRNA 22980..23054 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 23529..23714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(23781..24119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(24106..24390) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(24448..25974) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137615044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(25974..27143) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(27222..28925) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(28925..29395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(29542..29952) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(30019..30435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(30439..30786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(31018..33489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(33476..33772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(33774..34076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(34359..34628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 34813..35409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 35463..36608 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 36791..37201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(37402..37695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 note possible pseudo, internal stop codon CDS complement(37711..38328) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(38476..38847) product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene fra CDS complement(38865..39272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(39502..40023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(40116..40619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 40878..41846 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 41999..42907 product IS982-like element ISEfm1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137601194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 42963..43460 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(43497..44180) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 44379..45341 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(45410..46759) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(46837..47715) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(47906..49384) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642756.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(49381..50103) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(50341..51525) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(51774..52313) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 52421..52966 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 52971..53864 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene rarD CDS 53878..55032 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 sequence004 source 1..52477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..1054) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene whiA CDS complement(1070..2077) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(2074..2958) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rapZ CDS complement(3061..4443) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene argH CDS complement(4443..5666) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(5855..6328) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(6389..9226) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene uvrA CDS complement(9251..11254) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene uvrB CDS complement(11367..12008) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(12056..13780) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(14076..16061) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 16299..16907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(16935..17876) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene trxB CDS complement(18028..18927) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene galU CDS complement(18978..19994) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(20018..20845) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene lgt CDS complement(20852..21787) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene hprK CDS complement(21806..22165) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641006.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(22178..22501) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(22611..23678) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene prfB CDS complement(23791..26154) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene secA CDS complement(26339..26896) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene raiA CDS complement(27016..27699) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(27680..29017) product DNA/RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 29081..29719 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(29754..31589) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(31856..33478) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene groL CDS complement(33544..33828) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene groES CDS complement(33970..34617) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 34779..36686 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(36683..37696) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene tsaD CDS complement(37699..38253) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rimI CDS complement(38261..38986) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene tsaB CDS complement(39113..40105) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene galE CDS complement(40161..40910) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(40931..41794) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene rsmI CDS complement(41947..42285) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(42300..43313) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene holB CDS complement(43331..43663) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(43700..44338) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene tmk CDS complement(44362..44580) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(44596..45195) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene recR CDS complement(45205..45516) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(45538..47298) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene dnaX CDS complement(47573..48067) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene tadA CDS complement(48073..48681) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 48902..49132 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene nrdH CDS 49219..51384 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene nrdE CDS 51402..52394 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene nrdF sequence005 source 1..50041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 note possible pseudo, internal stop codon CDS complement(557..832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 note possible pseudo, internal stop codon CDS complement(867..1514) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(1946..2863) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 3084..5108 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 5114..5566 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rplI CDS 5586..6971 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene dnaB CDS 7038..8213 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(8548..8718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 note possible pseudo, internal stop codon CDS 8863..9243 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 tRNA complement(9330..9404) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 9685..10386 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene yycF CDS 10401..12266 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene walK CDS 12247..13557 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene yycH CDS 13575..14411 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 14425..15231 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 15318..16616 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 17259..17738 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rlmH CDS complement(17782..18438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(18454..18879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 19012..20958 product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 21592..22974 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 22988..23449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 23716..23898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 23891..24736 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160994791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 24759..25388 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 25388..26683 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 26855..27709 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 28035..29240 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 29320..29502 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 29684..30250 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 30263..30571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(30632..31111) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(31172..32338) product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 32667..33059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 note possible pseudo, internal stop codon CDS 33201..33596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 note possible pseudo, internal stop codon CDS complement(33659..33799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 34031..35824 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 35930..36601 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(36603..36881) product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 37300..38235 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 38417..39079 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(39147..39800) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 40125..41861 product multidrug efflux ABC transporter LmrCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene lmrC CDS 41867..43963 product multidrug efflux ABC transporter LmrCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene lmrD CDS 44201..44575 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 44572..45189 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 45235..45450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 45559..46146 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(46147..46908) product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 47201..47677 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 note possible pseudo, internal stop codon CDS 47689..48156 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 48159..48596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 48664..49287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 49311..49700 product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 sequence006 source 1..48484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 372..1247 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 1251..2138 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene xerD CDS 2179..2541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 2531..3325 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 3303..3917 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene scpB CDS 3889..4617 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 4917..5495 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 5640..6665 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 6658..8103 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 8165..8701 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 8717..9400 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene cmk CDS 9474..10679 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rpsA CDS 10760..12070 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene der CDS 12444..12719 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 12859..14118 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(14224..15054) product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644416.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 15218..15988 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene dapB CDS 15985..17199 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 17201..19084 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 19105..20067 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 20135..20617 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene folA CDS complement(20614..21249) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 21422..22264 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 22353..23279 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 23291..23899 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 23909..24130 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 24140..25024 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ylqF CDS 25008..25772 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 25819..26679 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene dprA CDS 26761..28878 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene topA CDS 28937..29854 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene xerC CDS 29854..30732 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(30795..31409) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene plsY CDS 31647..33746 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene parE CDS 33767..36214 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene parC CDS 36402..37412 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 37432..38361 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 38514..39032 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene msrA CDS 39056..39907 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 39907..40290 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 40316..41149 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 41176..42150 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 42449..43810 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 43853..46108 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476250.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 46222..46893 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene pgmB CDS 47003..47512 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 47670..48173 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 48188..48403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 sequence007 source 1..48074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..770) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 963..1181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 1120..1677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 note possible pseudo, frameshifted CDS 1885..3081 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(3179..3382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(3405..3695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(3951..4319) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rplL CDS complement(4371..4871) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rplJ CDS complement(5056..5748) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rplA CDS complement(5841..6266) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rplK CDS complement(6400..6948) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene nusG CDS complement(7061..7240) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene secE CDS complement(7480..8046) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(8327..9082) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rlmB CDS complement(9079..9483) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(9485..10891) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene cysS CDS 11218..11766 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(11831..13318) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene gltX CDS complement(13410..14552) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(14579..15949) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene radA CDS complement(15972..16508) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 16647..16931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 16996..18327 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(18398..19069) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(19239..20018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(20247..21185) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(21313..22260) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(22361..23116) product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene accA CDS complement(23119..23907) product acetyl-CoA carboxylase carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(23888..25225) product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(25230..25595) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(25601..26572) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 tRNA complement(26703..26790) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(26844..27284) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(27288..29462) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(29584..30408) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene nadE CDS complement(30421..31887) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(32040..32696) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(32711..34165) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(34570..35271) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(35323..36456) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene nagA CDS complement(36478..37272) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene proC CDS complement(37479..37949) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 note possible pseudo, internal stop codon CDS complement(38044..39516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(41125..42012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(42108..43235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 43629..44570 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(44615..46690) product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 46899..47984 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 sequence008 source 1..47798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(953..2305) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 2462..6010 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 6010..9726 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene addA CDS complement(9982..10956) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 11221..12525 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 12525..13823 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene purB CDS 13937..14617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 14783..15184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 15391..16743 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 17222..17701 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 17705..18772 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 18778..19449 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 19466..20323 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 20343..20816 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 20828..21598 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 22152..23135 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 23156..23617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 23636..24769 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 24781..25206 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 25222..26220 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 26234..27286 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 27312..28148 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 28157..28957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 28954..29712 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 30140..31324 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 31380..32678 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 32846..33775 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 33864..34523 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 34504..35193 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 35186..35923 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 36207..37061 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 37120..37272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 37451..38542 product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 38653..39087 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 39209..39418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 39702..40538 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 40916..41938 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 41938..42600 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 42724..43509 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 43577..44755 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 44858..45817 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 46102..47403 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 sequence009 source 1..47670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..1655) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(1744..2175) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(2185..2655) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 2744..3637 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(3625..4287) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 4402..4677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 4791..6923 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(6972..7970) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 8144..9103 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 9393..9974 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 9967..11352 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 11349..12002 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 12072..12401 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 12506..12958 product transcriptional regulator SylA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene sylA CDS 12967..13488 product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene paiA CDS 13498..13659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 13737..13949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 note possible pseudo, frameshifted CDS complement(14000..14491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(14515..15888) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 16054..16761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 note possible pseudo, internal stop codon CDS 16804..18009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 note possible pseudo, internal stop codon CDS complement(18101..18943) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 19049..19966 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 20010..20429 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 20446..21300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(21545..22027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(22031..22426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(22511..23521) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 23751..24197 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(24293..25738) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(25773..27311) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(27313..27864) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(27969..29222) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(29215..30111) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 30278..30472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 30591..31502 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(31721..32506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(32499..33212) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(33205..33582) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(33718..35007) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene purD CDS complement(35425..36954) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene purH CDS complement(37133..37711) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101893.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene purN CDS complement(37704..38744) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene purM CDS complement(38737..40215) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene purF CDS complement(40200..42395) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene purL CDS complement(42430..43104) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene purQ CDS complement(43109..43369) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene purS CDS complement(43362..44090) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(44093..45229) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene purK CDS complement(45210..45695) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene purE CDS complement(45887..46147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 note possible pseudo, frameshifted sequence010 source 1..42780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..705) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene leuD CDS complement(705..2078) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene leuC CDS complement(2059..3138) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene leuB CDS complement(3142..4302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(4693..5322) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 5409..5819 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(5873..6481) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(6737..7054) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(7217..8620) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene sufB CDS complement(8613..9068) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(9055..10293) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(10274..11569) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene sufD CDS complement(11572..12390) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene sufC CDS complement(12683..12868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 12930..17390 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene gltB CDS 17714..19147 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(19296..20210) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(20236..21045) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(21070..22044) product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(22250..22636) product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(23351..24541) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(24543..25619) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene serC CDS 26210..27199 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene trpX CDS 27199..28098 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 28091..28855 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 29068..30762 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(30826..31326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(31319..31465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 31459..32232 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 32353..33543 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 33533..34363 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene nadC CDS complement(34408..34671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(34689..35393) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(35541..36404) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642723.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(36417..37055) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(37567..37884) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene trxA CDS complement(37865..38632) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(38656..39570) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(39582..40559) product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 40652..41572 product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 41792..42523 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 sequence011 source 1..41936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..1292) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene metK CDS complement(1614..1799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 1753..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(2302..2835) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(2969..3505) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(3621..4979) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 5400..5663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(5752..6192) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(6305..7828) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(7912..9240) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(9255..9929) product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(9929..10603) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene fsa CDS complement(10630..12057) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(12039..12218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(12494..13864) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(14265..15221) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene manA CDS 15455..16411 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(16438..16770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(16836..17015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(17231..19225) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene tkt CDS complement(19664..20866) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(20890..21639) product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene pxpA CDS complement(21658..22446) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(22439..23767) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene accC CDS complement(23785..24195) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene accB CDS complement(24209..25210) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(25210..25932) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene pxpB CDS complement(26367..27068) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene phoU CDS complement(27081..27836) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene pstB CDS complement(27848..28624) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene pstB CDS complement(28637..29524) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene pstA CDS complement(29524..30426) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene pstC CDS complement(30438..31298) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(31444..32301) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 32497..33231 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(33212..33373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(33484..34638) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(34660..35781) product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(36242..36898) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(37476..38057) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene nrdG CDS complement(37993..40215) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene nrdD CDS 40638..41006 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 tRNA complement(41137..41222) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(41241..41311) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(41406..41479) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(41494..41565) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(41573..41656) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(41660..41734) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(41783..41857) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(41863..41935) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 sequence012 source 1..41658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..648) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(720..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(1296..2573) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(2589..3044) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 3119..3715 product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(3775..4383) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rpsD CDS complement(4580..5035) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 5182..6876 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ezrA CDS 7154..8302 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 8318..9538 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene thiI CDS 9676..10170 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene tpx CDS 10470..13127 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 13221..14519 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 14564..15181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 15340..16341 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 16446..17294 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene mreC CDS 17309..17848 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene mreD CDS 18311..18955 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 18970..19620 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 19639..20481 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 20541..21986 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene cls CDS complement(22085..23449) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 23636..24889 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 24891..26189 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 26287..27195 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 27222..27806 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene pgsA CDS 27895..29136 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 29231..30277 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene recA CDS 30696..32255 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene rny CDS 32376..34973 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene mutS CDS 35007..36953 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene mutL CDS 37062..37655 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene ruvA CDS 37675..38691 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene ruvB CDS 38697..39734 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene queA CDS 39828..40970 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene tgt CDS 41042..41455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence013 source 1..38727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..891) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene trpA CDS complement(884..2089) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene trpB CDS complement(2082..2660) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(2663..3442) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene trpC CDS complement(3439..4455) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene trpD CDS complement(5178..5765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(5765..7207) product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 8056..8565 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 8590..8817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(8949..9683) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(9687..10379) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(10402..11208) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(11580..12383) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119327301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(12523..13011) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(13014..13340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 13496..14368 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 14438..15070 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(15280..16344) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene hisC CDS complement(16381..16707) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene hisE CDS complement(16740..17075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, internal stop codon, frameshifted CDS complement(17072..17830) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene hisF CDS complement(17830..18543) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene hisA CDS complement(18524..19150) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene hisH CDS complement(19150..19734) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene hisB CDS complement(19734..20999) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene hisD CDS complement(21048..21686) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene hisG CDS complement(21683..22831) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene hisZ CDS complement(23434..23745) product MazG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(23754..24593) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene hisJ CDS complement(25130..26053) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(26073..26474) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 26571..26843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 26734..27132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(27150..28385) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(28742..30115) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 30305..30799 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 30908..31273 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(31293..32234) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 32327..32803 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 32804..33082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(33188..33556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(33575..34090) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 34233..35003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(35040..36140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 36423..38516 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 sequence014 source 1..38380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(721..1683) product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(1670..3559) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(3874..4062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(4224..4772) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(4777..5019) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(5120..7027) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 7292..8539 product chloride channel family chloride transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(8597..9151) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(9274..10233) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 10511..11386 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 11427..11798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 11938..12102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 12121..12417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 12530..12781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 12914..13201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(13358..15622) product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene gshAB CDS complement(15799..16578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(16591..17178) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(17376..19196) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(19292..19564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(19598..19969) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(20222..20638) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(20670..21473) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene lgt CDS complement(21488..22843) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050761141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(22840..23532) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(23756..25207) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(25225..27309) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(27312..27512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(27499..27885) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(27959..28429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 28686..29087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 29362..29712 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 29699..30061 product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene arsD CDS 30145..31875 product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene arsA CDS 31932..33227 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 33244..33573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 33603..33893 product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 33916..35340 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 35623..36015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 36096..36293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 36702..37019 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 37292..38365 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 note possible pseudo, frameshifted sequence015 source 1..37997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 507..1682 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 1842..2366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 2487..2708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(2769..3428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 3596..4285 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 4296..5663 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 5820..6443 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 6454..7095 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 7058..7240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(7194..7919) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(8216..8374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 8576..9499 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(9579..10301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(10298..11452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(11551..12081) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 12338..12652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 12836..14008 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(14060..14353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 14734..15750 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 15826..16224 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 16318..16449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 16437..17228 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 note possible pseudo, frameshifted CDS 17355..17495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 17754..17939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(17941..18360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(18610..19296) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 19415..20263 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(20336..20788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(20980..21300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, internal stop codon CDS complement(21343..21744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 note possible pseudo, internal stop codon CDS 22236..22685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 22696..23970 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 23993..24463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 24519..25493 product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 25739..26743 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 26949..27956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 27979..29514 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 29511..30395 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 30411..31139 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(31196..32716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 32917..33990 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene ulaG CDS 34028..34501 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 34523..36034 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 36085..36390 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 36401..37036 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 37042..37905 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 sequence016 source 1..37665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(301..1758) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(1995..2861) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene thrB CDS complement(2943..4226) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 4336..5823 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene thrC CDS 5998..6162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 6206..6622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 note possible pseudo, internal stop codon, frameshifted CDS 6632..7747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 note possible pseudo, internal stop codon CDS 8071..8376 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 8539..9513 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 9579..10799 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(11002..11382) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(11412..11861) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 11989..13533 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 13562..13891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(13967..14989) product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(15047..15673) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(15816..18287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(18320..18853) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(19074..19985) product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 20103..21077 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 21070..21618 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(21581..24013) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 24141..25226 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 25230..26045 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 26042..26866 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 26863..27933 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(28107..29504) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(29780..31186) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(31197..31619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(31755..33146) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 33268..33693 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 33703..34257 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 34344..34781 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 34952..35350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 35363..36181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 36340..37539 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 sequence017 source 1..35711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..3039) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene ileS CDS complement(3340..4038) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(4055..4807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(4820..5611) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(5624..5908) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(5924..6346) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene sepF CDS complement(6441..7649) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene ftsZ CDS complement(7675..9051) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene ftsA CDS complement(9201..10082) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(10114..11211) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene murG CDS complement(11208..12584) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene murD CDS complement(12602..13561) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene mraY CDS complement(13580..15724) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(15724..16113) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene ftsL CDS complement(16138..17088) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rsmH CDS complement(17109..17537) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene mraZ CDS complement(17685..18050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 18140..19099 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 19160..19285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(19328..21646) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645941.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(21696..22211) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(22401..23249) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(23246..24433) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 24551..25579 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(25653..27038) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(27368..28717) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene mgtE CDS complement(28720..29607) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(29604..30413) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(30430..31104) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 31349..31972 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(31981..33027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(33105..34379) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(34404..35249) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene metA sequence018 source 1..35592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 note possible pseudo, frameshifted CDS complement(483..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 note possible pseudo, frameshifted CDS complement(788..1141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 note possible pseudo, internal stop codon CDS complement(1160..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 note possible pseudo, internal stop codon CDS complement(1858..2373) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 2800..3519 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 3519..4616 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 4707..5381 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 5403..8144 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 8244..8495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 8661..9752 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene asd CDS 10042..10491 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 10508..10882 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 10993..11199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 note possible pseudo, internal stop codon CDS 11199..13088 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(13116..14174) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(14300..14746) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 14893..15753 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 15766..16704 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 16701..18218 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 18234..18731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 note possible pseudo, frameshifted CDS 18709..19185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 note possible pseudo, frameshifted CDS 19408..20823 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 20823..21857 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene cydB CDS 21847..23571 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene cydD CDS 23564..25288 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene cydC CDS complement(25285..26262) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 26352..27254 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 27267..28475 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(28569..28961) product DUF1398 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(29040..30044) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 30183..30728 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(30763..31578) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene thiD CDS complement(31758..33206) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 33391..33963 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 34093..34968 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 34987..35469 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 sequence019 source 1..28192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..839 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 920..1624 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 1614..1949 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 2205..3167 product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(3225..3839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(3869..4750) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 4826..5302 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(5332..6285) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(6448..7068) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(7074..7784) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(7784..8560) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(8562..9524) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(9534..10412) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(10638..11825) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 12053..12433 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 12430..12951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 12951..13298 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene crcB CDS complement(13592..14776) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(15522..16211) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(16235..17059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 note possible pseudo, internal stop codon, frameshifted CDS complement(17257..18075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(18528..19478) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(19491..20459) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(20452..21942) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(21954..22349) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rbsD CDS complement(22500..23180) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rpiA CDS complement(23199..24119) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene rbsK CDS complement(24213..25229) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002414145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(25374..26318) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 26460..28073 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 sequence020 source 1..6843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(392..976) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(1183..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(1639..2526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(2536..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 3051..3752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 3907..4347 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(4366..5532) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(5635..6564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 sequence021 source 1..30534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(708..2978) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene helD CDS 3285..4301 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene trpS CDS 4688..5626 product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 5641..6885 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 6885..7835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 7841..8539 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 8594..8911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 8924..9763 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 9899..11920 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene metG CDS 12237..13031 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 13033..13602 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene rnmV CDS 13595..14488 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene rsmA CDS 14576..14854 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 15013..15864 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ispE CDS 16117..17031 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 17056..18216 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 18237..18767 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene cysE CDS 18891..19559 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 19559..20347 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 20557..21399 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene purR CDS 21403..22770 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene glmU CDS 22836..23819 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 23946..24500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 24747..26093 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(26152..26973) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene yidA CDS complement(26991..28340) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(28337..29143) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643833.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 29276..29716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 29762..30373 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rpoE sequence022 source 1..28918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..965) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1087..1539) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1593..2321) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 2563..3069 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 3122..3763 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 3848..4312 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 4382..4993 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(5084..5482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(5600..5875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(5991..7421) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene gndA CDS complement(7557..8243) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 8405..9019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 9218..9835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 note possible pseudo, internal stop codon CDS 9854..10498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, internal stop codon CDS 10586..10828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, internal stop codon CDS complement(10913..12391) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene zwf CDS complement(12609..13784) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(13807..15330) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene glpK CDS 15474..15905 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 16007..17167 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 17400..18791 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 19098..20495 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 20575..21213 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(21492..22334) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 22485..23393 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene gnd CDS 23764..24846 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 25056..25925 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 25929..26447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 26511..27317 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene proB CDS 27338..28579 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 tRNA 28673..28747 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence023 source 1..27475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 366..3152 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 3145..4863 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 4872..5498 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene casB CDS 5498..6574 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cas7e CDS 6555..7265 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene cas5e CDS 7279..7947 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene cas6e CDS 7952..8905 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene cas1e CDS 8902..9804 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene cas2e repeat_region 9834..10533 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccccgcacacgcgggggtgatcc CDS 10667..11590 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(11888..12220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(12515..14179) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene ade CDS complement(14390..15625) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 15732..16847 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene wecB CDS 16920..17195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 17200..17562 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(17609..18013) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(18029..18478) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 18616..19398 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene map CDS 19595..19987 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787700.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 19977..21800 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 21923..22819 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 22949..24088 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(24133..24369) product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(24404..24610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 24780..25505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 25616..26407 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene recX CDS 26429..27361 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 sequence024 source 1..27210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..699) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene lepB CDS complement(758..2005) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(2034..3935) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene asnB CDS complement(3995..5524) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 5762..7267 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 7328..8311 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 8853..9467 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(9528..10751) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(10956..12863) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene mnmG CDS complement(13239..14627) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene mnmE CDS complement(14764..15057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(15023..15493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(15527..16273) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(16426..17256) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene yidC CDS complement(17260..17613) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene rnpA CDS complement(17668..17802) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rpmH CDS 18298..19614 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene dnaA CDS 19780..20919 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene dnaN CDS 21164..21388 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene yaaA CDS 21397..22515 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene recF CDS 22563..24506 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene gyrB CDS 24532..27069 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene gyrA sequence025 source 1..27195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..835) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(893..1546) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rpe CDS complement(1557..2447) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene rsgA CDS complement(2460..4355) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene pknB CDS complement(4370..5101) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(5113..6465) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene rsmB CDS complement(6458..7405) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene fmt CDS complement(7419..9836) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene priA CDS complement(9845..11035) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene coaBC CDS complement(11160..11360) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rpoZ CDS complement(11360..11977) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene gmk CDS 12165..12497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(12553..13212) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(13212..14138) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(14152..14781) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(14774..15952) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016527072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(15996..17672) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene recN CDS complement(17692..18147) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(18150..18983) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(18995..19885) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(19888..20118) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(20122..21462) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene xseA CDS complement(21452..22315) product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(22430..22840) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene nusB CDS complement(22840..23271) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(23304..23864) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene efp CDS complement(23933..25000) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(25074..25355) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rpmA CDS complement(25374..25703) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(25718..26026) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rplU CDS 26313..26501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 26572..27090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 sequence026 source 1..26684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 630..1382 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1845..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 note possible pseudo, internal stop codon CDS 2367..3353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 note possible pseudo, internal stop codon CDS 3877..4512 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 4522..5100 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 5124..6245 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(6255..7205) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 7307..8062 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 8199..10445 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene pcrA CDS 10745..12781 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene ligA CDS 12778..13905 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 14483..14794 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene gatC CDS 14794..16263 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene gatA CDS 16263..17690 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene gatB CDS 17712..18758 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(18946..19068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 19494..21527 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 21613..22299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 22330..23655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 23762..25126 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rlmD CDS 25152..25286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(25347..25991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 misc_feature complement(26109..>26684) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003563775.1:alpha/beta hydrolase locus_tag LOCUS_10630 sequence027 source 1..25521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..316) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rpmF CDS complement(366..926) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1007..2140) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(2150..2887) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(2890..3246) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rsfS CDS complement(3258..3854) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene yqeK CDS complement(3847..4479) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(4494..4805) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene yhbY CDS complement(4822..5955) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene yqeH CDS complement(5948..6478) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(6633..6986) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rplT CDS complement(7016..7210) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene rpmI CDS complement(7228..7734) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene infC CDS complement(8121..9050) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene dnaI CDS complement(9053..10405) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(10427..10876) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene nrdR CDS complement(10882..11493) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene coaE CDS complement(11496..12329) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene mutM CDS complement(12356..15016) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene polA CDS complement(15104..15823) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(16038..17369) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene murC CDS complement(17395..17775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(17808..18446) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(18513..18830) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 18976..19305 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(19676..20329) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene trmB CDS complement(20342..21553) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(21546..22283) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 22416..22841 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 22846..23094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 23277..24251 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(24371..24979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 note possible pseudo, frameshifted CDS complement(24934..25254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 note possible pseudo, frameshifted sequence028 source 1..25393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1009) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1129..1863) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1875..2744) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(2917..3831) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(4120..4851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 5094..5660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 5873..6211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(6317..7459) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(7686..8456) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642428.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(8829..9929) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene ychF CDS complement(9989..10192) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(10207..11085) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(11072..11842) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(11857..12801) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene noc CDS complement(12811..13545) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene rsmG CDS complement(13759..14670) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene rihC CDS complement(14965..16209) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(16653..17402) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(18642..20447) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene thrS CDS complement(20904..22259) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 22764..23612 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(23725..25026) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene serS sequence029 source 1..24618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 tRNA complement(875..949) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(1045..2373) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(2385..3386) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 3551..3916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(4153..4365) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(4375..4830) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(4902..5654) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 5893..7443 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene gntK CDS 7766..8821 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 8806..9459 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(9512..10405) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(10420..10743) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(10759..12165) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene sufB CDS complement(12165..12623) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(12601..13848) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(13829..15115) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene sufD CDS complement(15127..15921) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene sufC CDS 16205..16432 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 16434..18422 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene feoB CDS 18434..18601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(18625..19176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(19350..20621) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene preA CDS complement(20621..21853) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene preT CDS complement(22467..23966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 24060..24419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 note possible pseudo, internal stop codon, frameshifted sequence030 source 1..24267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..467) product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644385.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 502..900 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(882..1982) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(2114..2713) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(2805..3935) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(4403..4780) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene gpsB CDS complement(4851..5423) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 5504..6112 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644374.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene recU CDS 6124..8397 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(8456..9169) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(9194..9694) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(9753..12566) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 12741..13694 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene mvk CDS 13687..14667 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene mvaD CDS 14694..15764 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 15787..16818 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene fni CDS complement(16846..18201) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 18364..19176 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(19246..20751) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene glpK CDS complement(20778..22085) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene lysA CDS complement(22170..22355) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 22494..23906 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 23923..24177 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 sequence031 source 1..23737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(891..1922) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 2195..3370 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 3553..4890 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene xylA CDS 4997..6499 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene xylB CDS 6640..7197 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 7376..8548 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 8552..9538 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 9676..10557 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(10842..12116) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene hflX CDS complement(12142..12795) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(12867..13517) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162685289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 13705..15996 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene helD CDS 16281..18395 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 18555..19475 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene coaA CDS 19561..21120 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene guaA CDS 21509..21739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 note possible pseudo, internal stop codon CDS 21815..22378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 note possible pseudo, internal stop codon CDS 22415..23038 product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 23031..23612 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 sequence032 source 1..23598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..865) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(948..1262) product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1434..2258) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(2248..3483) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(3498..4556) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(4560..5810) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene dltD CDS complement(5807..6040) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene dltC CDS complement(6062..7267) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dltB CDS complement(7269..8795) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene dltA CDS complement(8812..8958) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(9062..10432) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(10449..11147) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(11390..11860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 11950..12342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 note possible pseudo, frameshifted CDS 12339..12542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(12788..13432) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(13448..14281) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(14489..15511) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 15618..16439 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(16532..19699) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(19701..20864) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 tRNA complement(21216..21286) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(21356..21586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(21651..23009) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 23182..23517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 sequence033 source 1..23410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 515..1105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1157..2458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 2623..3063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 3301..3840 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene pyrR CDS 3994..4923 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 5335..6606 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 6606..7700 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 7693..10875 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene carB CDS 10894..11814 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 11811..12530 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene pyrF CDS 12532..13167 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene pyrE CDS complement(13103..13999) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043926054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 14439..14906 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene nrdI CDS 14910..17081 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene nrdE CDS 17092..18021 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene nrdF CDS 18037..18987 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene nrdF CDS complement(19263..19700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 19866..21410 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 21410..22915 product accessory Sec system glycosyltransferase Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene asp1 sequence034 source 1..23054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..696) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 873..2195 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene eno CDS 2409..2648 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene secG CDS 2708..3478 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 3465..5873 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rnr CDS 5896..6366 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene smpB CDS complement(6405..6986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 7090..7779 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 7813..8784 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene pta CDS 8847..9308 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene tsaE CDS 9298..9795 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(9835..10371) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(10527..11147) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 11319..13952 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ppdK CDS 14091..14984 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene murB CDS 15040..17151 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(17148..17789) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 17944..18786 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene cdaA CDS 18779..19621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 19658..21007 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene glmM CDS 21141..22961 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene glmS sequence035 source 1..21510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1037..1750) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene budA CDS complement(1772..3451) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene alsS CDS 3712..4170 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054399313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(4227..4934) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(4924..5139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 5270..5581 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 5581..6210 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 6213..6467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 6470..7327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(7636..8238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 8349..8717 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene mscL CDS 8875..9507 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(9523..10803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(10906..11406) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(11505..12905) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene pepV CDS 13035..13859 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(13881..14588) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(14598..16241) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 16476..16907 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 16904..17353 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(17412..19829) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene leuS CDS 20197..20826 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 20829..21386 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 sequence036 source 1..21375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..2630) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(2899..3627) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 3753..4247 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene ybaK CDS 4259..5023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(5063..6016) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(6040..6870) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(7005..7661) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(7811..8776) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(8793..9548) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 10118..10513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(10690..10944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 note possible pseudo, internal stop codon, frameshifted CDS complement(10944..11462) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(11462..12313) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(12564..13859) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene aroA CDS complement(13872..15047) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene aroC CDS complement(15064..16134) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene aroB CDS complement(16127..17152) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644102.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene aroF CDS complement(17172..18050) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene aroE CDS 18713..18952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 18977..20404 product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 20520..21284 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene aroD sequence037 source 1..21018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 note possible pseudo, internal stop codon CDS complement(592..1890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 note possible pseudo, internal stop codon CDS complement(1903..2364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 note possible pseudo, internal stop codon CDS complement(2431..2661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 note possible pseudo, internal stop codon CDS complement(2823..3569) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 3857..4000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(4070..4363) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(4363..4956) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene yihA CDS complement(5040..6287) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene clpX CDS complement(6457..7782) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene tig CDS complement(7941..9131) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene tuf CDS complement(9316..10239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(10317..12032) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(12053..12925) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene dapA CDS complement(13086..13355) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene rpsO CDS 13600..13854 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene rpsT CDS complement(13941..14966) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101660.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene holA CDS complement(14936..17068) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(17237..17716) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(17793..18425) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(18476..19516) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(19518..20000) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene coaD CDS complement(19997..20563) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rsmD CDS complement(20563..20847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence038 source 1..20888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..904) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(950..2119) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 2568..3800 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031263459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene gdhA CDS 4037..4549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 4840..6261 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 6401..7786 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(7847..8362) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(8372..9517) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(10003..10761) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 11157..11690 product amino acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 11817..12344 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 12625..15231 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene adhE CDS 16411..18018 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 18210..18938 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 18895..19107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 19319..20716 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 sequence039 source 1..20605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..1363 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1562..2284 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene atpB CDS 2308..2520 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564959.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene atpE CDS 2556..3068 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene atpF CDS 3068..3610 product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene atpH CDS 3638..5158 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene atpA CDS 5191..6114 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 6141..7544 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene atpD CDS 7556..7972 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 8119..8349 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 8369..9679 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene murA CDS 9734..10711 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 10721..10963 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene yidD CDS 10972..11193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 11220..12419 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 12438..12743 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 13131..14171 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 14164..14850 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 14875..15696 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645414.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 15948..16919 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 17022..18173 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 18234..19664 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 19682..20530 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 sequence040 source 1..19547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..1913) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene aspS CDS complement(1919..3214) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene hisS CDS 3716..4570 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 4657..5493 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(5533..6156) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(6516..6953) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene dtd CDS complement(7073..9313) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(9455..9811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(9818..10516) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(10588..11541) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene prmA CDS complement(12253..12612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 12839..15673 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 15677..16042 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(16112..16372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(16524..17426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS complement(17501..17809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 note possible pseudo, frameshifted CDS complement(17917..18537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(18665..19426) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 sequence041 source 1..19485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 repeat_region 1393..5564 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tctcgaactcattgatttgatactcttctaaaac CDS complement(5595..6266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(6263..6568) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene cas2 CDS complement(6546..7451) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene cas1 CDS complement(7653..11729) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene cas9 CDS complement(11862..12071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 12201..12455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 note possible pseudo, internal stop codon CDS 12513..12668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 note possible pseudo, internal stop codon CDS complement(12716..13666) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101033.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 13971..15362 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 15349..16365 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 16375..17295 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene rbsK CDS complement(17407..17670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(17856..19244) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 sequence042 source 1..19079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..784 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 881..1009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1113..1784) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1789..2835) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(2875..3264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 3309..3575 product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(3653..4519) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(4599..4856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(4876..6846) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 7003..8454 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 8472..9449 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 9470..11146 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(11303..11560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 note possible pseudo, internal stop codon, frameshifted CDS complement(11665..12150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 note possible pseudo, internal stop codon, frameshifted CDS complement(12206..12649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(12733..13044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 13525..14412 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 14480..15514 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 15756..16193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(16590..16928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(17641..17841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(17892..18596) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 sequence043 source 1..17710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(231..1436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1439..2332) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(2348..3334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(4005..5180) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(5205..6164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(6191..7615) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(7617..8738) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene glf CDS complement(8754..9518) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(9515..10594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(10582..11946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(11951..12583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(12601..13215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 13673..14065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(14498..16192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(16306..17385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 sequence044 source 1..17607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..795) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(833..1507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1630..2007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(2363..3493) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mutY repeat_region 3647..4210 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcgtaactcatatttttaccaagcttctaaaac CDS complement(4238..4912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(4909..5214) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene cas2 CDS complement(5192..5899) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene cas1 note possible pseudo, frameshifted CDS complement(5889..6098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 note possible pseudo, frameshifted CDS complement(6318..8285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 8560..9375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 note possible pseudo, frameshifted CDS 9363..9725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 note possible pseudo, internal stop codon, frameshifted CDS 9840..10043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 tRNA complement(10168..10255) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(10330..13554) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(13569..14447) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 14569..14934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 note possible pseudo, internal stop codon CDS 14938..15426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 note possible pseudo, internal stop codon CDS 15505..16236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 note possible pseudo, internal stop codon CDS complement(16284..16583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(16576..16992) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(17007..17519) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 sequence045 source 1..17538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..1188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1254..1865) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 2136..6467 product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(6542..6751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 note possible pseudo, internal stop codon CDS complement(6767..6886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(6996..7463) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(7480..7851) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(7869..8432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 8602..9237 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene cutC CDS complement(9537..9995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 note possible pseudo, internal stop codon CDS complement(9976..10719) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 11097..12557 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 12538..13884 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 14063..14365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 14358..14681 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(15202..15984) product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 16209..17399 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 sequence046 source 1..17481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(42..1088) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1091..2113) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(2116..3318) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 3356..3541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(3711..4415) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene rpiA CDS complement(4432..5352) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene rbsK CDS 5899..6294 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rbsD CDS 6364..7713 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene fucP CDS complement(7897..9615) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene ptsP CDS complement(9615..9881) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(10012..10194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 10577..12673 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(12738..13340) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 13464..14162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 14303..15193 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439388.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(15258..16628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 misc_feature complement(16746..>17481) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461892.1:C40 family peptidase locus_tag LOCUS_14810 sequence047 source 1..17271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..724) product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene cbpA CDS complement(919..1875) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 2136..2696 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene pth CDS 2713..6255 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene mfd CDS 6233..7819 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 7821..8090 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 8249..8617 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 8724..9230 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 9352..10575 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642085.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene tilS CDS 10578..11117 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene hpt CDS 11209..13278 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ftsH CDS 13359..14246 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene hslO CDS 14316..15314 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene dusB CDS 15334..16827 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene lysS sequence048 source 1..16288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..461) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene rplS CDS complement(574..1332) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene trmD CDS complement(1334..1837) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene rimM CDS complement(2030..2305) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638633.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene rpsP CDS complement(2395..3819) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene ffh CDS complement(3832..4173) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046870843.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(4179..5567) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101483.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene ftsY CDS complement(5580..9137) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene smc CDS complement(9161..9856) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene rnc CDS complement(9973..10215) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene acpP CDS complement(10253..11293) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644323.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene plsX CDS complement(11308..13341) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene recG CDS complement(13477..15177) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(15208..15570) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 15821..16006 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene rpmB sequence049 source 1..15845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..1030) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1123..1335) product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1487..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(2010..2573) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene def CDS 2897..4003 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene pdhA CDS 4006..4983 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 5020..6312 product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 6320..7741 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene lpdA CDS 7920..8201 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 8207..8977 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 9075..10919 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene typA CDS 11052..11219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 11152..12243 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 12296..15721 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 sequence050 source 1..15799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1035) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1123..1908 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1913..2659) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(2662..2886) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(2903..3394) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(3623..3976) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 4066..4647 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 4684..5859 product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene cytX CDS complement(5955..6596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 6695..7141 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(7195..7722) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(7736..10054) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene recJ CDS complement(10072..10236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(10247..11068) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(11091..12020) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene rnz CDS 12128..12406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(12427..13728) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene obgE CDS complement(13835..15643) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene uvrC sequence051 source 1..15719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..766) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene thiE CDS complement(831..1649) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene thiD CDS complement(1652..2440) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene thiM CDS 2930..4624 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(4698..5453) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene fetB CDS complement(5450..6091) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 6271..6720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 6723..7508 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 7492..8775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 9072..9737 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene tenA CDS 9996..10847 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069469570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(10925..11332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(11820..12197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 note possible pseudo, internal stop codon CDS complement(12228..12503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 note possible pseudo, internal stop codon CDS complement(12519..12899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 13226..14623 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene rlmD CDS complement(14879..15094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 15161..15679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 sequence052 source 1..15717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(122..197) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 382..1008 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1033..1548) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1760..1915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1962..2507) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(2524..3432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(3425..4297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699835.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(4440..5780) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene glnA CDS complement(5813..6211) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(6309..7229) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475815.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene miaA CDS 7314..7490 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(7551..7961) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(7980..8942) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(8965..9186) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(9189..9857) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475813.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(9867..10412) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(10499..10648) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene rpmG CDS complement(10747..12828) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 13004..15640 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 sequence053 source 1..15554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1262) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1401..2540) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene rpoD CDS complement(2544..4403) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene dnaG CDS complement(4560..6632) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene glyS CDS complement(6634..7560) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene glyQ CDS complement(7833..8630) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene recO CDS complement(8789..9697) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047769999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene era CDS complement(9724..10113) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(10091..10576) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene ybeY CDS complement(10576..11559) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(11718..12161) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(12269..12454) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638914.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rpsU CDS complement(12594..13490) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(13765..13950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(13955..14830) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 sequence054 source 1..15368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 note possible pseudo, internal stop codon CDS 604..1047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 note possible pseudo, internal stop codon CDS complement(1109..1396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1396..2733) product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(2733..3920) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 4073..4450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 note possible pseudo, internal stop codon CDS 4535..5452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 note possible pseudo, internal stop codon CDS 5653..6018 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(6043..6219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(6222..6875) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(6878..7201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(7274..7588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(7578..7967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 8096..8725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(8785..10293) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(10415..11830) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(11830..12150) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(12152..13333) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(13496..14803) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 sequence055 source 1..15305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1120..1749 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 2230..2883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 3800..4528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 4626..6164 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(6252..7700) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 7843..9420 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 9642..10178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(10183..11061) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 11158..11700 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 11763..12251 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(12489..12623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 12670..14142 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene cls sequence056 source 1..15078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(352..717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 869..1510 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1500..2141) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(2122..2898) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(2908..3636) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(3655..5034) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(5055..5663) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641558.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(5757..6941) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(6959..7972) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(8045..8320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(8317..8772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(8769..9035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(9043..9480) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(9473..9793) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(9795..10850) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475746.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene comGB CDS complement(10786..11781) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene comGA CDS complement(11882..12613) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(12703..13704) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene ccpA CDS 13867..14964 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 sequence057 source 1..14669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 486..713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 note possible pseudo, internal stop codon CDS 729..1052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 note possible pseudo, internal stop codon CDS 1058..1711 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 1733..2209 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(2564..3613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(3765..4775) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene argF CDS complement(4772..5935) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(5953..6687) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene argB CDS complement(6700..7890) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene argJ CDS complement(8387..9424) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene argC CDS 9671..10744 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 10737..13811 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene carB sequence058 source 1..14327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 860..2458 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 2715..4013 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 4109..4354 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(4394..5611) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 5731..6438 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(6467..6925) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 7034..7591 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 7618..8511 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene htpX CDS 8641..10011 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 10522..12105 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 12234..12590 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene acpS CDS 12595..13704 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642062.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene alr CDS 13791..14165 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 sequence059 source 1..13953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 704..1135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1197..2366 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(2439..3083) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene lexA CDS 3244..3495 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 3582..3809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 4029..5075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 note possible pseudo, internal stop codon CDS 5115..6428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 note possible pseudo, internal stop codon CDS 6418..7593 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(7640..8269) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 8378..9133 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 9123..9407 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 9503..10501 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 10656..11447 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rpsB CDS 11558..12436 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene tsf CDS 12520..13257 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene pyrH CDS 13244..13807 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene frr sequence060 source 1..13934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..643) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(966..1193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1206..2000) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015380740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(2026..2985) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 3088..4104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 4333..5502 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 5602..7047 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 7066..8064 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(8252..8584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 8712..8900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(9207..10373) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 10659..11933 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 11948..13753 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene pepF sequence061 source 1..13881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(247..867) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1036..1359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1419..2834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(2886..4052) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(4079..5062) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(5065..6348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(6358..7212) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(7218..8324) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101307.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(8317..9420) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(9448..10104) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(10118..11053) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(11078..11848) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(11845..12123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(12498..13628) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 sequence062 source 1..13200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(212..1219) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1541..2287 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 2353..3354 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 3404..4456 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 4525..5670 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(5718..6404) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rpiA CDS complement(6445..8454) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene tkt CDS complement(8487..9860) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(9890..10186) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(10204..10644) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 10774..12807 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 sequence063 source 1..13117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(548..973) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1120..1983 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(2047..3204) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(3283..3993) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene dapD CDS complement(4006..4485) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(4576..5103) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(5103..5699) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(5705..6484) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene racE CDS 6652..7119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(7190..7501) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene trxA CDS complement(7586..9958) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(9977..10510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(10507..10740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(10796..11998) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 12123..13037 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene rnhC sequence064 source 1..13023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..1200 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1264..2334) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene xerS CDS complement(2946..3812) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(3898..4329) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 4488..6188 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(6238..8784) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(8781..9863) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(9889..10803) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(10796..11251) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene lspA CDS complement(11276..12937) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 sequence065 source 1..12572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..876) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1056..1478 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene msrB CDS 1599..3005 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 3019..3459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(3512..4834) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(5246..6100) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641112.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(6123..6614) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700992.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(6831..8453) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(8482..9945) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(10115..11017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 11262..12443 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 sequence066 source 1..12306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..648) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(683..1681) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1759..4230) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(4252..4929) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(4939..5598) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(5726..6859) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene mnmA CDS 7189..7650 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene nrdI CDS complement(7720..8061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(8079..9227) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(9237..9932) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(9945..10244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(10247..10798) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(10788..11021) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(11053..12042) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644607.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene dapF sequence067 source 1..12233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(566..1045) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene greA CDS complement(1134..1772) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene udk CDS complement(1787..2878) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene mltG CDS complement(2993..5410) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene pheT CDS complement(5420..6466) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(6737..7075) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003602575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(7115..7609) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(7682..8449) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 8509..8778 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 8974..9789 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene yidC CDS complement(9870..11339) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(11362..12063) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 sequence068 source 1..11900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 note possible pseudo, internal stop codon CDS complement(1030..1524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1887..3575 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene argS CDS 3708..4178 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene argR CDS 4479..6617 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 6689..7033 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 7111..8313 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 8313..10853 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 10862..11803 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 sequence069 source 1..11013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..2290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2660..3154) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040531169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(3176..3598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(3722..4474) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(4962..5153) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 5348..5983 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 6043..7785 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 7791..8501 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 8638..9996 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(10229..10609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, frameshifted CDS complement(10618..10866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 note possible pseudo, frameshifted sequence070 source 1..10483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..1231) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1373..2065 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 2066..2878 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2886..4127 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene pepT CDS complement(4173..4370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 4610..7975 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene dnaE CDS 7993..8709 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 8910..10331 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene pyk sequence071 source 1..10445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..1574 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1687..2391 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2596..2901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 tRNA 2970..3044 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 3162..3236 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 3368..5224 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 5270..5737 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(5778..6587) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 6693..7289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 7343..8149 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 8472..9047 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 tmRNA 9159..9528 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(9725..10198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 note possible pseudo, frameshifted sequence072 source 1..10374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(732..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(952..1281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1291..2226) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2296..2982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 note possible pseudo, internal stop codon CDS complement(3100..3789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 note possible pseudo, internal stop codon CDS 4459..5505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 5676..7136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 7236..7514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 7723..8613 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570286.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(8829..9017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(9038..10129) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 sequence073 source 1..9221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..995) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 note possible pseudo, internal stop codon CDS complement(1044..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 note possible pseudo, internal stop codon CDS complement(1285..2016) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2028..2780) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene tpiA CDS complement(2971..3180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(3643..4845) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(4926..5942) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene gap tRNA 6224..6296 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 6459..8267 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 8406..9137 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 sequence074 source 1..8798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..969) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1083..2156 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2364..3788 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene araA CDS 3951..4952 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643068.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 5054..5605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(5653..6312) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(6318..7172) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 7259..8719 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674845.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 sequence075 source 1..8575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(644..769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1148..1834) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1956..2996) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 3240..4439 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(4795..5325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 5438..5863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 5874..6155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 6522..7994 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 sequence076 source 1..8417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(727..1953) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene dcm CDS complement(1940..4636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(4639..5901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 6138..7538 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 7540..8298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 sequence077 source 1..8405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..755 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene ndk CDS complement(804..1430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 1606..1806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1870..2046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2295..2945 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 3202..3873 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene deoC CDS 3915..5102 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 5121..5828 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene deoD CDS 5913..6866 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 6952..8253 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 sequence078 source 1..8267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 21..395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 524..1213 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 1667..2803 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2868..4118 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 4562..5338 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 5350..5733 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 tRNA 5810..5880 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 5930..6017 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 6149..7432 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 7433..8035 product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence079 source 1..7983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(570..2468) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2635..3489 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 3510..3938 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 4054..4656 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(4756..4911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(4911..7025) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene feoB CDS complement(7026..7508) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 7465..7617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence080 source 1..7788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1231 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene dinB CDS 1322..2272 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 2274..3626 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 3890..6541 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene alaS CDS 6656..6916 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 6916..7353 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene ruvX CDS 7364..7681 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 sequence081 source 1..6804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..1021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 1342..2649 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2686..3999 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 4259..5122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 5138..6673 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 sequence082 source 1..6797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..713) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(775..2379) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2384..3292) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 3434..4861 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 5021..6643 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 sequence083 source 1..6478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1223) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642512.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene folP CDS complement(1220..1816) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1819..3090) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(3092..3655) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene folE CDS complement(3656..4144) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene folK CDS complement(4137..4436) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene folB CDS complement(4606..5523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 tRNA complement(5608..5692) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 5869..6012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(6054..6335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 sequence084 source 1..5378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1217) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(1234..1917) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2274..2600) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(3200..3811) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(3864..4037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 note possible pseudo, internal stop codon CDS complement(4062..5003) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 note possible pseudo, internal stop codon CDS 5067..5282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 sequence085 source 1..5358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1013) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(1121..1945) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(1956..2282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2423..2665) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rpsR CDS complement(2693..3214) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene ssb CDS complement(3255..3551) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rpsF CDS 3952..5109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 sequence086 source 1..5302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(820..2199) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2330..3034 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 3053..3688 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(3734..3976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 4196..4618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 sequence087 source 1..5247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(538..1716) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(1975..2502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2995..3789 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 3905..4327 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene spxA CDS 4463..4834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 note possible pseudo, frameshifted CDS 4765..5121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 note possible pseudo, frameshifted sequence088 source 1..5214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1765 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207215633.1:MucBP domain-containing protein locus_tag LOCUS_19520 CDS 1876..3174 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 3152..3508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 3486..3890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 3974..5089 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 sequence089 source 1..4226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 2..77 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 81..156 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 194..269 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 292..368 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 400..489 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 499..574 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 575..650 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 655..729 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 752..822 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 832..908 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 909..998 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1018..1090 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1122..1197 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1199..1273 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(1293..1820) product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene hmoB CDS 1885..2622 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2893..3294 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene spxA CDS 3419..4132 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 sequence090 source 1..3806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..2819) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene mprF CDS 3232..3678 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 sequence091 source 1..3627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..1775 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 1798..2904 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 3067..3555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 sequence092 source 1..3498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..1019) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(1033..1674) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(1674..2510) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(2527..3270) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 sequence093 source 1..3347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 note possible pseudo, internal stop codon, frameshifted CDS complement(416..559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 note possible pseudo, internal stop codon, frameshifted CDS complement(508..684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(695..2170) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2342..3229 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 sequence094 source 1..3330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 544..1194 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 1200..1484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2164..2535 product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2649..3047 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 sequence095 source 1..3241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..75) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(288..1109) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640888.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(1171..2667) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 sequence096 source 1..3083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence097 source 1..2675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..582) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 740..1009 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene rpsN CDS complement(1100..1918) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(1987..2517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 sequence098 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..2364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 sequence099 source 1..2439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..1010) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(1114..1245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 1491..1613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 1724..2314 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene clpP sequence100 source 1..2266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..814) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(1472..1597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 sequence101 source 1..2036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..1592) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene tyrS sequence102 source 1..1955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..1259) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 1338..1586 product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643297.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 sequence103 source 1..1812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(812..1618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 sequence104 source 1..1767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(68..1638) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence105 source 1..1645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..1032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(1196..1393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 sequence106 source 1..1533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(826..>1533) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010012236.1:helix-turn-helix domain-containing protein locus_tag LOCUS_20000 sequence107 source 1..1517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..1223) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene adhP sequence108 source 1..1485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 note possible pseudo, frameshifted CDS 567..935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 note possible pseudo, internal stop codon, frameshifted CDS 999..1454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 note possible pseudo, internal stop codon sequence109 source 1..1452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1367 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966780.1:group II intron reverse transcriptase/maturase locus_tag LOCUS_20050 sequence110 source 1..1446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..1366) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 sequence111 source 1..1232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence112 source 1..1005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@