COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..525439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(694..882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(897..3695) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3896..5701 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5727..9017 product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 9092..12415 product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 12575..13642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(13605..15149) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(15150..20039) product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene pks13 CDS complement(20070..21965) product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene fadD32 CDS complement(22510..23505) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(23526..24098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(24256..26049) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196151465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(26361..27359) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(27652..29562) product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene zomB CDS complement(29540..30403) product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(30442..30957) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(30941..32791) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(32788..34017) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene glf CDS complement(34091..34843) product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(34950..36680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 36990..39008 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(39083..39913) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(39919..40674) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(40755..42578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(42684..44177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(44574..47234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(47457..50408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 50657..51145 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(51254..52519) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene serS CDS complement(52525..52968) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 53020..54126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 54140..54478 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 54601..54909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 54939..56165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 56162..56956 product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(56976..57665) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(57662..58576) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene pheA CDS complement(58622..59347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 59580..60806 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 60833..61645 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 61917..63011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 note possible pseudo, frameshifted CDS 63075..63605 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 63775..64326 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(64409..65323) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(65357..66121) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(66118..67062) product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(67062..67409) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 67744..68670 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 68833..69717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(69754..70413) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene msrA CDS complement(70423..71538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 71818..72447 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 72560..73426 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 73700..74398 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 74408..74911 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 74965..76392 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(76396..76788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 note possible pseudo, frameshifted CDS complement(77154..77789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(77791..78372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(78403..79908) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 80060..80593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 80610..80981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(80985..81344) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 81499..82776 product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 82773..84188 product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 84185..85306 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 85303..87498 product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 87495..88697 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(88652..90235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(90267..90893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(90907..92412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(92409..93083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 93303..94070 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(94495..96105) product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 96172..96801 product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 96815..97339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 97375..98010 product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 98043..98546 product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 98573..99499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 99606..100610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 100603..101373 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 101426..102283 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(102305..103207) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 103338..104249 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene mmsB CDS 104246..105619 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 105663..107138 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene mmsA CDS 107283..107759 product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(107781..109334) product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 109491..110153 product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene raaS CDS 110227..111126 product multidrug efflux ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 111123..112757 product multidrug efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 112914..114719 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(114682..116340) product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(116321..117040) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(117045..117824) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(117821..118741) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(118867..119742) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(119739..120941) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(120975..122174) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(122174..123157) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(123154..123558) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(123561..124010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(124040..124915) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(124957..126045) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(126042..126815) product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(126812..127675) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(127751..128581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 128718..129302 product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene kstR2 CDS 129318..130355 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(130421..131395) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(131392..132285) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 132608..134101 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 134117..134572 product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 134627..135097 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rraA CDS 135121..135684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 135663..135818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(135849..136070) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 136145..139498 product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene lysX CDS 139500..140171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(140263..140556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 140745..141365 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 141362..143023 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 143020..143823 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(143880..144695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(145007..145420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 145377..145700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(145708..146622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(146896..148632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(148654..150477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(150761..152227) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(152220..156806) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene gltB CDS complement(157389..158012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 tRNA complement(158311..158394) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(158468..158743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 158684..159844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 160008..160475 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 160472..161917 product serine/threonine phosphatase PstP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene pstP note possible pseudo, internal stop codon CDS 161917..163362 product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rodA CDS 163359..164846 product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene pbpA CDS 164872..166215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 166212..168140 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene pknB CDS complement(168203..168868) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891354.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(168892..169656) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 169834..170097 product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene crgA CDS 170173..170649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(170656..171624) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(171636..172157) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(172405..173664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(173691..174380) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 174565..174939 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 tRNA complement(175092..175165) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(175329..175403) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(175479..176444) product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(176445..178967) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene gyrA CDS complement(179165..179752) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(179733..180107) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(180122..180562) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(180559..183201) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(183450..185495) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene gyrB CDS complement(185647..186570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(186614..187741) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(187738..188670) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(188800..189351) product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(189348..190574) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene recF CDS complement(190574..191497) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene gnd CDS complement(191569..192738) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene dnaN CDS complement(193325..194905) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene dnaA CDS 195349..195492 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rpmH CDS 195589..195897 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rnpA CDS 195894..196241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 196317..197405 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene yidC CDS 197427..198020 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 198114..198791 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rsmG CDS complement(198823..199215) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(199212..200195) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 200412..201302 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 201606..202277 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rsmG CDS 202348..203358 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078336141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 203361..204452 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 204677..205360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(205385..206353) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(206394..207596) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(207808..208131) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene trxA CDS complement(208170..209153) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene trxB CDS complement(209377..210138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(210202..210783) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene sigM CDS complement(210854..214417) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene murJ CDS complement(214720..217188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(217185..217739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 note possible pseudo, frameshifted CDS 217841..219292 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 219351..219758 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 219884..220543 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene modA CDS 220588..221346 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 221358..222419 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 222599..222895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 222892..224616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 224653..225186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(225190..226452) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 226555..226731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 226768..227103 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 227143..227748 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(227757..229112) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(229222..230208) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 230293..231135 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(231124..232104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(232144..232524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 232664..235522 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene leuS CDS complement(235582..237177) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(237355..238866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 239037..239408 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(239421..240107) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 240178..241515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 241623..242357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 242394..243401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(243466..245553) product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(245740..246477) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(246481..248271) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(248285..249079) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(249152..249331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 249534..249977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 249999..250478 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 250599..251681 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene ugpC CDS 251827..253110 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 253191..254237 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 254237..255223 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 255274..255429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 255753..257921 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, frameshifted CDS complement(257944..259473) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(259705..260757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(260754..261596) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(261620..262021) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 262190..264403 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 264452..266107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(266114..267058) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(267185..267826) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(267819..268598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(268595..269683) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(269688..270686) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(270942..272546) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(272775..273869) product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(273862..274428) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(274534..275103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(275100..275918) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(275987..276583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(276586..277398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 277489..278028 product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 278423..280663 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 280750..282285 product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(282344..283075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(283197..283631) product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 283758..284045 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene rpsF CDS 284147..284677 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 284718..284960 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene rpsR CDS 284978..285430 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene rplI CDS 285950..288592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(288679..289617) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 289782..290030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 290027..290446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 290506..290832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 291037..292758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 293047..293745 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(293689..295203) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 295302..296117 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(296170..296481) product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene mihF CDS complement(296595..297386) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 297473..299962 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene pepN CDS 300138..300269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 300366..301127 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082087.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 301228..302922 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(303004..304176) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(304311..304907) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 305005..305982 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene zapE CDS complement(305990..306604) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 306686..307240 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 307347..308159 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 308162..308485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(308495..310228) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(310428..311042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(311039..311836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 312039..313661 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(313671..314078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(314188..314943) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(315197..316357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(316357..317526) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 317674..318267 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 318312..318698 product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(318733..319884) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(319889..320488) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 320664..321749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 321840..322691 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(322703..323182) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 323268..323951 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 323944..324270 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 324513..326000 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038672.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(326001..328502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 328750..329715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(329722..330561) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 330757..331500 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(331502..332290) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 332469..333125 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 333118..334329 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 334326..335087 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 335089..336075 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 336153..336881 product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(336888..338006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(338088..338741) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(338757..339236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013472216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(339399..340646) product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene aztD CDS complement(340688..342142) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(342278..343285) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 343401..344540 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 344547..345587 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(345591..346037) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(346093..346749) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(346749..347222) product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 tRNA complement(347422..347498) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 347640..348452 product Rv0687 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(348521..349732) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene hppD CDS 350405..350539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 350576..350779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 351134..352537 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 352580..353431 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 353445..353927 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 353938..354456 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 354500..354994 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 354991..355596 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 355593..356447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(356455..357852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(357849..359225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(359282..359440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(359491..361683) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(361785..362528) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(362625..364154) product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(364201..366129) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 366296..367489 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 367456..368331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 368328..369509 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene fahA CDS complement(369517..370128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 370274..371023 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(371024..371551) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(371556..372017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(372027..373472) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(373469..373717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 373602..374051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 374109..374870 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene fabG CDS 374915..375910 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 376145..376486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 376500..377927 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 378114..378650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(378707..379846) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(379890..380120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 380020..380916 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(380934..381692) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 381841..382440 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(382476..382643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(382676..384325) product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(384454..385395) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 385683..387299 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(387374..387859) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(387894..388775) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 389091..389984 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(390076..390603) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 390873..391739 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 391749..393452 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 393765..394937 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 394977..395882 product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene bphC CDS complement(395953..397098) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(397346..398137) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(398166..398429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(398410..399567) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 399870..401036 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(401068..402627) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 402822..403451 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 403688..404851 product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 404942..407131 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 407144..408349 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 408349..409221 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 409221..409871 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(409962..410117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 410283..410672 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(410609..411334) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(411366..411884) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(411896..412804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(412814..413296) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(413296..414960) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 415204..416862 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 417015..418181 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 418178..419116 product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 419116..420228 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 420225..420680 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 420680..421858 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 421880..422695 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(422782..423873) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 424226..425773 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(425852..426631) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 426814..427575 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(427659..428576) product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 429093..430655 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 430672..431613 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 431610..432497 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 432484..433539 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 433536..434342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(434326..435891) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 435982..436662 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(436614..437648) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 437790..438488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 438617..439255 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(439281..441002) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ilvD CDS complement(441068..442657) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 442819..444537 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(444606..446180) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 446624..447397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 447482..449152 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 449304..450257 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 450250..451356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 451353..452417 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 452417..453406 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027033306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 453749..454540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 454773..454910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(454981..455829) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(456288..457445) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(457640..458353) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 458588..483049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(483059..483718) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 483821..485011 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 485040..485471 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 485476..486342 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 486402..487271 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 487283..489484 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 489753..490916 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 490943..492004 product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene ligD CDS 492096..493352 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 493380..493583 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 493701..495386 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 495530..496453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 496517..496843 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(496902..498860) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(498972..499835) product protocatechuate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(499847..500767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(500801..501574) product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(501656..502651) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(502728..505196) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 505531..505833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 505889..506347 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(506351..507499) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(507578..508177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 508210..509112 product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(509123..510277) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 510437..511414 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(511416..511811) product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(511872..512351) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 512516..513760 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(513887..515218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(515563..516198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(516195..516719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(517151..518359) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 518441..519484 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(519459..520250) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090884.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(520263..521873) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 522233..523927 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 523932..525131 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 sequence02 source 1..141994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..611) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 tRNA 779..862 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 1147..1220 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 1265..1338 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 1401..1568 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rpmG CDS 1654..2202 product (3R)-hydroxyacyl-ACP dehydratase subunit HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene hadA CDS 2189..2614 product (3R)-hydroxyacyl-ACP dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene hadB tRNA 2757..2830 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 2864..3325 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene secE CDS 3386..4192 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene nusG CDS 4291..4725 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rplK CDS 4851..5564 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rplA CDS 5992..6549 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rplJ CDS 6633..7016 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rplL CDS 7311..8357 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 8392..9162 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 9167..10027 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 10024..11361 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 11379..12434 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 12431..13426 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 13426..14655 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 14667..15908 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 15908..17158 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 17200..17817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 17848..18552 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 18923..22411 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 22539..26498 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 26626..26826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 26915..28609 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 28661..29635 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 29787..30260 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 30257..31759 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 31919..32116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 32113..32490 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 32603..33361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 33358..33915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(33963..34250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 34466..35410 product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(35393..36793) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(36790..37620) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(37617..38570) product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene nikB CDS complement(38567..40159) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 40822..43083 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene metE CDS complement(43129..44250) product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(44247..45161) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene prpB CDS complement(45163..46665) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 46742..48247 product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 48356..49153 product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 49150..50931 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 50928..52076 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 52073..53671 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 53695..55683 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 55680..56843 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 56854..57639 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(57695..57826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 57963..58616 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 58957..59331 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003929602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rpsL CDS 59331..59801 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene rpsG CDS 59950..62052 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene fusA CDS 62142..63332 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene tuf CDS complement(63416..64288) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 64387..64764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(64773..65363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(65360..66328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(66321..66500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(66497..66802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(66799..67275) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 67468..68664 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 68711..69478 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(69487..70059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(70043..70405) product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(70611..71666) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(71827..72636) product mycofactocin oligosaccharide methyltransferase MftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene mftM CDS complement(72633..73262) product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene mftR CDS 73464..73784 product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene mftB CDS 73851..75068 product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene mftC CDS 75111..76286 product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene mftD CDS 76300..79023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 79037..80998 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 81119..81799 product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene mftE CDS 81799..83196 product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene mftF CDS 83198..84664 product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene mftG CDS 84728..86059 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 86120..86677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 86801..88453 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 88463..90106 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 90228..91727 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene dhaS CDS 91779..92891 product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(93088..93681) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 93809..95383 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 95391..97418 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 97415..98584 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 98581..99057 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 99054..99863 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene citE CDS 99860..101812 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(101816..103489) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene asnB CDS 103742..104497 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 104689..138441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 138767..139525 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 139673..141169 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(141132..141887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 sequence03 source 1..112722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..1074 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 1071..1484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 1575..3056 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(3037..4461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 4524..5147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 5107..5499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(5866..6621) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 6832..8529 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(8588..9049) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 9151..9573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(9577..10176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 10162..10494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(10507..11703) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 11830..12432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(12440..13606) product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 13677..14630 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(14647..14838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 15013..15285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(15359..16438) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ychF CDS complement(16499..16906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(16972..17568) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(17594..19207) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(19350..19814) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 19900..21504 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(21485..21949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 22101..23324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(23321..26302) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(26299..27456) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 27581..28393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(28473..29477) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 29476..30111 product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 30108..31337 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene xseA CDS 31344..31562 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(31559..32128) product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 32240..33280 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene glpX CDS 33378..34787 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(35006..36316) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 36479..36922 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922181.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(36978..38285) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene glyA CDS complement(38328..39533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 39694..40626 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene coaA CDS complement(40660..41250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 41334..42695 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 42692..43849 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(43854..44621) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 44698..46155 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 46309..46437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 46698..47678 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(47688..49700) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 tRNA complement(47795..47882) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(49712..49981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(49981..50841) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene mca CDS 51010..51435 product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 51683..52177 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene greA CDS complement(52347..54698) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(54851..55852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(55860..57731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(57742..59094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(59256..60398) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(60436..60807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(61037..62419) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 62699..63916 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(63987..64847) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(64991..65836) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 66031..66339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(66343..67473) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(67536..68585) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 tRNA complement(68638..68714) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(68751..69713) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(69716..70249) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(70246..70683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 note possible pseudo, frameshifted CDS complement(70860..72155) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene eno CDS complement(72290..72985) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 73288..74169 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 74196..75326 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 75310..76581 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene efeB CDS 76753..77628 product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(77664..78926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(78968..80134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(80131..81840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(81876..83495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(83485..84780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(84777..85715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(86015..86833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(86994..87659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(87652..91290) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene mfd CDS complement(91398..92378) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(92695..93327) product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893568.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(93443..94084) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 tRNA 94205..94276 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 94446..95924 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene glmU CDS 95921..96901 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 97001..97501 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 97662..98354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 98365..98853 product L-methionine sulfoximine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(98858..99826) product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene egtD CDS complement(99837..100571) product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene egtC CDS complement(100572..101807) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene egtB CDS complement(101807..103021) product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene egtA CDS 103110..104282 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 104384..105859 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 106085..106666 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 106763..107341 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene pth CDS complement(107360..110554) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 110760..111173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 111464..111853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, frameshifted CDS 111988..112329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 sequence04 source 1..107825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..1161) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(1158..1835) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(1955..3700) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 3865..5997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 tRNA complement(4866..4954) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 6083..6616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 6713..7456 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene yaaA CDS 7532..8752 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(8801..10279) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(10291..11943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(11936..13318) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(13312..13926) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene cobO CDS complement(13955..15883) product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(16110..17627) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene mqo CDS 17840..18871 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081672.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 18868..20244 product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene mtr CDS 20248..21144 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(21213..21881) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(21878..22900) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(22900..23733) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(23766..24779) product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(25119..27851) product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(27933..28478) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(28541..29803) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 29993..30358 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 30355..31269 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 31266..32024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(32005..33534) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(33531..34427) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene map CDS 34609..34926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(34941..35642) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 35816..36928 product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 36944..37627 product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 37673..38734 product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 38736..39914 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 39911..40816 product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 40791..41588 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 41665..42234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(42321..43955) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 44063..44932 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 44982..45752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(45753..46589) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(46674..47831) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene ispG CDS complement(47907..49127) product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rip CDS complement(49124..50284) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene dxr CDS 50424..50693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(50772..51881) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rlmN CDS 51999..52841 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(52845..54119) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(54206..54940) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(54952..55806) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(55809..56366) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene frr CDS complement(56415..57143) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene pyrH CDS complement(57315..58139) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene tsf CDS complement(58254..59114) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rpsB CDS 59444..59989 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(59974..61002) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 61001..62161 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(62166..63203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 63464..64009 product (3R)-hydroxyacyl-ACP dehydratase subunit HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene hadA CDS complement(64011..65132) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene dprA CDS complement(65129..66637) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(66637..67017) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(67228..67545) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(67583..68209) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(68260..69075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(69187..69528) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene rplS CDS complement(69599..70489) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(70489..71427) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(71529..73877) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(73979..74656) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene trmD CDS complement(74667..75233) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene rimM CDS complement(75241..75483) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(75483..75923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 76229..76600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 76597..76983 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084697.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(77047..77658) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rdgB CDS complement(77655..78350) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rph CDS complement(78471..79229) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(79289..79909) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(79906..81003) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(81000..81536) product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(81629..81982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 81966..83381 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 83407..84015 product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 84080..86140 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(86360..86575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 86574..87614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 87611..89257 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 89278..90630 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene gabT CDS complement(90737..90955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 91660..92166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(92723..95305) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(95347..95964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 96082..98091 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 98088..100277 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene glgB CDS 100274..101722 product zinc metallopeptidase LpqM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene lpqM CDS 102000..102191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(102344..103207) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(103300..103674) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(103756..104934) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 105038..105517 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene mce CDS 105628..106521 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(106525..106767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(106878..107579) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene nucS sequence05 source 1..96954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..1424 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 1575..1796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(1806..2666) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(2730..4325) product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(4330..5214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(5239..6615) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(6669..7019) product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(7060..7782) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 7829..9175 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 9274..9810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 9803..10708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 10782..11075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 11244..12191 product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 12191..13369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(13391..14284) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene purU CDS complement(14296..15144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 15182..15868 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene deoC CDS complement(15861..16625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 16759..17370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(17377..18156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(18162..18668) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(18729..19244) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 19268..20371 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 20423..21619 product L,D-transpeptidase LdtMt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene ldtMt5 CDS 21693..22463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 22490..22996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 23001..23303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 23303..24133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 24423..24602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 24717..26177 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(26185..26934) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 27212..28501 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(28529..29836) product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 29898..30713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 30710..31906 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 31924..32784 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 32835..34175 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene mshA CDS 34172..34714 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 35116..35445 product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 35575..36321 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 36653..37819 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 37852..38541 product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene regX CDS complement(38619..39557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 39567..40436 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 40433..41404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 41436..42278 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 42389..43072 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 43069..43917 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 44014..44814 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene proC CDS 44982..45212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 45730..46761 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 46758..47774 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892373.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(47793..48839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 49021..49293 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 49636..50322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 50319..51689 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 51686..52636 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene hemC CDS 52709..54274 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080286.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 54423..55355 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene hemB CDS 55352..55987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 56010..56441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 56413..56904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 56916..57161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 57158..57439 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 57467..57694 product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(57676..58638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 58797..59969 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(59976..60737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(60734..62851) product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 63125..64462 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene hemL CDS 64488..65168 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 65165..65785 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 65782..66603 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 66600..68243 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 68282..69259 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene ccsB CDS complement(69347..69559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(69625..69837) product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 70108..70464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 70461..71555 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(71563..72087) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(72101..72400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 72609..73400 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 73465..74202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(74207..74539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 74617..74997 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 75043..75162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(75179..76048) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 76118..79396 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(79401..80231) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(80228..81202) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(81273..81776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(82115..83296) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene menE CDS complement(83318..83647) product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(83641..84021) product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(84059..84313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(84327..85478) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(85695..86081) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(86094..86528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(86615..87508) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 87560..88180 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 88177..89181 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 89199..89675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 89842..91482 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene menD CDS 91490..91915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 91988..92611 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 92635..93333 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(93363..94625) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 94772..95785 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 95903..96769 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene htpX sequence06 source 1..93641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..1389) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(1386..1607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1750..2559) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057847.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(2599..3990) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene aroP CDS complement(3990..4904) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene dapD CDS 4980..6062 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene dapE CDS 6093..6899 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 6893..7453 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 7544..9319 product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene fadD6 CDS 9349..10257 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene folP CDS 10254..11186 product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 11199..11510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 11507..12067 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 12241..12399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 12497..13369 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(13356..14522) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene glgA CDS 14639..15835 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene glgC CDS complement(15860..16531) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 16787..17404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 17419..17778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 17801..19267 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 19330..19731 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene tatB CDS complement(19768..20913) product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(20943..22052) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(22146..22658) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(22651..23925) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 24042..24944 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 25038..25523 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(25454..26941) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 27091..27675 product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 27701..28549 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 28546..28863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 29201..30391 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 30510..31127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(31144..31974) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(31971..33569) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 33640..34254 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(34445..38089) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(38288..42106) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(42189..42614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 42553..42819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(42877..43275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(43280..44134) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(44170..44910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(44986..45996) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(46040..46744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 46863..49208 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 49331..50167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 50213..51664 product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 51670..52638 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(52645..52836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(52947..54749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 note possible pseudo, internal stop codon, frameshifted CDS complement(54760..55092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 55330..55707 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(55712..56776) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(56863..57150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(57215..58525) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(58546..59781) product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 59934..60731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 60745..61923 product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 61954..62583 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 62580..63359 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(63367..65154) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(65318..66028) product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(66098..66742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(66862..68169) product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 68289..70085 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 70268..70774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(70794..72692) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(72794..73423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 73600..74361 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 74433..76787 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 76892..77650 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 77655..80201 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 80259..80702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 80794..81969 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 81980..83125 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 83153..85969 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(85975..86910) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(86907..88145) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 88349..89215 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 89280..90428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 90467..92113 product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(92119..92802) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 92744..93499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 sequence07 source 1..91148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..1011) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1020..1892) product daunorubicin ABC transporter ATP-binding protein DrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene drrA CDS complement(1889..3130) product daunorubicin ABC transporter permease DrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene drrB CDS complement(3319..3849) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 4206..4385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 4345..4650 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene rpsJ CDS 4679..5332 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rplC CDS 5329..5994 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene rplD CDS 5991..6296 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rplW CDS 6337..7173 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene rplB CDS 7192..7473 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene rpsS CDS 7470..7874 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rplV CDS 7874..8674 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rpsC CDS 8678..9094 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rplP CDS 9094..9330 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rpmC CDS 9327..9617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 9789..10157 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rplN CDS 10157..10474 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rplX CDS 10476..11042 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rplE CDS 11047..11232 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 11399..11797 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene rpsH CDS 11812..12351 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rplF CDS 12348..12761 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rplR CDS 12793..13434 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene rpsE CDS 13434..13613 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene rpmD CDS 13616..14056 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene rplO CDS 14278..15591 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene secY CDS 15588..16133 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 16139..16942 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene map CDS complement(17027..17464) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene dtd CDS 17654..17911 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene infA CDS 18336..18704 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene rpsM CDS 18704..19117 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene rpsK CDS 19139..19744 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rpsD CDS 19862..20926 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 20982..21470 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rplQ CDS 21483..22382 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene truA CDS 22446..23405 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(23433..24575) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 24638..25207 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 25231..25785 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(25789..27420) product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene eccE CDS 27610..29031 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene eccB CDS complement(29070..30458) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene mycP CDS complement(30467..31939) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene eccD CDS 32127..36128 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 36125..37381 product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 37522..37836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 37875..38159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 38308..39576 product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rocD CDS 39781..40224 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene rplM CDS 40221..40727 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rpsI CDS 40852..42210 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene glmM CDS 42279..42590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 42590..44008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(44089..44961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892955.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 45029..46894 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene glmS CDS complement(46922..47281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 note possible pseudo, internal stop codon, frameshifted CDS 47306..48754 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 48814..50025 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene alr CDS 50022..51107 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 51097..51606 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene tsaE CDS complement(51616..52494) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 52576..53304 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene tsaB CDS 53322..53771 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rimI CDS 53777..54817 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene tsaD CDS complement(54762..56105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 56216..56782 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(56789..58516) product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(58575..59069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(59077..60066) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 60295..60597 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene groES CDS 60679..62298 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene groL CDS complement(62369..62659) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 63168..63968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 64098..64676 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 64669..65697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(65784..66188) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 66391..67932 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene guaB CDS 67963..69102 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 69307..71058 product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene choD CDS 71127..72680 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene guaA CDS complement(72745..72999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(72992..74299) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 74441..75760 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 75770..76447 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(76479..77591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 77700..78467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 78509..79009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(79011..79871) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 80025..80984 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(80992..82287) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(82533..84536) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094422.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 84508..85014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(84944..85966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(86047..86304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(86384..88066) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene phaC CDS complement(88056..88574) product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene htdZ CDS 89070..90728 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene cdr CDS 90721..91029 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 sequence08 source 1..89608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 tRNA complement(598..671) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(735..1922) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1961..4870) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene topA CDS complement(5015..5599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(5771..5974) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 6366..8720 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(8744..9085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(9094..9447) product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(9444..9710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(9707..10288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(10288..11148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(11145..12323) product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(12320..13441) product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene ssd CDS 13944..14723 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(15185..15946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 16121..18049 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene acs CDS 18098..20422 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 20561..20926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(21054..22454) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 22682..23890 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene nhaA CDS 23914..24438 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 24446..25393 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(25398..26588) product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene marP CDS complement(26585..27304) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(27316..27981) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731103.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(27987..28760) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene nth CDS 28861..29172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 29444..30064 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene crp CDS complement(30280..31065) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(31095..31862) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 32010..32678 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(32725..33207) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(33212..33376) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 33456..34451 product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050545102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 34448..35605 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(35656..35979) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 36266..38569 product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene ponA2 CDS 38641..39267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(39286..41508) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(41943..43325) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(43374..45353) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(45357..46097) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(46091..47356) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 47525..48178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(48175..48651) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 48716..49696 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 tRNA 49752..49828 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(50064..50876) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(51187..52653) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(52673..53176) product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene furA3 CDS complement(53225..55027) product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(55055..55393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 55326..55664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 55677..56138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(56222..56584) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105737682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(56626..58134) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 58354..58923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(59050..59748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(59794..61548) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(61789..62820) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(62827..64092) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 64237..65034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(65024..66883) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 67287..69689 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 69795..70028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(70044..70604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 70734..72437 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene leuA repeat_region 72499..72652 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcgttttgcgcacttagcgcg CDS complement(72750..73682) product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 73833..77540 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 77577..79238 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene narH CDS 79283..79888 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene narJ CDS 79890..80660 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene narI CDS complement(80769..81080) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(81098..81454) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 81898..82275 product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 82371..83609 product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169592731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 83602..84315 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 84866..85363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(86297..86764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(86938..88161) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(88158..89138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(89153..89461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 sequence09 source 1..82539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(455..907) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1093..1971 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(2038..2814) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(2811..3722) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene mmsB CDS complement(3719..4795) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(4792..5931) product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(5942..7447) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 7582..9228 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(9241..10521) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(10584..11069) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(11106..11831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(11828..14644) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161897637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 14734..15051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(15053..16204) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 16293..17120 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 17122..17541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(17552..18301) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(18337..19374) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(19468..19938) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112798.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 20073..21164 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene pdhA CDS 21161..22138 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172527631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 22135..23244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(23307..24740) product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(24740..25072) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(25073..26188) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 26459..26836 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 26894..27715 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 tRNA 28145..28231 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(28336..28761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(29162..30418) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(30448..30759) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 30898..32382 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 32379..34631 product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 34628..36067 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(36064..37557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(37645..38007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(38044..38568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 38901..40280 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163665679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 40354..40635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 40635..43016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 43043..43771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 43855..44565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 44593..44868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(44890..45636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(45735..47585) product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(47582..50827) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(50824..52740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(52737..57539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 57747..59993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 59990..60964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 60967..61866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(61874..62977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(63037..64026) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(64079..69004) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(69001..72405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181821298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(72536..73633) product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043791004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 73860..76742 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 76822..77079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 77076..77501 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 77599..82263 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(82224..82430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 sequence10 source 1..73048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..1950) product IS1634-like element ISMsm6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 2050..2322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(2289..2555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 3700..4221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 4398..4655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(4788..5177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(5174..5392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(5758..6096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(7211..7768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(7784..8353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(8699..8968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 8961..9176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(9226..9738) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene msrA CDS 10009..10230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(10641..11141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(11257..11403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(11640..12377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(12514..12678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(13116..13481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(14156..14500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(14571..14987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(15014..15802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(16451..17059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 16949..17233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(17182..18237) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(18234..18419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(18478..20604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(20918..21127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(21141..21320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(21470..21973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(22038..23399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(23697..24995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(25105..25428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(25428..25688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(25685..27673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(27875..28669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(28670..30454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(30454..31866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(32047..32502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(32502..33290) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(33883..34611) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(34871..35497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(35661..37037) product rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(37331..37753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(37830..38624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 38875..39360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 39552..39917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(39914..40519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(40516..41595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(41592..42083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 42293..43255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(43370..43942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(43980..44576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(44804..46387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(46384..47220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(47217..49262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(49361..52405) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(52402..52800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(52846..53151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 54306..56474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 56471..56638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 56682..57023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 57038..58558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 58663..59847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 59870..60571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 60588..61112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 61154..61441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(62130..62468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 62581..63204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 63252..64295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 64426..64941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 64948..65526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 65792..66004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 66052..66522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 66602..67156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 67220..67537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 67555..67836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 67899..68126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 68222..68659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 68674..68940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 69083..69883 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 69883..71022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 71221..71532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 71614..71898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 72025..72252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 72278..72526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 sequence11 source 1..70677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..1211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1265..1900) product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 2068..2508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 2501..4285 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 4358..4864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 4960..5511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(5494..6273) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 6353..7225 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 7334..8866 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(8925..9626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(9632..10150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(10350..11114) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(11107..11871) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(11876..12907) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(12892..13626) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene tenA CDS 13800..15377 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(15390..15686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(15705..18212) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(18215..18985) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 18984..20345 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 20333..20977 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(20988..21287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(21284..25537) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911174.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(25549..25971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 26167..27024 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(27187..27567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(27634..28419) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 28549..29478 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 29490..29711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(29708..30706) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(30821..31099) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(31122..32012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(32044..33309) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(33440..34750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(34982..35713) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(35749..37416) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 37620..38387 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 38384..39898 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 39895..40518 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(40603..40908) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284194.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(40914..41270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(41358..42908) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(42905..43888) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 44069..45298 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 45397..48675 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene recC CDS 48672..51992 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene recB CDS 51989..53863 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene recD CDS complement(53865..57068) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 57236..58210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(58219..58878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(58920..59684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 59821..60294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 60288..61208 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 61276..61794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 61820..62191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(62232..62813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 62995..68472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(68529..70058) product IS1634-like element ISMsm6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(70255..70512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 sequence12 source 1..434046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..1205) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene disA CDS 1326..1868 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1889..3166) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene radA CDS complement(3366..3965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 4286..4774 product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene carD CDS 4885..5460 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ispD CDS 5497..5973 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene ispF CDS 6009..7403 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene cysS CDS 7403..8368 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene rlmB CDS complement(8353..9219) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(9320..9925) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(9925..10683) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(10694..11593) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(11590..12444) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(12441..13418) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 13582..14670 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(14682..17243) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene otsB CDS complement(17304..17951) product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene kstR CDS 18045..20243 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 20278..21387 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 21372..22550 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 22547..23551 product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 23548..23991 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 23988..25160 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(25231..27549) product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene atsD CDS 27754..28416 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 28429..29346 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 29366..29731 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 29736..30071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 30195..31040 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 31037..32539 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(32543..34399) product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(34503..35363) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(35377..37077) product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene kstD CDS complement(37281..37613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(37616..38785) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 39003..40151 product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene hsaA CDS 40160..41068 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 41065..41964 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 41964..42545 product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene hsaB CDS 42596..43204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(43276..45330) product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene cerN CDS complement(45435..46163) product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(46180..46722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(46770..47198) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(47279..48154) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(48164..48955) product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene cynR CDS 48875..49180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 49292..50119 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(50154..51260) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(51272..52261) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(52258..53397) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113160.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(53397..54260) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(54257..55855) product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 55939..57132 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 57129..57938 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 58065..58688 product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene kstR2 CDS 58711..59865 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 60260..61351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 61404..62024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 62101..64404 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(64489..65583) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(65580..66329) product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(66326..67216) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(67216..68001) product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 68127..69041 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(69111..69782) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(69882..70352) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(70360..71523) product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 71707..72957 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(73104..73526) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(73537..74400) product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(74414..75589) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(75591..76655) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(76669..77625) product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 77730..78770 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(78837..79598) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(79696..80319) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(80484..81314) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 81394..83040 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901660.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 83040..84152 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(84219..85853) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(85929..87050) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(87065..88246) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 88529..88717 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 88875..89759 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 90235..90999 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 91020..91871 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 91884..93065 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 93065..94090 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 94087..95139 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 95136..96431 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 96428..97663 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 97660..99078 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 99171..99761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 99758..100309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(100392..101945) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(101996..102271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 102692..104380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 104660..106126 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(106120..106767) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(106764..107936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 108005..108379 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 108376..108702 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 108761..109561 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 109569..112223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 112402..112635 product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene mbtH CDS complement(112647..114119) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(114121..114513) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 tRNA 114596..114670 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 114939..116096 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(116101..116736) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(116736..117710) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 117799..118413 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(118396..119235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(119293..119607) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 119766..120467 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 120478..121884 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(121891..122307) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 122537..123163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 123218..124471 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene purD CDS 124486..125652 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 125705..126331 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 126369..127790 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene purB CDS complement(127877..128296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(128341..128772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 128862..130937 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 130968..132323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 132320..132748 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 132741..133760 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene dcyD CDS complement(133723..134460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(134457..135269) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(135266..136324) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(136330..137325) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(137563..138996) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 139140..140024 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 140026..142146 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(142160..142858) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(142855..144483) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 144629..146056 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 146271..147320 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 147317..148240 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 148237..149073 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 149070..150182 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 150205..151170 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 151181..151669 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 151770..152474 product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(152487..153134) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 153276..153512 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene purS CDS 153509..154186 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene purQ CDS complement(154286..155248) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 155388..156698 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 156795..159074 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064180.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene purL CDS 159078..160862 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 160892..161278 product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 161399..162988 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene purF CDS 163134..164213 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene purM CDS complement(164414..164614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(164758..165753) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(165783..166913) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 167000..167860 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104397.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 168017..169519 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 169529..170548 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene cydB CDS 170550..172262 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene cydD CDS 172252..173967 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene cydC CDS 174234..174935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(175296..176000) product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(176168..176617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(176779..177183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 177265..177492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(177569..177874) product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(177880..178713) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(178769..179239) product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(179496..179951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(179948..180730) product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730787.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene lmeA CDS 180870..181655 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 181652..182557 product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene mshD CDS 182769..183896 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene pstS CDS 183954..185006 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene pstC CDS 185010..185915 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene pstA CDS 186011..186787 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene pstB CDS 187032..188972 product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040688119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 188945..189427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 189438..190037 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(190024..190617) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(190772..191734) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(191772..192752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 193193..194710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 194769..195710 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054291694.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 195707..197515 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 197512..198381 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(198442..199677) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(199674..200681) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(200782..201750) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene mgrA CDS complement(201775..202920) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 202999..204354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(204397..205140) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141309845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 205284..206249 product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(206278..207036) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 207188..208150 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(208174..209679) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 209779..211233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 211230..211934 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 211931..212857 product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene hpaI CDS 212887..214404 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene hpaE CDS 214431..215498 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene hpaD CDS 215675..215806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 215920..217050 product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(217115..218554) product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene dhaS CDS 218750..219133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 219258..220103 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(220164..220853) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene phoU CDS complement(220935..222614) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 222642..222869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(222918..224072) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene dusB CDS complement(224169..225137) product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 225503..226111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 tRNA 226218..226293 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 226582..227211 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 tRNA 227318..227391 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 227438..227512 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 227567..227643 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 227716..227790 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 227841..227917 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 228204..229355 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 229410..231032 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 231044..231616 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(231630..232484) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene fabG CDS complement(232481..233386) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 233672..234622 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 234680..235561 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 235568..236113 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(236267..236848) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 237013..237768 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 238224..239384 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(239451..240218) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 240751..242418 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916600.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 242431..242562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(242611..244872) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene metE CDS 245200..246282 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 246506..247258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 247357..247782 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(247787..248881) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 249002..249625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(249622..250638) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(250635..251819) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 251942..252532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(252504..253427) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(253580..253780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 253694..254923 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 255031..255228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(255253..255921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(255933..257591) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(257688..257849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(258281..260530) product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 260490..260828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(260899..261615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(262020..262424) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(262446..262676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(262769..263359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(263410..264477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(264474..265058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(265069..265668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(265682..266314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(266316..266852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(266857..267369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 267755..268183 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(268253..268750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(268778..270469) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 tRNA complement(269814..269913) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(270527..271327) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 271389..272192 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 272369..274945 product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 274942..275496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(275542..275790) product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 275873..277354 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 277390..277818 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 277867..278673 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 278670..278936 product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(278926..279567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(279573..280433) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene sepH CDS complement(280654..281772) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene serC CDS complement(281815..282942) product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 283156..283806 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045843615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene pdxH CDS 283806..285086 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 285218..286516 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 286563..287288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(287374..288447) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(288601..290991) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(290981..292285) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(292285..293043) product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene prrA CDS 293214..293942 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 293939..294805 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112272.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 294802..295797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(295813..296658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(296963..298888) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(299063..300163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(300339..301844) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(301889..303091) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(303088..303987) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(303984..304220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 304408..304911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 304988..305509 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 305502..306695 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(306745..308382) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 308510..309124 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 309121..310623 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(310721..311200) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 311372..311575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 311686..312417 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 312417..313505 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 313542..316010 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 316075..316758 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 316789..316980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 317012..318625 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(318639..319415) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(319445..320176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 320476..321717 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 321714..322931 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 322998..323771 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 323768..324160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 324172..325926 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 325955..326374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 326358..326807 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene soxR CDS 326973..327335 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 327332..328969 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 329069..329500 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 329521..331119 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 tRNA complement(331126..331199) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 331432..332193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(332209..333009) product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(333006..334028) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(334121..335344) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(335380..335862) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene nsrR CDS 336036..336971 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 337012..338064 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 338098..339021 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 339290..340042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(340103..342001) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene htpG CDS 342192..342827 product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene devR CDS complement(342880..344553) product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 344793..345392 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(345393..345722) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878426.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(345839..346321) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(346321..347115) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 347203..347943 product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene cobF CDS complement(347933..348367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(348442..349989) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(349994..351415) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 351532..351864 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 351882..352223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(352231..353502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(353514..354287) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 354425..355225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(355232..356908) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene pgi CDS 356874..358412 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(358440..358733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 358913..361366 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene pcrA CDS complement(361381..362268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 362761..363930 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene sucC CDS 363946..364848 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene sucD CDS complement(364933..365568) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 365671..366441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 366446..367909 product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 367997..368605 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene purN CDS 368598..370184 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene purH CDS complement(370215..370430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(370752..371717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(371810..372748) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(372815..373072) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene rpsR CDS 373168..373854 product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene mprA CDS 373851..375308 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 375409..376755 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 376800..377294 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 377319..377492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(377489..377944) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene mscL CDS complement(377983..378690) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(378792..379076) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(379168..379761) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 379828..380751 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 380818..382077 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 382085..382720 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(382738..383475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 383956..384762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 tRNA 384855..384929 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(385005..385421) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 385593..385748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 385804..386610 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(386594..387304) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(387330..388397) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 388588..389733 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 389730..390356 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 390380..390889 product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 390913..392217 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene arcA CDS complement(392214..392588) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene arsC CDS 392667..393038 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 393040..393507 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(393535..395127) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 395130..395969 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene rsmI CDS complement(396027..396194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 396427..400494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(400415..401707) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(401737..402921) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(402966..404555) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene metG CDS complement(404552..404779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 404678..405421 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 405526..406653 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 406663..407790 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 407800..408696 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene rsmA CDS 408747..409340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 409475..410263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 410428..412032 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(412034..414271) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 tRNA 412325..412398 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(414268..415170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(415179..415388) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 415733..415936 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 416044..416979 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 416979..418778 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 418893..419423 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 419498..420529 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(420513..421190) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene pnuC CDS complement(421187..422887) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 423036..424664 product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(424672..425547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 425777..427831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 427834..429450 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 429447..430628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 430625..431077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 431078..432115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 432152..432847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 432887..433732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 sequence13 source 1..70257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(231..626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 580..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1221..2111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(2126..2503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(2491..2898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(2882..3169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(3308..3523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(3732..3974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(4110..5351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(5348..5842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(5997..6488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(6485..6703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 7001..7492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 7499..8650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 tRNA complement(8699..8789) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(8841..9038) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(9176..9634) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(9631..10194) product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 10244..11209 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 11206..12561 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(12569..13069) product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(13222..14277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 14387..15550 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 15627..15998 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 16059..16889 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 16924..17721 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 17718..18455 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 18452..19354 product mycobacterial-type methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411241.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 19476..21083 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(21097..22023) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(22101..22934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 tRNA complement(23122..23195) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(23242..23333) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(23420..24118) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067845886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 24219..25298 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene hisC CDS complement(25305..26708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(26777..27454) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(27473..28321) product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 28643..29821 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(29874..30860) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 tRNA complement(31028..31116) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(31159..31635) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(31669..32850) product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 32889..33884 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(33894..35105) product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 35233..35817 product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 35899..36765 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 36778..37593 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 37590..38477 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(38474..39112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 39287..40552 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 40564..41373 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 41405..42772 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 42789..43928 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 43925..45025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 45022..46644 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384235.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 46817..47677 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(47690..49570) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 49667..51928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 51991..52989 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 52991..53923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(53924..55000) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene rfbB CDS 55009..55884 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene rfbA CDS 55888..56493 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 56525..57034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 57031..57861 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(57914..58465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 58720..59595 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene rfbA CDS 59589..60194 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 60199..61308 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(61323..62171) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(62248..62715) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 62896..64320 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 64320..65081 product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(65175..66038) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(66035..66277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 66165..68012 product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(68014..69426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 69501..70016 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 sequence14 source 1..64714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 661..1722 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2041..2349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2511..2846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2872..3072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 3562..4302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(4364..5419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(5666..5998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(5995..6246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 6572..7132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 7120..7779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 8083..8334 product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene yefM CDS 8331..8591 product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene yoeB CDS complement(8931..9413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 9700..10035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 10219..11184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(11312..12061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(12252..12515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 12736..13200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(13351..13725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(13992..14423) product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(14741..15178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(15319..15513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(15822..16058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(16181..16450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(16571..16996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(17006..17290) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(17411..17785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 18087..18440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(18586..18897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 18791..19006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(19259..19840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(20101..20586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(20723..21064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 23822..25156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 25660..26853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(26850..27248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 27640..28101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(28173..28469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(28540..30492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(30711..31295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 31518..32096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 32098..33990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 34205..35863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 35918..36238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 36274..36834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 36843..39869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 39900..42881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 42894..43475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 43573..43899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 43896..44522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 44753..47194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 47194..47772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 47871..48242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 48248..49519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(49802..50884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(50920..51273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(51404..51724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(51752..52657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(52673..53758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(54047..55768) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(55772..56728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 56924..57400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 57425..58549 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 58704..59693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(59971..60276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 60185..60487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 60638..61216 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(61291..62319) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 62492..62806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(63028..63969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 sequence15 source 1..59424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 250..399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(406..942) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 1049..1531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 1545..2003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2007..2822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2888..3706 product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 3774..4193 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 4199..5365 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(5427..6089) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(6114..6950) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 7122..9035 product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene mutA CDS 9032..11293 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene scpA CDS 11271..12281 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene meaB CDS complement(12351..13031) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(13099..14085) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 14186..15061 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(15062..16309) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(16306..16674) product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(16702..17097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(17241..17513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(17776..18546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(18543..18983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(19331..19828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 20036..20605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 20647..20865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(20914..22335) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 22608..23834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 tRNA complement(23904..23990) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 24298..25626 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene tnpB CDS 25654..27009 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 27028..27561 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 27895..28218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 28296..28673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 28712..29353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 29599..30483 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461762.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(30549..31103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(31251..32318) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(32372..33385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(33495..34361) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(34361..35419) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(35433..36452) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(36452..37135) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(37254..38153) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 38344..39192 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 39200..39499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(39809..40234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(40367..40555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 40609..40980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(41056..41682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(41679..42143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(42309..43073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 43118..43579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 note possible pseudo, frameshifted CDS 43585..43947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 note possible pseudo, frameshifted CDS complement(44202..44873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 45196..45729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 45726..47804 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 47942..49915 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 49912..51261 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 51258..53045 product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 53100..56210 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 56255..59041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 sequence16 source 1..57756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 697..954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 994..1725 product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 1854..2894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2900..3886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 3883..5184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 5181..5834 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(5841..6470) product TetR family transcriptional regulator BioQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene bioQ CDS complement(6557..6718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 6659..7585 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene bioB CDS 7798..8352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(8622..9323) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898937.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 9427..10461 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene nadA CDS 10461..12047 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 12044..12907 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene nadC CDS 12987..13394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 13548..13676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 13654..14046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(14050..14667) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(14685..15989) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 16145..17479 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene hisD CDS 17476..18600 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 18600..19214 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene hisB CDS 19234..19371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 19371..20537 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 20594..21229 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene hisH CDS 21226..21477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 21524..22258 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene priA CDS 22272..23087 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 23103..23876 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene hisF CDS 23873..24220 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728899.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene hisI CDS 24302..24976 product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(24991..25437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(25495..26301) product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(26280..26819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 26928..27197 product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(27204..27359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 27462..27641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(27653..28147) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 28290..29828 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 29828..30517 product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 30598..31407 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene trpC CDS 31469..32755 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene trpB CDS 32752..33555 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene trpA CDS 33561..34463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 34460..35113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 35343..36161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 note possible pseudo, frameshifted CDS 36203..36388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 36385..37032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(36993..37649) product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene mpt83 CDS 37826..39391 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(39384..40136) product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene rskA CDS complement(40129..40734) product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene sigK CDS 40900..45492 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene gltB CDS 45485..46990 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 47148..48482 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296575.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene pyk CDS 48498..49385 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 49468..51333 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729783.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(51352..51693) product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(52082..52735) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 52801..53361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(53401..54594) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(54591..55043) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 55331..56224 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(56335..57648) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 sequence17 source 1..57266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(907..1533) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 1637..2527 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2608..3291) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 3395..3709 product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene mhuD CDS 3822..4145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 4136..4939 product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(4936..5685) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(5737..7113) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(7219..7869) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(7912..8652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(8908..9342) product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 9467..10060 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(10141..12615) product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene clpC1 CDS complement(12815..14050) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(14047..15804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(15835..16689) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(16858..17211) product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(17342..18853) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene lysS CDS complement(18984..19394) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(19391..19921) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073964.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(20081..20263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(20308..21120) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(21125..21547) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(21579..22523) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene panC CDS complement(22542..23480) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(23591..24529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(24588..25055) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(25061..25567) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113139.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene folK CDS complement(25564..25950) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene folB CDS complement(25943..26764) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048402.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene folP CDS complement(26797..27411) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene folE CDS complement(27490..29856) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene ftsH CDS complement(30080..31441) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 31559..33799 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(33760..34314) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene hpt CDS complement(34327..35310) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene tilS CDS complement(35307..36365) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(36372..37781) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene dacB CDS 37939..38430 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 38529..39191 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene lexA CDS complement(39217..40470) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(40484..41890) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 42130..42279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 42329..42448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 42513..42635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(42854..43684) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(43684..44295) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 44421..45503 product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 45519..46022 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 46084..46635 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(46644..47957) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 48262..52182 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 52179..53483 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(53469..54755) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(54752..55405) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(55457..56278) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(56275..56964) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 sequence18 source 1..52186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..949 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170424.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 1037..1261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 1258..2220 product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2228..2884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2987..3250) product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(3318..6002) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(5999..6889) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene tatC CDS complement(7028..7288) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene tatA CDS complement(7490..8458) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(8455..9462) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(9498..10841) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene pafA CDS complement(11040..11819) product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene prcA CDS complement(11816..12694) product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene prcB CDS complement(12691..12885) product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(13012..14511) product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895348.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene dop CDS 14623..15252 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 15262..16257 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 16283..16786 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 16881..17699 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104591.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 17737..18474 product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene scnC CDS 18525..18854 product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(18917..20680) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene arc CDS 20868..21293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(21385..22236) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 22393..23202 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(23285..24133) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075024.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene hisG CDS complement(24184..24486) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(24487..25371) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(25373..26230) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(26233..26931) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(26963..27436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839539.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(27436..28767) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(28807..32349) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene metH CDS 32428..33357 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 33354..34514 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 34705..35793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 35840..37309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 37306..38721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 38735..42925 product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 43214..44074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 44162..45415 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(45487..46728) product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene mshC CDS complement(46775..47575) product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(47578..48171) product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(48211..48894) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 48934..49581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 49578..49934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(50214..50372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(50676..51128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(51246..51908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 sequence19 source 1..52004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..1569) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene tyrS CDS complement(1562..2206) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091814.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2324..3052 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 3049..3810 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 note possible pseudo, frameshifted CDS complement(3815..4030) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(4081..7044) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(7154..8578) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene argH CDS complement(8582..9781) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(9833..10381) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(10345..11286) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene argF CDS complement(11291..12508) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(12505..13428) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene argB CDS complement(13425..14675) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene argJ CDS complement(14672..15754) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene argC CDS 15848..17488 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(17493..17828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(17992..18537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 18655..20142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(20286..22775) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729318.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene pheT CDS complement(22816..23886) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene pheS CDS complement(24007..24807) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(24831..25220) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene rplT CDS complement(25285..25479) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rpmI CDS complement(25535..26050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 26513..26911 product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 26966..27166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(27243..30188) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene uvrA CDS 30371..31063 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 31159..31884 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095823.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 31985..34270 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(34293..34745) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(34850..35719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(35751..37907) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene uvrB CDS 37981..38502 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519677.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(38512..39762) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene coaE CDS 39869..40081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(40332..41804) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408066.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene rpsA CDS 42085..42933 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(42974..43738) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(43735..44679) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(44701..45597) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(45717..46814) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216586824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 46831..47361 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 47438..47803 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene trxA CDS complement(47850..50513) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene polA CDS complement(50623..51243) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 tRNA 51344..51420 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(51497..51856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 sequence20 source 1..49334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1989) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728877.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene treZ CDS 1909..2763 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031934.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2768..5137) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene treY CDS complement(5134..5394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 5275..7557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 7722..8738 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 8735..9772 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 9780..10535 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 10532..11335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 11345..12577 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406219.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 12645..13568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(13675..14073) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(14075..15145) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112738.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene arsB CDS complement(15142..15483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 15640..16887 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 16988..18532 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 18558..19865 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 19888..20322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 20356..21519 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 21516..22205 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene bioD CDS complement(22194..22499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(22579..22779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(22923..24080) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(24113..25096) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(25090..25734) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(25766..26527) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(26558..27751) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(27830..28630) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 28820..29608 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(29658..30269) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(30379..31929) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(32123..32686) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 32928..34040 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 34076..35065 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 35073..36359 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083669.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene eno CDS 36410..37312 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 37491..38978 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 38992..39936 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385804.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 39933..41936 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(41949..42164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(42252..42668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 42967..44505 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 44502..46079 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 46174..46905 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene hpaI CDS 46905..48371 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene leuC CDS 48471..49082 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 sequence21 source 1..46035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 510..1241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 1951..3093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 3093..3905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 3949..5124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(5212..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 5817..8297 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene recG CDS 8376..9404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 9401..10162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 10159..10488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 10637..11767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 12060..12299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 12419..12787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 12937..13614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(13696..14202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(14421..14660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(14657..14917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(14985..15428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(15425..16735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 16935..18725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(18737..19180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(19205..19669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 19793..20440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 20573..21436 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(21377..22357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(22414..22944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201953910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(22898..23335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(23354..24004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 24507..24824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(24821..25444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 25576..26562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 26703..27209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 27498..32372 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 32692..33051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 33222..33677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(33764..34399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(34595..39328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 39700..40035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 40216..40380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 40496..41146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(41200..41523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 41856..42275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 42381..42626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(42928..43140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(43133..44737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(44901..45527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 sequence22 source 1..43894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..1590) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 1673..2878 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110014.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 2878..3675 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 4062..6497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 assembly_gap 6376..6472 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6511..7770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 assembly_gap 7634..7732 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7823..8926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 8942..9595 product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(9605..9856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 9997..11610 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 11712..13178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 13225..14172 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 14336..15049 product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 15078..15440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(15506..16006) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(16365..17786) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229629.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 17892..18374 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(18359..18736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(18746..19474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 19763..21031 product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(20973..21263) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 21297..21689 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(21693..21875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 22157..24130 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene typA CDS 24238..25977 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 25991..26869 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene mshB CDS 27048..27470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 27525..27743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 27801..30389 product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(30394..31416) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 31519..32466 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 32547..32870 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296419.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 32894..33994 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene dapC CDS 34158..35804 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene pruA CDS 35804..36772 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 36805..38232 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(38223..39077) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 39126..40157 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(40162..41109) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(41106..41747) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(41836..43602) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082857.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 sequence23 source 1..336012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..1861 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene cas1 CDS 1866..2153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 repeat_region 2323..5026 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcgtccgtgcccaagcggcacggcctcattgaggc CDS complement(5016..5768) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 5862..7589 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene ctaD CDS 7638..7994 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 8117..9493 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 9499..9837 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 9827..12262 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 12305..13888 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene ffh CDS 13890..14978 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899537.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 15144..15281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 tRNA complement(15400..15484) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(15555..16187) product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 16558..25863 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 25863..26276 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(26355..27053) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 27199..28578 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(28583..29077) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene bcp CDS 29187..29408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 tRNA complement(29546..29620) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(29674..29747) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 30102..31241 product L,D-transpeptidase LdtMt2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene ldtMt2 CDS 31375..31515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(31600..31740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 tRNA complement(32113..32187) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(32271..32837) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene orn CDS complement(32940..34058) product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894835.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(34142..35428) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene lysA CDS complement(35551..36354) product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene cmrA CDS complement(36392..38413) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(38428..38967) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 39072..40424 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(40453..41298) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(41391..42740) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene gdhA CDS 43147..44562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 tRNA complement(44756..44832) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(44882..45859) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 46056..48092 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 48289..48765 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene ssb CDS 48848..50011 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 50197..51876 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896081.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene ettA CDS 51882..52307 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 52417..57291 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 57288..57764 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060104.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 57757..58407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(58411..58773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(59031..59618) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(59615..60847) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(60917..61276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 61322..61717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(61721..63085) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(63096..63977) product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(64036..65580) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(65651..66055) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 66239..66808 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 66805..67134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 67121..67594 product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(67673..70246) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene pepN CDS complement(70465..71709) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 71879..72505 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 72561..73040 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 73045..73842 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(73839..74636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(74752..75885) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112987.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 tRNA complement(76136..76209) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 76347..76423 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 76528..77907 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene tig CDS 78047..78655 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 78705..79367 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 79580..80857 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene clpX CDS complement(80948..81979) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112330.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene dmpG CDS complement(81982..82974) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(82971..83786) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(83887..84639) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(84677..85381) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 85408..86622 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(86619..87443) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene fdhD CDS complement(87444..89912) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 89830..90447 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 90455..92500 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 92681..95335 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 95332..96762 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 96759..97187 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 97206..97625 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene ndk CDS 98081..101242 product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201954410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 101510..101821 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene rplU CDS 101887..102150 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rpmA CDS 102300..103760 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084930.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene obgE CDS 103757..104857 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene proB tRNA 104616..104704 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(104893..105714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 105845..107713 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(107710..108126) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(108171..109430) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene ectB CDS complement(109445..109924) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene ectA CDS complement(110120..112285) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(112282..113133) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729943.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(113239..114624) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 114696..115979 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 116044..116796 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296447.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene nadD CDS 116797..117222 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rsfS CDS 117219..117914 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 117863..118630 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 118635..119492 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 119583..120443 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 120440..122812 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 122809..123786 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene holA CDS complement(123930..124190) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene rpsT CDS complement(124421..124990) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 125155..127017 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene lepA CDS 127036..127968 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(127978..128370) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(128388..130310) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 130576..131616 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 131626..131847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 132291..133322 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 133331..134224 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093159.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene cysT CDS 134221..135027 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene cysW CDS 135024..135971 product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 136096..136686 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(136672..137916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(137981..138730) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(138735..140030) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110195.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(140030..140953) product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(140962..141738) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(141735..143450) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 143910..144062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 144189..145409 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene hemW CDS complement(145414..145719) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 145840..146883 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene hrcA CDS 146950..148107 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene dnaJ CDS 148127..148888 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 148950..149702 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(149693..151312) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 151453..152100 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 152178..153236 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 153321..153863 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene ybeY CDS 153903..155225 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 155222..156139 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene era CDS 156204..156995 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene recO CDS 157000..157764 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 157761..158156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(158282..158698) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(158695..159036) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060366.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 159200..160591 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(160618..161484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(161487..162851) product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(162848..163666) product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(163698..164792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(164789..165745) product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(165868..167886) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 167922..168650 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 168647..169930 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085034.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(169932..170765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 170892..172811 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene dnaG CDS complement(172831..173079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 tRNA 173216..173289 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(173357..174043) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 tRNA 174214..174289 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 174295..175233 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 175227..176174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156232331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(176184..177251) product ParB/Srx family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194141.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 177523..178650 product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891558.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 178685..179503 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 179684..180193 product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(180220..181125) product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene lipA CDS complement(181270..182703) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(182805..184052) product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene kasA CDS complement(184060..184371) product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene acpM CDS complement(184392..185291) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(185429..186763) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085223.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(186867..189593) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene aceE CDS 190104..190526 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411534.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 190554..191018 product peroxiredoxin AhpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene ahpE tRNA 191051..191124 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 191142..192434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(192431..192703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 192870..193394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 193443..194039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 194036..194539 product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 194536..194934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 194967..195437 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 195485..196987 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 197014..198012 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(197994..198950) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(198979..199707) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 199706..200752 product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene cobC CDS 200749..201885 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 201979..202716 product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 202713..203819 product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 204096..205478 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(205498..206733) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(206756..207343) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(207852..208013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 208189..208371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(208395..209285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(209342..210298) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene pip CDS complement(210302..210745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(210825..211670) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene panB CDS 211949..212773 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 212840..214441 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 214492..215850 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene glnA CDS 215847..218861 product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110447.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(218865..219551) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 219724..220845 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 221225..221728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 221824..222813 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(222883..224148) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(224492..225928) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene glnA CDS 226166..226642 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085293.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(226747..227502) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(227588..228604) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene lipA CDS complement(228657..229463) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene lipB CDS complement(229460..230350) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(230434..232230) product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene sucB CDS 232453..232785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(232837..234357) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 234415..235548 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene gcvT CDS 235602..236705 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729696.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(236770..237531) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(237534..238625) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene cobT CDS complement(238622..239212) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(239292..239990) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 240053..241132 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 241192..241542 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 241647..242618 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(242689..244614) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene asnB CDS 245091..246008 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085336.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 246045..246461 product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(246630..247655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(247710..248717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(248816..249658) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 249756..250400 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(250503..252146) product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(252143..253279) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093315.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(253276..254148) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(254213..254755) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 254951..255412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224079.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 255492..256583 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene trpD CDS complement(256570..256845) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(256842..258587) product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 259135..259737 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 259930..260994 product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene ripC CDS 261038..262411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 262449..263576 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(263731..265542) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080244.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 265710..266099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067531.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 266188..266628 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 266658..267818 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907999.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 267815..268183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 268180..269142 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 269257..270000 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 270009..270566 product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(271492..272817) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 272888..273379 product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 273488..274855 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(274964..276961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 277115..277483 product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(277503..278426) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(278423..280051) product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(280137..281741) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene crtI CDS complement(281747..282922) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 283025..283969 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene metF CDS complement(283980..285134) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(285141..285863) product lipoprotein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene lppM CDS complement(285899..286705) product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(286702..288288) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(288309..288941) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 289220..289612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 289825..290253 product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 290472..290999 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060894.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene mraZ CDS 291201..292217 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene rsmH CDS 292214..292870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 293014..294780 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 295000..296592 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 296589..298112 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene murF CDS 298109..299203 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene mraY CDS 299207..300754 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene murD CDS 300751..302220 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene ftsW CDS 302217..303362 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene murG CDS 303359..304858 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene murC CDS 304855..305691 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 305928..307199 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene ftsZ CDS 307196..307936 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729652.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene pgeF CDS 307947..308708 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 308812..309399 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074951.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 309454..309804 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 309919..310830 product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729650.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene wag31 CDS 310871..311068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 311296..314481 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene ileS CDS 314549..315889 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 316014..316499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(316567..317520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 317709..318200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 318206..319123 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728869.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 319120..319791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(319796..320836) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 320896..321843 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene rarD CDS 321914..325450 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082233.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene dnaE CDS complement(325460..326503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(326500..327438) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(327467..327673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 327771..328238 product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(328266..330266) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029219.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 330499..333636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(333637..334173) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 334295..335809 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 sequence24 source 1..42651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..672 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(685..1215) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(1494..2885) product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(3001..4137) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(4181..4963) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(4968..6134) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 6227..7165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 7267..8193 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene cysD CDS 8193..10049 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene cysC CDS 10043..11173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(11183..14476) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 14532..15566 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 15585..16856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 tRNA complement(16934..17007) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(17201..17917) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(17919..18809) product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 19049..20653 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene argS CDS 20650..22071 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene lysA CDS 22068..23381 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 23378..24463 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene thrC CDS 24463..25428 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730210.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene thrB CDS 25756..27723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 27886..28119 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059822.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene rpmE CDS 28148..29341 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene prfA CDS 29346..30239 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene prmC CDS 30273..30935 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 30938..32095 product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene rfe CDS 32117..32596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 32975..33754 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene atpB CDS 33823..34074 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 34084..34644 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 34650..35474 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 35536..37179 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene atpA CDS 37228..38208 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 38215..39663 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene atpD CDS 39670..40038 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 40080..40517 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(40584..41162) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 41266..42474 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene murA sequence25 source 1..38746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..959) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229373.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(956..2518) product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127917152.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene fadD5 CDS complement(2633..3400) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 3539..4732 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 4997..5599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 5604..6293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(6442..7227) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401404.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(7218..7889) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(7898..9040) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 9168..10667 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 10672..11589 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(11583..12446) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227665.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 12558..13493 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227664.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(13503..14357) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(14534..15841) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 15999..16931 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(16932..17540) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene recR CDS complement(17550..17873) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083655.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(17936..18370) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083660.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 18549..20150 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 20289..21743 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 21740..23041 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 23171..24142 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(24249..26390) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(26423..27637) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 27843..29537 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene gatA CDS complement(29708..31810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(32014..32457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(32540..33010) product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 note possible pseudo, internal stop codon CDS complement(33087..34412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 34515..35576 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(35631..36923) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 tRNA 37157..37244 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 37428..37661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 37831..38007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(37982..38425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 sequence26 source 1..31904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..4535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 4523..5536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 5577..5819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 5816..6061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 6152..6538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(6565..7593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 8213..8626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 8783..9391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(9403..9690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(9708..10787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(10800..11912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(11928..14516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(14714..15724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(15820..17409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 17580..18821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(19093..19254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(19639..20457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(20534..22876) product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene rad50 CDS complement(22971..24317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 24539..25585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(25662..25982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(26066..28255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 28461..29165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 29471..30742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 sequence27 source 1..29042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(595..1125) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(1233..2894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(3131..4222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(4457..4669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(4739..5020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 5013..5354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 5401..6813 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene dnaB CDS 6891..7295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 7313..7537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 7537..7974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 8088..8558 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(8555..9298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 9444..9872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 9892..10737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 11282..12259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 12435..13097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(13122..14210) product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene mcrC CDS complement(14221..15996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 16186..18408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 18421..19023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(19020..19337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 19354..20040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 20037..20573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 20642..21418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 21531..21686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 21706..22500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 22463..22957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 23141..23707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 23990..25318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 25587..26045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 26045..26326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 26730..27083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(27865..28239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 sequence28 source 1..28752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..1634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 1706..1993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 2147..2914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 3538..4533 product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 5485..6732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 6828..7190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 7369..8058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 8158..8466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 8643..9215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 9488..9919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 10088..11074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 11120..11659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 11656..12822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(12792..13232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 13557..14066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 14063..14368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(14731..15033) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877443.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 15143..16744 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 16858..17790 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 17783..18625 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 18625..19491 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 19488..20132 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(20261..20566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(20717..22576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(22683..22913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(22906..23850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 24065..25252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 25373..25690 product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 25918..26649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 26751..27044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 27151..28692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 sequence29 source 1..28239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 599..1636 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 1620..3176 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 3173..4231 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(4248..6041) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene ctaD CDS 6218..7147 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene gluQRS CDS 7233..8090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 8215..8976 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(8943..10196) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene tgt CDS complement(10311..11486) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(11489..13414) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(13411..15144) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(15250..17583) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(17612..18217) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(18321..18776) product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(18823..20058) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(20055..20510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(20560..21243) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(21323..22210) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(22207..23016) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 23162..23755 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(23742..24563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(24566..24898) product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(24974..25408) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(25477..27225) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176397.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(27247..28089) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 sequence30 source 1..26270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 note possible pseudo, frameshifted CDS complement(649..852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(864..1793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 2204..3571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 3654..4883 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 4880..6121 product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 6329..6781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 6778..7509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 7692..8273 product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495104.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 8424..8753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 8891..24946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(24918..26144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 sequence31 source 1..26203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..1096) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene pssA CDS complement(1126..1839) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113180.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(1943..2410) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 2547..3326 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064851.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 3435..3956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 4191..5816 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene groL CDS complement(5907..6107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 6213..7046 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563158.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 7176..7316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(7399..8463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(8460..10583) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 11194..11346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 11479..12882 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene lpdA CDS complement(12971..14488) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(14660..15376) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(15404..15973) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085920.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 16088..16885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(16842..18251) product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene ramB CDS 18450..19223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 19592..20881 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene aceA CDS 20981..21877 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 21970..24258 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene metE CDS complement(24326..25924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 sequence32 source 1..18036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(471..1199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(1199..1405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(1715..2317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(2403..2813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(2940..3296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3708..3992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3989..4153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(4310..4693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 5565..6167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 6256..6549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 6974..7861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 7858..8151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 8141..8623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(8604..8849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(8846..9433) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(9567..10643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897749.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(10707..13085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 12979..13350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 13838..14782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(14924..15193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 15306..15575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(15638..15877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(15877..17106) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(17103..17804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 sequence33 source 1..17593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..1397 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(1394..2143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(2160..4397) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(4398..7148) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(7182..13565) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 13738..14817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 14792..15637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(15742..16584) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900538.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 16677..17507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 sequence34 source 1..261887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..1765) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(1762..2151) product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(2222..2590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(2642..3193) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 3506..4126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(4119..5834) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene leuA CDS 5911..6594 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(6551..7579) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(7672..9171) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 9302..10366 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 10382..11032 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(11046..11729) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 11816..12247 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 12244..12879 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene folE CDS complement(12899..15442) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112450.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(15454..16110) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(16110..16874) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene trmB CDS 17209..17769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 17766..19202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 19235..19540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 19835..21664 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 21905..22837 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene cysK CDS 22843..23421 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene cysE CDS 23602..24216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 24360..24692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 24689..25516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 25513..26133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(26173..28875) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(28865..31897) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 32007..32291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(32301..34247) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(34383..35831) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(35909..36796) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(36816..37580) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 37663..38880 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296766.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(38825..40558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 40630..41805 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 41806..42378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(42593..43738) product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(43752..44195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(44529..44936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(44967..49256) product alpha-(1->3)-arabinofuranosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(49237..49410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(49465..50580) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(50627..50896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 50778..52322 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831451.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(52325..52792) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 52923..54110 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908964.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 54237..55814 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 55915..56508 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876752.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(56525..56824) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 57400..57699 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(57761..58633) product 3-hydroxyacyl-thioester dehydratase HtdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401305.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene htdX CDS complement(58633..59979) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 60097..61446 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401309.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 61657..63612 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(63762..65597) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(65672..66289) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(66489..66929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(66985..68064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 68419..69429 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(69459..70391) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 70330..70518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 70538..71302 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 71338..71577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 71608..72897 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(72886..73059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(73108..73359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(73560..73811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(73840..74580) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 tRNA complement(74672..74743) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 74868..75455 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727114.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene dcd CDS 76006..77541 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 77639..78964 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 78937..80022 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478165.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 80019..81050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 81047..82123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 82138..83214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 83262..84722 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(84733..85611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(85608..86885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(86996..88792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 89033..107494 product non-ribosomal peptide synthase/polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169347939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 107570..108997 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(109055..109174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(109341..109889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 109971..110759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(110744..112030) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727121.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(112236..113447) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401733.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(113578..113763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(113897..114316) product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 114348..116291 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(116441..117400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(117693..120800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 note possible pseudo, internal stop codon, frameshifted CDS 121257..121886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(121957..123270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(123423..124802) product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027377.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(124828..127398) product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene iniR CDS complement(127401..129095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 128989..129219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 129352..130554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 130630..132459 product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene iniA CDS 132456..133925 product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892122.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 133983..136118 product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037705.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(136138..137553) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 137896..139737 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065061.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene dnaK CDS 139734..140300 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene grpE CDS 140389..141561 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene dnaJ CDS 141590..142000 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 142366..143580 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 143624..144481 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 144485..146308 product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 146308..147027 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(147113..147979) product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(148049..148300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 148452..149147 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087452.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(149189..150121) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(150138..150929) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087450.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(151104..152036) product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087449.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene bphC CDS complement(152080..153261) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(153258..154439) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 154595..155404 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086134.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 155404..156237 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112839.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 156249..157067 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 157295..158872 product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene fadD8 CDS complement(158934..159662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(159835..160530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(160640..161068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(161093..162256) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 162504..165056 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene clpB CDS complement(165111..165695) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222845.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(165765..167375) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 tRNA complement(167808..167884) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 168011..168865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 168967..169614 product trehalose monomycolate transport factor TtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene ttfA CDS 169717..170319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 170404..170937 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene pyrE CDS complement(171016..171525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 171653..172753 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene galT CDS 172756..173910 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene galK CDS complement(174036..175286) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(175283..175771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 175928..176671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(176668..177123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(177149..177697) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728158.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 177903..178832 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 178832..179989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 180058..180801 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 180968..181957 product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085728.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(182000..182794) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 182929..183963 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene fbaA CDS complement(184092..184655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 184717..185133 product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 185120..186265 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 186325..187260 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727169.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(187250..187711) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(187755..188717) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 188824..189738 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 189808..190113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(190169..190945) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401851.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(191012..191686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 191976..193265 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085742.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(193358..193900) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 193945..194550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(194631..195257) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(195254..196342) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115042.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(196499..197083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(197405..198574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(198611..200029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(200238..200543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 200607..202070 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(202131..203231) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 203330..203737 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 203739..204452 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(204449..204874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070947244.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 204916..206127 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene purT CDS complement(206142..206885) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(207001..208365) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 208556..209041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 209117..209536 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 209533..210756 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 210774..211661 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 211669..212691 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 212688..213479 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 213479..214342 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(214273..215058) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(215061..216035) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 216187..216861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 216858..217334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 217409..218422 product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene fgd CDS 218466..219068 product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376499.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(219171..219680) product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 219847..221610 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene ctaD CDS complement(221635..223866) product serine/threonine-protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727190.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(223876..224856) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900142.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(224853..226163) product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene glnX CDS 226325..227164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(227221..228612) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 228670..229176 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(229184..229579) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 229728..230978 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 231016..231459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(231476..232168) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene thiE CDS 232305..233372 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727195.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene thiO CDS 233384..233593 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene thiS CDS 233586..234344 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 234460..234999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 235102..236058 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 236055..236807 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 236885..238360 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402133.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 238428..239240 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 239315..239500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(239492..240349) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene thiD CDS 240429..240944 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(241018..241926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(242035..242649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(242685..243506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 244319..244690 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 244794..245126 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(245133..245933) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(245948..246178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(246195..246812) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 246956..247282 product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 247368..247955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 248018..248701 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727227.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 248782..249900 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892265.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 249925..251229 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(251282..251623) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064840.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene mnhG CDS complement(251620..251880) product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(251877..252449) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(252446..254047) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(254044..254601) product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(254601..257372) product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113179.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 257596..258057 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(258010..259383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(259406..261577) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092266.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 sequence35 source 1..17276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 741..1715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 1812..3938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 4379..4987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 5186..5842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 6037..6312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 6431..7009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 7006..7359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 7356..7676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(8234..8635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(8628..9419) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296248.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 9458..10975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 11087..11299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 12143..12418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 12618..12842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 15046..16044 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 16059..16571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 16846..17148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 sequence36 source 1..16379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1572) product ISL3-like element IS31831 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(2485..3969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 4183..4395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 5019..5609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(5694..5903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(5937..6716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 6890..7948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229078.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 8000..8563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 8829..9752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(9896..10159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 10281..10778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(10814..11245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 11644..12045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(12125..12691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 12824..13012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(13052..13573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 note possible pseudo, internal stop codon, frameshifted CDS complement(13840..13989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 14112..15194 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(15343..15504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 sequence37 source 1..13688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 756..1355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 1412..1750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(1714..2412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 2577..3464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 3464..3775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 3839..4612 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 4615..4872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 5246..5698 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(5771..7099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(7096..8175) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 8421..9368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 10031..10978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 11149..12333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 12468..13142 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 13241..13489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 sequence38 source 1..12375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..699 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043791004.1:ISAs1 family transposase locus_tag LOCUS_31590 CDS 850..1542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 1568..2053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(2089..2463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(2574..2798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 2840..4237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 note possible pseudo, frameshifted CDS complement(4244..4969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(5264..5815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(6240..7142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(7326..7754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(7769..10243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(10240..10668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(10736..11458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(11557..12102) product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092977.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 11990..12301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 sequence39 source 1..11777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(480..1664) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene eno CDS complement(1657..2235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 2161..2568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 2695..3618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 3887..5041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 5185..6102 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 6146..6718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 6722..7588 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 7593..8177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 8170..9813 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 9887..11443 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 sequence40 source 1..11696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..2411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(2538..2780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(3051..3809) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(4147..4518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(4667..5269) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(5418..6182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 6417..9497 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 9686..10027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(10061..10315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 note possible pseudo, internal stop codon, frameshifted CDS 10469..11197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 sequence41 source 1..9992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(486..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(1330..2043) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(2278..2712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 2772..3032 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114847.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3061..7368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 7655..7834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 8601..9233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 9284..9514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 sequence42 source 1..7943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(942..1085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(1322..1702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(1851..3032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3263..3712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(3863..4078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(4089..5000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 note possible pseudo, frameshifted CDS complement(5265..5786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(6121..7071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(7175..7720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 sequence43 source 1..5703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 467..1980 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 2322..5448 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence44 source 1..5328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(331..1407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 1655..3991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(4060..4779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(4889..5173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 sequence45 source 1..208018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 626..1273 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 1270..2289 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729306.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 2352..2570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 2605..3405 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 3402..4319 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058622.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 4322..6097 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110859.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene recN CDS 6201..7385 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene steA CDS 7382..8326 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058615.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 8416..10143 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 10150..10800 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 10797..11738 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene xerD CDS 11854..12732 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 12729..13523 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 13520..14218 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene scpB CDS 14232..15236 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 15233..15931 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene cmk CDS 15928..17373 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729299.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene der tRNA 17475..17550 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 17737..17922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 18032..20128 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(20145..21512) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(21676..21978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(21975..22463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 22612..23238 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 23314..23946 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079356.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 23943..24827 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901262.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 24824..25192 product DUF1290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 25189..25962 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 26009..26413 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene gcvH CDS 26659..27153 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 27183..27887 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 27949..28422 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 28655..29245 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 29528..32365 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene gcvP CDS 32550..33398 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 33448..33888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(33968..36262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(36274..37413) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(37410..38627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(38691..40886) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075497.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(41395..41757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(41765..42049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 42364..43707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 43879..44058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(44062..44520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(44559..45014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(45074..45835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 45897..46583 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 46587..48263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 48267..48731 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 48718..49182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776876.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 49204..50253 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930166.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(50267..53566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(53727..54599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(54606..55694) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(55687..57066) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(57321..58205) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(58211..59536) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(59648..60802) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene acdA CDS complement(60892..62319) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(62355..63161) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232398.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene fadH CDS complement(63158..65251) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729528.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(65316..66911) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(66958..68181) product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(68306..68890) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 69087..70538 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109880.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 70574..71818 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(71793..72245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(72246..72476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 note possible pseudo, internal stop codon CDS 72634..73071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 73068..74036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 74116..74268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(74585..76009) product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(76049..77017) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(77065..77466) product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(77463..78824) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899270.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(78821..80401) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(80589..81056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 note possible pseudo, frameshifted CDS complement(80992..81351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(82151..82429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(82589..83113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 83331..84074 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(84155..85300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(85297..86418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(86446..86865) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(86867..87313) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(87387..87992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 88172..88666 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene fxsA CDS 88685..90292 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729377.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 90282..91838 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene lnt CDS 92468..119278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 119346..119705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(119709..120659) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 120771..121739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(121768..122412) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227895.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(122423..123019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 123262..124014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(123995..124459) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(124512..124871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 124952..125329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 125326..125895 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(125898..126122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 126236..126676 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 126680..126958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(127304..127867) product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(127864..128565) product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 128682..129863 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 130178..130453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 130548..131624 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075004273.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 132072..132299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 132472..133023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 note possible pseudo, frameshifted CDS complement(134645..135634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(135634..136491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(136488..138593) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene pabB CDS complement(138600..138971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(139299..139637) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene rbpA CDS 139808..140140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 140259..141686 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 141683..142597 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(143432..143665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 144012..145037 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 145324..146766 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114663985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 146961..148307 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(148320..148775) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(149077..151593) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856739.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(151590..152909) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 153044..153463 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058519.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 153492..154457 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075506.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 154695..157079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 157226..158680 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091773.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene gndA CDS complement(158768..159298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(159413..160567) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 160840..164040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 164224..164673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 164997..166385 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 166523..167149 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 167584..168786 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179763269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(169147..170265) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109955.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 170382..171317 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(171412..171825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(171981..173663) product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064832.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene kstD CDS complement(173734..174321) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 174453..175013 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 175034..175219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(175348..175704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(175701..176090) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080074.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(176150..177487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(177484..178260) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 178370..179554 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 179592..180254 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 180389..181456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(181461..181871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 note possible pseudo, frameshifted CDS complement(183340..187083) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086495.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene cobN CDS 187113..188306 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene cobG CDS 188326..188952 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 188961..190448 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(190471..190683) product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 190568..190882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(190777..191442) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(191465..194059) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(194201..194938) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(194947..195696) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895328.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene cobM CDS complement(195701..196921) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(196918..197685) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 197730..198134 product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 198257..198715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(198728..199489) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(199514..200764) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(200899..202044) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080086.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 202319..202696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 202632..205331 product Tn3-like element TnAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138014.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(205477..206808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(206949..207332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 sequence46 source 1..5146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(1112..2083) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028342.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(2080..3102) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223672.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(3099..4145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(4174..5010) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 sequence47 source 1..3505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 729..1007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 1000..1548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(1611..1823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(1834..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 note possible pseudo, internal stop codon, frameshifted sequence48 source 1..2935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..879 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene fabG CDS complement(1020..2348) product ISL3-like element ISMsm4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(2556..2840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 sequence49 source 1..2501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(217..2406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 sequence50 source 1..2201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 839..1150 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 1147..2073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 note possible pseudo, frameshifted sequence51 source 1..1925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 398..1258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(1329..1799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 sequence52 source 1..1921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(748..1635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 1705..1872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 sequence53 source 1..1825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..1508) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 sequence54 source 1..1612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 364..1581 product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence55 source 1..1581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 note possible pseudo, frameshifted CDS complement(1069..1503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 sequence56 source 1..202200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..2792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 2789..4972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 4969..5910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 5913..7346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(7428..8903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(8936..12538) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene smc CDS complement(12561..12842) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(12848..13276) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(13269..14720) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(14779..15459) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene kdpE CDS complement(15456..18002) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915886.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene kdpD CDS complement(18010..18660) product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(18668..20776) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene kdpB CDS complement(20773..22473) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene kdpA CDS complement(22907..23551) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 23630..25093 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104558.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(25038..25895) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene mutM CDS complement(25911..26684) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081515.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene rnc CDS complement(26701..26886) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene rpmF CDS complement(26889..27455) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414824.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(27602..28369) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056943.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(28451..28945) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056942.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene coaD CDS complement(28942..29508) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene rsmD CDS complement(29536..32943) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(33109..35364) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093937.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene recG CDS complement(35381..37057) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081474.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 37376..37567 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene rpmB CDS 37767..38507 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(38570..39247) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056911.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(39244..39768) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(39778..40695) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 40893..41138 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 41140..41751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(41780..42886) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(42956..43954) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 44092..44808 product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415094.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene cofC CDS 44941..47076 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056904.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 47204..48088 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(48201..48959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(49116..49727) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene leuD CDS complement(49754..51268) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene leuC CDS 51308..52009 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 52124..52627 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 52694..52861 product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 tRNA complement(52915..52988) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(53013..53088) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(53183..53255) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(53442..54914) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene gltX CDS complement(55028..55759) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 55935..57128 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(57201..58220) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415144.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(58324..59916) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081440.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene serA CDS complement(60135..61148) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069737.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene ilvC CDS complement(61216..61719) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene ilvN CDS complement(61716..63665) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296656.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 63944..64471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 64556..66397 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene ilvD CDS complement(66569..67489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 67602..68705 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(68620..69861) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(69885..71396) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093966.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene gatB CDS complement(71463..72494) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 72478..72648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(72586..73248) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 73398..74678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 74675..76060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(76050..77258) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 77406..78029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 78026..79321 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329024.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 79340..79867 product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892314.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(79938..81422) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene gatA CDS complement(81419..81718) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene gatC CDS 81898..82548 product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519583.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(82552..83040) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(83268..85379) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene ligA CDS complement(85421..86452) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(86449..87537) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene mnmA CDS complement(87538..88674) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(88619..89602) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(89599..90414) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900617.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 90636..91595 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066638520.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(91714..92670) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056737.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(92715..93515) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056735.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 93788..94561 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 94558..96123 product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728284.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 96143..97387 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(97439..98089) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111782.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(98251..98556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(98699..99832) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene ald CDS 99959..101266 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727377.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(101272..102429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093988.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(102448..103425) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(103567..104346) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(104366..105172) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(105228..106121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078324130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(106137..106898) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(106895..108121) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056675.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene serB CDS complement(108259..109899) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene ctaD CDS 109832..110095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(110126..110305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 110559..111608 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727368.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 111592..112677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(112691..114055) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 114088..114588 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(114671..115678) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893682.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene nrdF CDS complement(115725..117830) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109420797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene nrdE CDS complement(117851..118309) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene nrdI CDS complement(118371..118604) product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056596.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 118846..119127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 119178..120005 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726607.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(120105..120665) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 120769..121383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 121393..122214 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728510.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(122215..122769) product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 122850..123692 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene nadE CDS 123706..124044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 123990..124160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(124164..124418) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(124411..125460) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene moaA CDS 125551..126759 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 126747..127754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 127747..128172 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 128302..129675 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080124.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(129676..130305) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077141.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene bluB CDS complement(130351..131415) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 tRNA complement(131892..131965) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(132121..132870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(132922..133431) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(134092..135465) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(135501..137138) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081136.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene pgm CDS complement(137219..137563) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene crcB CDS complement(137560..137925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 tmRNA complement(137984..138353) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 138505..139710 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229356.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 139814..141892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(141889..142362) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056461.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene smpB CDS complement(142427..143332) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907867.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene ftsX CDS complement(143384..144073) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene ftsE CDS complement(144137..144619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(144616..145527) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(145535..146638) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene prfB CDS 146698..147468 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene hisN CDS 147565..147882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 148083..149486 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 149520..150725 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 150920..151876 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972341.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 151873..152937 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670726.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 152942..153760 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681811.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 153760..154272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(154327..154809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413999.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 154947..156590 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 tRNA complement(156645..156721) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 157173..157730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(157832..160708) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950333.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 160928..161581 product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(161592..162632) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 162748..164166 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081023.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(164173..164742) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 164868..165752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 165760..167106 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111850.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(167143..167487) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098383.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 167598..167903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 168167..170116 product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230673.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(170138..172261) product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111856.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 172364..172615 product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene mrx1 CDS complement(172593..173537) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene nudC CDS complement(173548..174615) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081006.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(174683..178081) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111858.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(178078..181404) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 181461..182237 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111862.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 182240..182536 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090551.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 182592..184352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(184365..184718) product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(184809..185846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(185914..186903) product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 187120..188427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 188508..189827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 189923..190723 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(190677..191393) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(191390..192508) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080996.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(192541..192966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(193073..195574) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene nirB CDS complement(195571..197070) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(197067..199169) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(199166..200566) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077324.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(200996..201382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 201336..201788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 sequence57 source 1..1509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(428..1345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 sequence58 source 1..1427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..1369 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 sequence59 source 1..1385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 note possible pseudo, frameshifted CDS complement(947..1315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 note possible pseudo, frameshifted sequence60 source 1..1319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 note possible pseudo, frameshifted sequence61 source 1..1189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence62 source 1..1143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 17..322 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226878.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 337..1113 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226879.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 sequence63 source 1..1123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(768..1055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 note possible pseudo, frameshifted sequence64 source 1..1072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence65 source 1..188887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(631..831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 1010..2455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(2662..4767) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(4768..5985) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(6106..7329) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111512.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 7525..8376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(8321..9730) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 9899..11092 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(11089..11625) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 11800..12867 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546855.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene hemE CDS 12864..14216 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 14221..14916 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 14951..17242 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728553.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(17301..17735) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene msrB CDS complement(17732..18994) product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene aftC CDS complement(19027..20595) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908281.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(20618..21394) product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908282.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 21477..22430 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene zapE CDS complement(22458..22988) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(22993..24222) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 24242..25666 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 tRNA complement(25710..25784) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(25817..25892) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(25937..26011) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(26012..26083) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(26108..26181) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 26593..26665 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 26939..28987 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene thrS CDS 28930..29547 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057529.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 29579..30259 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 30256..31212 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 31221..32336 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 32333..33346 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090088.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 33494..34396 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene pdxS CDS 34526..35347 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 35409..36014 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene pdxT CDS complement(36099..37139) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091136.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 37439..38191 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 38365..40080 product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728641.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 40159..40740 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene ruvC CDS 40754..41356 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene ruvA CDS 41353..42441 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene ruvB CDS 42546..42875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 43044..44585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 44588..45724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 note possible pseudo, internal stop codon CDS 45729..47465 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 47474..48040 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 48132..50465 product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068903.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(50586..51377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(51377..52240) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 52420..53100 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 53116..54396 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene hisS CDS 54374..55024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227104.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 55123..57726 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(57686..58966) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112957.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 59213..60673 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 60670..61230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 61355..62023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(62057..62422) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(62914..64524) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(64581..65519) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 65688..67466 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene aspS CDS 67636..68796 product kae1-associated kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093587.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(68800..69330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 69643..71058 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 71222..73906 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene alaS CDS 73909..74484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 74481..75809 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 75806..76627 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413193.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 76813..77376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 77393..78589 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene aroC CDS 78594..79145 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 note possible pseudo, internal stop codon CDS 79150..80259 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene aroB CDS 80268..80684 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413001.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene aroQ CDS complement(80749..81315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 81475..82587 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 82605..83168 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene efp CDS 83169..83759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 83926..84522 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093570.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene pyrR CDS 84519..85466 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 85526..86845 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728776.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 86842..87390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082346.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 87387..88547 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728778.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene carA CDS 88547..91915 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111366.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene carB CDS 91912..92751 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111363.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene pyrF CDS 93219..93539 product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene mihF CDS 93616..94182 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025239507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene gmk CDS 94247..94546 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728783.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene rpoZ CDS 94561..95814 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene coaBC CDS 95923..97134 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene metK CDS 97170..99152 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296599.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 99827..100165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(100432..101448) product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(101537..102556) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(102549..103919) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 104165..105121 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 105215..106834 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 106946..107878 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224632.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene fmt CDS 107875..109398 product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728793.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 109416..109799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 109942..110988 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 110985..113336 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 113517..114188 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene rpe CDS 114190..115218 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene ribD CDS 115223..115840 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 115939..117186 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 117183..117668 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728796.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene ribH CDS 117665..118138 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 118171..120276 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene uvrC CDS 120273..121184 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene rapZ CDS 121190..122203 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057786.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene yvcK CDS 122194..123177 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057788.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene whiA CDS 123289..124308 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057792.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene gap CDS 124328..125539 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 125543..126328 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057795.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene tpiA CDS complement(126473..126997) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene speG CDS 127134..127367 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene secG CDS 127370..127780 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 127833..130613 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene ppc CDS complement(130678..130824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 131013..132359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 132401..132856 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 132982..133557 product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 133733..134308 product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 134398..135513 product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 135540..136169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 note possible pseudo, internal stop codon, frameshifted CDS complement(136216..137535) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 137697..138872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 138869..140071 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 140068..141363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 note possible pseudo, frameshifted CDS 141360..142487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 note possible pseudo, frameshifted CDS 142484..143347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 143344..144540 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 144568..146115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(146137..147990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(148325..149074) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894486.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene pgl CDS complement(149067..149990) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene opcA CDS complement(149975..151426) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082283.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene zwf CDS complement(151520..152638) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene tal CDS complement(152644..154794) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087835.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene tkt CDS 154953..155942 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057808.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(156003..156977) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 156992..157345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130196.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(157407..158375) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728826.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(158423..160006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(160064..160861) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(160858..161748) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(161826..163529) product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene mptB CDS 163784..164407 product suf operon transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407481.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene sufR note possible pseudo, internal stop codon CDS 164467..165912 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene sufB CDS 165939..167108 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene sufD CDS 167159..167947 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894511.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene sufC CDS 167952..169211 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 169214..169729 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 169726..170124 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894514.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 170126..170596 product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(170611..171453) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(171524..172501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(172642..173412) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 173533..175164 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 175275..175499 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 175527..175829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(175913..176479) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075960.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(176600..179401) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075957.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene acnA CDS 179725..180255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407520.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 180413..181858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 181983..183032 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024571137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 183053..183988 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 183985..184965 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 185032..185754 product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057861.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene fabG1 CDS 185812..186645 product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087822.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene inhA CDS 186650..187696 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 187968..188171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 188190..188402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 188371..188844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 sequence66 source 1..150233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..558 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 590..979 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 1006..1899 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 2050..3138 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(3139..3636) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727792.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 3725..4393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 4535..5140 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 5161..6021 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 6031..6306 product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080708.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(6338..7480) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(7477..8790) product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900028.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 9205..10584 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079512.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 10804..12021 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417452.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 12096..13295 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084599.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 13316..14119 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 14119..14625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 14625..15059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 15074..16129 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene trpS CDS 16137..17162 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene yhjD CDS complement(17179..18489) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(18625..19401) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056123.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(19401..21152) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056124.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene sdhA CDS complement(21168..21608) product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417269.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(21610..22014) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296683.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene sdhC CDS 22526..23626 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080733.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(23640..24881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111962.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(24930..25235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(25232..25579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(25591..26598) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727826.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(26595..26921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 26990..27613 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene upp CDS complement(27633..28115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(28197..29675) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080741.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(29675..30484) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 30514..31221 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079467.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 31310..32458 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088379.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 32455..33606 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080747.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(33608..34084) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 34277..35683 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 35844..37034 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 37173..37622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 37635..38246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(38195..39718) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene glpK CDS 39818..41536 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727860.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(41540..42079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(42099..43046) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 43361..43951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 44027..45004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(44952..46484) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(46481..47734) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 47800..49152 product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080767.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene lat CDS complement(49136..49396) product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909602.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(49400..49786) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098517.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 49888..50484 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 50604..52187 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 52233..53009 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(53013..53375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(53375..53824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(53855..55645) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(55805..57187) product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(57314..57727) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080777.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(57724..58635) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077428.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 58769..59197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(59194..59838) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727924.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(59855..60187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(60184..61794) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056191.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 61941..62774 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(62789..63208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 63402..64001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(64015..64665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(64755..66401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(66719..68251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 68241..68693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 68781..69362 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 69402..70082 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 70095..71408 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(71405..71956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 72048..73322 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 73319..73828 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene purE CDS 73832..75025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 75036..75704 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(75712..76419) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(76431..77969) product phosphotransferase Lcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene lcp1 CDS 78088..78933 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene rfbD CDS 78968..79870 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 79867..80946 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 81011..81787 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(81858..83138) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014103.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 83324..84040 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 84158..85345 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089160.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 85451..86377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(86382..87593) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(87617..88426) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(88430..89608) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene pcaD CDS complement(89605..90936) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene pcaB CDS complement(90950..91591) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene pcaG CDS complement(91584..92306) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene pcaH CDS 92475..93236 product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 93233..93877 product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(93942..94499) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(94496..95863) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727937.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(95860..96855) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111920.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene cofD CDS 97153..97566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(97598..98368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 98265..98600 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417073.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 98785..100179 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 100240..101382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 101382..102620 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene manA CDS 102687..103607 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 103686..105212 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 105317..106546 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 106713..106895 product rubredoxin RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417044.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene rubB CDS 106919..107527 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296677.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 107649..109097 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080862.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene ahcY CDS 109172..109822 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111910.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 109906..110583 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene mtrA CDS 110619..112490 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877234.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene mtrB CDS 112535..114289 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene lpqB CDS 114331..114996 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 115236..115946 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene raiA CDS 116102..118897 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene secA CDS complement(118913..119248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 119636..120043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 120043..121485 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 121543..122055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080948.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 122171..123286 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080950.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 123393..124652 product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene desA3 CDS 124723..125967 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080953.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(125992..127032) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene rsgA CDS complement(126981..128291) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene aroA CDS 128376..129128 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098388.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(129115..130131) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(130207..130701) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene ybaK CDS 130886..131527 product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416897.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene sigH CDS 131524..131799 product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene rsrA CDS 132081..132272 product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 132301..133818 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728009.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(133888..134142) product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene whiB1 CDS complement(134418..135386) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080966.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 135432..135857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056347.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(135865..136377) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(136374..136988) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728016.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 137044..137838 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(137842..139059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080978.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(139109..140692) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094277.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 141054..141734 product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 141866..142099 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(142170..142841) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 143137..144120 product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 144134..144889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 144928..146106 product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416855.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene moeZ CDS 146268..147053 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 147153..147419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(147433..148122) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086031.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 148245..149480 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 149798..150136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 sequence67 source 1..150128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(303..2072) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 2247..3623 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(3625..4434) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4437..6407) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728575.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene dxs CDS 6478..8301 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087566.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene glsA CDS 8403..9383 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 9380..10210 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(10282..11832) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(11892..12374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(12568..13833) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728572.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(13841..15853) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 16062..16727 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102352.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 16783..17469 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894154.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(17416..18102) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(18169..18546) product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 18715..19440 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413927.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(19437..20270) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894150.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(20275..20769) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene dut CDS 20764..21300 product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057247.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(21347..21649) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 22142..22825 product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene cei CDS complement(22848..23723) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093703.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 23833..24600 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 24724..26100 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728563.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(26107..27330) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(27352..27834) product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(27945..28244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(28403..30118) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089243049.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 30364..31467 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(31440..31667) product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057213.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 31753..32109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 32136..33614 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 33778..34746 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(34837..37542) product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(37535..38809) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 38933..39619 product iron-dependent transcriptional regulator IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413962.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene ideR CDS 39659..40654 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene galE CDS complement(40634..41716) product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(41923..42639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 42783..43760 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 43861..44898 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 44933..47452 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 47471..48106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(48202..48627) product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 48690..49460 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(49471..50253) product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260111.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(50309..51244) product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112364.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 51390..51977 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 51980..52510 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730168.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 52590..53267 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(53323..53901) product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(54252..54938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 54969..55229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(55171..56409) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(56406..57017) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650958.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 57175..61083 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene hrpA CDS complement(61093..61581) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene nrdR CDS 62221..62946 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076527.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene lexA CDS complement(63011..64156) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(64280..65599) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 65916..67247 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 67299..67736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(67745..68674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224263.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(68877..70352) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene hflX CDS complement(70434..71312) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413987.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene dapF CDS complement(71332..72216) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(72213..73136) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene miaA CDS complement(73151..73900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728550.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 74072..75406 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296629.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(75479..76066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081855.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(76063..77592) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296630.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene miaB CDS 77788..78507 product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081846.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene gluA CDS 78517..79365 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 79376..80059 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057178.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 80056..80982 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090302.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(81067..81708) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene recX CDS complement(81775..82812) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene recA CDS complement(82948..83787) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222318.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(83798..83992) product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(84019..85074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090308.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(85270..85782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(86001..87509) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(87540..88163) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089008.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 88184..89812 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296700.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(89813..91033) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 91117..92010 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(92066..92791) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(92833..93006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 93246..93857 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 93868..94548 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 94545..95150 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(95235..96053) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057162.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene pspA CDS complement(96224..96592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(96666..97154) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(97151..97765) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093751.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene pgsA CDS 97955..98443 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894076.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 98475..98759 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803874.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(98756..99757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(99965..102733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(102805..103428) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(103536..105503) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(105500..106408) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048369.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene dapA CDS complement(106476..107228) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene thyX CDS 107316..108074 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898940.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 108134..108622 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 108699..109133 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 109142..109795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 109927..111447 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728978.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 111472..111813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(111879..112334) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(112348..112815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(112812..113576) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene dapB CDS complement(113636..114511) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079765.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(114568..115908) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510573.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(116022..118277) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081771.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(118557..118826) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene rpsO CDS complement(118957..119784) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 120015..120782 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene mntR CDS 120785..121198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(121202..122155) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene truB CDS complement(122177..122848) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(122845..123768) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(123773..125137) product MATE family efflux transporter Mmp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728487.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene mmp CDS complement(125139..126140) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(126161..126619) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076703.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene rbfA CDS complement(126681..126971) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(127086..130004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 130261..130503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(130530..131531) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894006.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene nusA CDS complement(131528..132103) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene rimP CDS 132353..132850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081718.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 132847..133293 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728479.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 133369..133857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(133951..135498) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene nuoN CDS complement(135495..137072) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086541.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(137072..138967) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene nuoL CDS complement(138986..139285) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene nuoK CDS complement(139282..140106) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(140107..140610) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416447.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene nuoI CDS complement(140603..141781) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene nuoH CDS complement(141778..144219) product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(144216..146246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(146243..147439) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene nuoD CDS complement(147547..148287) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(148284..148859) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(148894..149265) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061193.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(149445..149915) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820