>Feature sequence01 2082 1804 gene locus_tag LOCUS_00010 2082 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2786 2109 gene locus_tag LOCUS_00020 gene nth 2786 2109 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_00020 5613 2863 gene locus_tag LOCUS_00030 5613 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6320 5679 gene locus_tag LOCUS_00040 6320 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7808 6351 gene locus_tag LOCUS_00050 7808 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9482 7992 gene locus_tag LOCUS_00060 9482 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10350 9664 gene locus_tag LOCUS_00070 10350 9664 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_00070 11053 10451 gene locus_tag LOCUS_00080 gene leuD 11053 10451 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_00080 12558 11134 gene locus_tag LOCUS_00090 gene leuC 12558 11134 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_00090 13399 12848 gene locus_tag LOCUS_00100 gene lepB 13399 12848 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_00100 13598 14518 gene locus_tag LOCUS_00110 13598 14518 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_00110 15330 14515 gene locus_tag LOCUS_00120 15330 14515 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181838.1 protein_id gnl|my_center|LOCUS_00120 15882 16985 gene locus_tag LOCUS_00130 gene proB 15882 16985 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922103.1 protein_id gnl|my_center|LOCUS_00130 17032 18279 gene locus_tag LOCUS_00140 17032 18279 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_00140 18382 19242 gene locus_tag LOCUS_00150 gene proI 18382 19242 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027273.1 protein_id gnl|my_center|LOCUS_00150 19817 19425 gene locus_tag LOCUS_00160 gene gcvH 19817 19425 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_00160 20068 20265 gene locus_tag LOCUS_00170 20068 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20407 21528 gene locus_tag LOCUS_00180 gene gcvT 20407 21528 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_00180 21530 22882 gene locus_tag LOCUS_00190 gene gcvPA 21530 22882 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 protein_id gnl|my_center|LOCUS_00190 22879 24357 gene locus_tag LOCUS_00200 gene gcvPB 22879 24357 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_00200 25596 24475 gene locus_tag LOCUS_00210 25596 24475 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_00210 26410 25811 gene locus_tag LOCUS_00220 26410 25811 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158950.1 protein_id gnl|my_center|LOCUS_00220 27315 26599 gene locus_tag LOCUS_00230 gene dnaD 27315 26599 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 protein_id gnl|my_center|LOCUS_00230 28632 27337 gene locus_tag LOCUS_00240 gene asnS 28632 27337 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_00240 29874 28669 gene locus_tag LOCUS_00250 29874 28669 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_00250 30743 29871 gene locus_tag LOCUS_00260 30743 29871 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00260 32384 30882 gene locus_tag LOCUS_00270 32384 30882 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812900.1 protein_id gnl|my_center|LOCUS_00270 32910 32377 gene locus_tag LOCUS_00280 32910 32377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33772 33287 gene locus_tag LOCUS_00290 33772 33287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35122 33824 gene locus_tag LOCUS_00300 35122 33824 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_00300 35759 35112 gene locus_tag LOCUS_00310 35759 35112 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_00310 38650 35762 gene locus_tag LOCUS_00320 gene dinG 38650 35762 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 protein_id gnl|my_center|LOCUS_00320 39469 38840 gene locus_tag LOCUS_00330 39469 38840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40054 39671 gene locus_tag LOCUS_00340 gene panD 40054 39671 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_00340 40949 40047 gene locus_tag LOCUS_00350 gene panC 40949 40047 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458948.1 protein_id gnl|my_center|LOCUS_00350 41869 40946 gene locus_tag LOCUS_00360 gene panB 41869 40946 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212979991.1 protein_id gnl|my_center|LOCUS_00360 43243 42206 gene locus_tag LOCUS_00370 43243 42206 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_00370 44582 43233 gene locus_tag LOCUS_00380 44582 43233 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_00380 45801 44647 gene locus_tag LOCUS_00390 gene bshA 45801 44647 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768296.1 protein_id gnl|my_center|LOCUS_00390 46559 45864 gene locus_tag LOCUS_00400 gene bshB1 46559 45864 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 protein_id gnl|my_center|LOCUS_00400 46978 46556 gene locus_tag LOCUS_00410 gene mgsA 46978 46556 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_00410 47799 46996 gene locus_tag LOCUS_00420 gene dapB 47799 46996 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 protein_id gnl|my_center|LOCUS_00420 48352 47819 gene locus_tag LOCUS_00430 48352 47819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48737 48405 gene locus_tag LOCUS_00440 48737 48405 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 protein_id gnl|my_center|LOCUS_00440 48841 49752 gene locus_tag LOCUS_00450 48841 49752 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723019.1 protein_id gnl|my_center|LOCUS_00450 50704 49811 gene locus_tag LOCUS_00460 50704 49811 CDS product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133225906.1 protein_id gnl|my_center|LOCUS_00460 51390 50761 gene locus_tag LOCUS_00470 51390 50761 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 protein_id gnl|my_center|LOCUS_00470 51726 51544 gene locus_tag LOCUS_00480 51726 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52945 51806 gene locus_tag LOCUS_00490 52945 51806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53722 53123 gene locus_tag LOCUS_00500 53722 53123 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003289268.1 protein_id gnl|my_center|LOCUS_00500 54417 53821 gene locus_tag LOCUS_00510 54417 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55007 54414 gene locus_tag LOCUS_00520 55007 54414 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_00520 56756 55662 gene locus_tag LOCUS_00530 gene tyrA 56756 55662 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_00530 58056 56932 gene locus_tag LOCUS_00540 gene hisC 58056 56932 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_00540 58875 58057 gene locus_tag LOCUS_00550 gene trpA 58875 58057 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 protein_id gnl|my_center|LOCUS_00550 60101 58872 gene locus_tag LOCUS_00560 gene trpB 60101 58872 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 protein_id gnl|my_center|LOCUS_00560 60888 60085 gene locus_tag LOCUS_00570 60888 60085 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460913.1 protein_id gnl|my_center|LOCUS_00570 61700 60888 gene locus_tag LOCUS_00580 gene trpC 61700 60888 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 protein_id gnl|my_center|LOCUS_00580 62730 61690 gene locus_tag LOCUS_00590 gene trpD 62730 61690 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_00590 64326 62743 gene locus_tag LOCUS_00600 gene trpE 64326 62743 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_00600 65109 64744 gene locus_tag LOCUS_00610 gene aroH 65109 64744 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_00610 66205 65102 gene locus_tag LOCUS_00620 gene aroB 66205 65102 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_00620 67374 66205 gene locus_tag LOCUS_00630 gene aroC 67374 66205 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_00630 68400 67591 gene locus_tag LOCUS_00640 gene cheR 68400 67591 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_00640 68852 68409 gene locus_tag LOCUS_00650 gene ndk 68852 68409 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 protein_id gnl|my_center|LOCUS_00650 69920 68952 gene locus_tag LOCUS_00660 gene hepT 69920 68952 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_00660 70789 69923 gene locus_tag LOCUS_00670 70789 69923 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393345.1 protein_id gnl|my_center|LOCUS_00670 71393 70770 gene locus_tag LOCUS_00680 71393 70770 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_00680 72265 71390 gene locus_tag LOCUS_00690 gene ubiA 72265 71390 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_00690 72980 72258 gene locus_tag LOCUS_00700 gene menG 72980 72258 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187667.1 protein_id gnl|my_center|LOCUS_00700 73866 72991 gene locus_tag LOCUS_00710 73866 72991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74536 73982 gene locus_tag LOCUS_00720 74536 73982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74908 74633 gene locus_tag LOCUS_00730 gene mtrB 74908 74633 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_00730 75305 75033 gene locus_tag LOCUS_00740 gene hbs 75305 75033 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_00740 77066 75582 gene locus_tag LOCUS_00750 gene spoIVA 77066 75582 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_00750 77845 77495 gene locus_tag LOCUS_00760 77845 77495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 78517 77858 gene locus_tag LOCUS_00770 78517 77858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 78941 78666 gene locus_tag LOCUS_00780 78941 78666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 80087 79050 gene locus_tag LOCUS_00790 gene gpsA 80087 79050 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_00790 80703 80089 gene locus_tag LOCUS_00800 gene plsY 80703 80089 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_00800 82041 80716 gene locus_tag LOCUS_00810 gene der 82041 80716 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_00810 83494 82244 gene locus_tag LOCUS_00820 gene rpsA 83494 82244 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229552.1 protein_id gnl|my_center|LOCUS_00820 84228 83647 gene locus_tag LOCUS_00830 84228 83647 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_00830 84935 84225 gene locus_tag LOCUS_00840 gene cmk 84935 84225 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_00840 85261 85031 gene locus_tag LOCUS_00850 85261 85031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 86002 85349 gene locus_tag LOCUS_00860 86002 85349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 87524 86160 gene locus_tag LOCUS_00870 gene ypeB 87524 86160 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 protein_id gnl|my_center|LOCUS_00870 87758 87609 gene locus_tag LOCUS_00880 87758 87609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 88528 87833 gene locus_tag LOCUS_00890 gene prsW 88528 87833 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_00890 89245 88628 gene locus_tag LOCUS_00900 89245 88628 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 protein_id gnl|my_center|LOCUS_00900 89766 89431 gene locus_tag LOCUS_00910 89766 89431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 90336 89887 gene locus_tag LOCUS_00920 90336 89887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 90923 90333 gene locus_tag LOCUS_00930 90923 90333 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 protein_id gnl|my_center|LOCUS_00930 91646 93235 gene locus_tag LOCUS_00940 gene serA 91646 93235 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00940 93411 93707 gene locus_tag LOCUS_00950 93411 93707 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 protein_id gnl|my_center|LOCUS_00950 93700 96261 gene locus_tag LOCUS_00960 93700 96261 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_00960 97878 96415 gene locus_tag LOCUS_00970 97878 96415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 98595 97879 gene locus_tag LOCUS_00980 gene resD 98595 97879 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 protein_id gnl|my_center|LOCUS_00980 99544 98801 gene locus_tag LOCUS_00990 gene rluB 99544 98801 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_00990 100127 99639 gene locus_tag LOCUS_01000 gene spmB 100127 99639 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 protein_id gnl|my_center|LOCUS_01000 100816 100166 gene locus_tag LOCUS_01010 gene spmA 100816 100166 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_01010 101961 100870 gene locus_tag LOCUS_01020 gene dacB 101961 100870 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_01020 102617 102162 gene locus_tag LOCUS_01030 gene ytfJ 102617 102162 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_01030 103282 102590 gene locus_tag LOCUS_01040 103282 102590 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 protein_id gnl|my_center|LOCUS_01040 104027 103422 gene locus_tag LOCUS_01050 gene scpB 104027 103422 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 protein_id gnl|my_center|LOCUS_01050 104790 103996 gene locus_tag LOCUS_01060 gene scpA 104790 103996 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_01060 105329 104862 gene locus_tag LOCUS_01070 gene ribH 105329 104862 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_01070 106622 105363 gene locus_tag LOCUS_01080 gene ribBA 106622 105363 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 protein_id gnl|my_center|LOCUS_01080 107314 106646 gene locus_tag LOCUS_01090 gene ribE 107314 106646 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_01090 108444 107317 gene locus_tag LOCUS_01100 gene ribD 108444 107317 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741110.1 protein_id gnl|my_center|LOCUS_01100 109533 109102 gene locus_tag LOCUS_01110 109533 109102 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_01110 111003 109669 gene locus_tag LOCUS_01120 gene lysA 111003 109669 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_01120 112785 111118 gene locus_tag LOCUS_01130 112785 111118 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_01130 113312 112881 gene locus_tag LOCUS_01140 gene spoVAB 113312 112881 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 protein_id gnl|my_center|LOCUS_01140 113971 113312 gene locus_tag LOCUS_01150 gene spoVAA 113971 113312 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_01150 114921 114166 gene locus_tag LOCUS_01160 gene sigF 114921 114166 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_01160 115383 114931 gene locus_tag LOCUS_01170 gene spoIIAB 115383 114931 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_01170 115733 115380 gene locus_tag LOCUS_01180 gene spoIIAA 115733 115380 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 protein_id gnl|my_center|LOCUS_01180 117012 115825 gene locus_tag LOCUS_01190 gene dacF 117012 115825 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_01190 118013 117189 gene locus_tag LOCUS_01200 118013 117189 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_01200 119237 118044 gene locus_tag LOCUS_01210 gene deoB 119237 118044 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_01210 120261 119347 gene locus_tag LOCUS_01220 gene xerD 120261 119347 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_01220 120525 120292 gene locus_tag LOCUS_01230 120525 120292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 121264 120788 gene locus_tag LOCUS_01240 gene fur 121264 120788 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 protein_id gnl|my_center|LOCUS_01240 122005 121376 gene locus_tag LOCUS_01250 gene spoIIM 122005 121376 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 protein_id gnl|my_center|LOCUS_01250 123273 122083 gene locus_tag LOCUS_01260 123273 122083 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_01260 123836 123273 gene locus_tag LOCUS_01270 123836 123273 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 protein_id gnl|my_center|LOCUS_01270 123942 124094 gene locus_tag LOCUS_01280 123942 124094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 125328 124195 gene locus_tag LOCUS_01290 125328 124195 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_01290 125380 125523 gene locus_tag LOCUS_01300 125380 125523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 127097 125676 gene locus_tag LOCUS_01310 127097 125676 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257660.1 protein_id gnl|my_center|LOCUS_01310 128247 127261 gene locus_tag LOCUS_01320 gene bfmBAB 128247 127261 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_01320 129273 128251 gene locus_tag LOCUS_01330 gene bfmBAA 129273 128251 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_01330 130829 129405 gene locus_tag LOCUS_01340 gene lpdA 130829 129405 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_01340 131090 130851 gene locus_tag LOCUS_01350 131090 130851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 131306 131461 gene locus_tag LOCUS_01360 131306 131461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 132062 131556 gene locus_tag LOCUS_01370 132062 131556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 133105 132293 gene locus_tag LOCUS_01380 gene spo0A 133105 132293 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_01380 134544 133312 gene locus_tag LOCUS_01390 gene spoIVB 134544 133312 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_01390 136475 134733 gene locus_tag LOCUS_01400 gene recN 136475 134733 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_01400 136953 136504 gene locus_tag LOCUS_01410 gene argR 136953 136504 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032581.1 protein_id gnl|my_center|LOCUS_01410 137444 136980 gene locus_tag LOCUS_01420 137444 136980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 138446 137592 gene locus_tag LOCUS_01430 138446 137592 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 protein_id gnl|my_center|LOCUS_01430 140400 138493 gene locus_tag LOCUS_01440 gene dxs 140400 138493 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_01440 141478 140576 gene locus_tag LOCUS_01450 141478 140576 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_01450 141735 141475 gene locus_tag LOCUS_01460 141735 141475 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_01460 143086 141701 gene locus_tag LOCUS_01470 gene xseA 143086 141701 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_01470 143991 143134 gene locus_tag LOCUS_01480 gene folD 143991 143134 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_01480 144526 144080 gene locus_tag LOCUS_01490 gene nusB 144526 144080 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_01490 144897 144664 gene locus_tag LOCUS_01500 144897 144664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 145452 144913 gene locus_tag LOCUS_01510 145452 144913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 145929 145519 gene locus_tag LOCUS_01520 145929 145519 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_01520 147388 146045 gene locus_tag LOCUS_01530 gene accC 147388 146045 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592876.1 protein_id gnl|my_center|LOCUS_01530 147901 147425 gene locus_tag LOCUS_01540 gene accB 147901 147425 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 protein_id gnl|my_center|LOCUS_01540 148983 148171 gene locus_tag LOCUS_01550 148983 148171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 149674 149036 gene locus_tag LOCUS_01560 gene spoIIIAG 149674 149036 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_01560 150568 149693 gene locus_tag LOCUS_01570 150568 149693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 151793 150591 gene locus_tag LOCUS_01580 gene spoIIIAE 151793 150591 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_01580 152198 151809 gene locus_tag LOCUS_01590 gene spoIIIAD 152198 151809 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_01590 152412 152209 gene locus_tag LOCUS_01600 gene spoIIIAC 152412 152209 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020914.1 protein_id gnl|my_center|LOCUS_01600 152984 152466 gene locus_tag LOCUS_01610 152984 152466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 153997 153035 gene locus_tag LOCUS_01620 gene spoIIIAA 153997 153035 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_01620 154380 154114 gene locus_tag LOCUS_01630 154380 154114 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391665.1 protein_id gnl|my_center|LOCUS_01630 155870 154617 gene locus_tag LOCUS_01640 155870 154617 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_01640 156647 156090 gene locus_tag LOCUS_01650 gene efp 156647 156090 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_01650 157805 156732 gene locus_tag LOCUS_01660 gene pepQ 157805 156732 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_01660 158260 157808 gene locus_tag LOCUS_01670 gene aroQ 158260 157808 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142437.1 protein_id gnl|my_center|LOCUS_01670 158858 158343 gene locus_tag LOCUS_01680 158858 158343 CDS product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 protein_id gnl|my_center|LOCUS_01680 159075 160070 gene locus_tag LOCUS_01690 159075 160070 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807112.1 protein_id gnl|my_center|LOCUS_01690 160076 160405 gene locus_tag LOCUS_01700 160076 160405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 161385 160414 gene locus_tag LOCUS_01710 161385 160414 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686827.1 protein_id gnl|my_center|LOCUS_01710 163128 161509 gene locus_tag LOCUS_01720 163128 161509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 163678 163253 gene locus_tag LOCUS_01730 gene mntR 163678 163253 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 protein_id gnl|my_center|LOCUS_01730 163907 164977 gene locus_tag LOCUS_01740 gene splB 163907 164977 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 protein_id gnl|my_center|LOCUS_01740 165764 165003 gene locus_tag LOCUS_01750 gene ccdA 165764 165003 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152676.1 protein_id gnl|my_center|LOCUS_01750 167052 165982 gene locus_tag LOCUS_01760 167052 165982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 169328 167301 gene locus_tag LOCUS_01770 gene metG 169328 167301 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 protein_id gnl|my_center|LOCUS_01770 170025 169717 gene locus_tag LOCUS_01780 170025 169717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 170462 170022 gene locus_tag LOCUS_01790 gene zur 170462 170022 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 protein_id gnl|my_center|LOCUS_01790 172577 170721 gene locus_tag LOCUS_01800 172577 170721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 172621 172962 gene locus_tag LOCUS_01810 172621 172962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 175144 173480 gene locus_tag LOCUS_01820 gene nagZ 175144 173480 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_01820 176848 175151 gene locus_tag LOCUS_01830 176848 175151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 178652 176820 gene locus_tag LOCUS_01840 178652 176820 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_01840 179508 178678 gene locus_tag LOCUS_01850 179508 178678 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_01850 180392 179508 gene locus_tag LOCUS_01860 180392 179508 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776905.1 protein_id gnl|my_center|LOCUS_01860 181908 180502 gene locus_tag LOCUS_01870 181908 180502 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_01870 182859 182098 gene locus_tag LOCUS_01880 gene pflA 182859 182098 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446860.1 protein_id gnl|my_center|LOCUS_01880 185194 182933 gene locus_tag LOCUS_01890 gene pflB 185194 182933 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_01890 188116 185501 gene locus_tag LOCUS_01900 gene adhE 188116 185501 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260481.1 protein_id gnl|my_center|LOCUS_01900 188618 189334 gene locus_tag LOCUS_01910 gene fnr 188618 189334 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 protein_id gnl|my_center|LOCUS_01910 191934 189445 gene locus_tag LOCUS_01920 191934 189445 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_01920 192072 192950 gene locus_tag LOCUS_01930 gene chbR 192072 192950 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097020.1 protein_id gnl|my_center|LOCUS_01930 193392 193075 gene locus_tag LOCUS_01940 193392 193075 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_01940 194548 193580 gene locus_tag LOCUS_01950 194548 193580 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_01950 195679 194597 gene locus_tag LOCUS_01960 195679 194597 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_01960 196442 195672 gene locus_tag LOCUS_01970 196442 195672 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_01970 197552 196461 gene locus_tag LOCUS_01980 197552 196461 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_01980 197734 198552 gene locus_tag LOCUS_01990 gene araC 197734 198552 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210586.1 protein_id gnl|my_center|LOCUS_01990 199343 198639 gene locus_tag LOCUS_02000 199343 198639 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_02000 199801 200415 gene locus_tag LOCUS_02010 199801 200415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 200549 201517 gene locus_tag LOCUS_02020 gene msrB 200549 201517 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_02020 201651 201833 gene locus_tag LOCUS_02030 201651 201833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721789.1 protein_id gnl|my_center|LOCUS_02030 202149 203216 gene locus_tag LOCUS_02040 gene ccpA 202149 203216 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_02040 204196 203345 gene locus_tag LOCUS_02050 204196 203345 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_02050 204973 204305 gene locus_tag LOCUS_02060 204973 204305 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244510.1 protein_id gnl|my_center|LOCUS_02060 207527 205338 gene locus_tag LOCUS_02070 207527 205338 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_02070 209661 207760 gene locus_tag LOCUS_02080 209661 207760 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_02080 211321 209678 gene locus_tag LOCUS_02090 211321 209678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 213476 211353 gene locus_tag LOCUS_02100 213476 211353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 214335 213508 gene locus_tag LOCUS_02110 214335 213508 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_02110 215218 214328 gene locus_tag LOCUS_02120 215218 214328 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_02120 217267 215459 gene locus_tag LOCUS_02130 217267 215459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 218866 217286 gene locus_tag LOCUS_02140 218866 217286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 220432 219017 gene locus_tag LOCUS_02150 220432 219017 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_02150 221768 220812 gene locus_tag LOCUS_02160 221768 220812 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139264482.1 protein_id gnl|my_center|LOCUS_02160 223042 221912 gene locus_tag LOCUS_02170 gene ald 223042 221912 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219410.1 protein_id gnl|my_center|LOCUS_02170 223785 223312 gene locus_tag LOCUS_02180 223785 223312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 225041 223782 gene locus_tag LOCUS_02190 225041 223782 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 protein_id gnl|my_center|LOCUS_02190 226447 225701 gene locus_tag LOCUS_02200 226447 225701 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628423.1 protein_id gnl|my_center|LOCUS_02200 226932 226645 gene locus_tag LOCUS_02210 226932 226645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 229099 227054 gene locus_tag LOCUS_02220 gene recG 229099 227054 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000816.1 protein_id gnl|my_center|LOCUS_02220 229978 229103 gene locus_tag LOCUS_02230 229978 229103 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844766.1 protein_id gnl|my_center|LOCUS_02230 231815 230010 gene locus_tag LOCUS_02240 231815 230010 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_02240 232258 232446 gene locus_tag LOCUS_02250 gene rpmB 232258 232446 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830107.1 protein_id gnl|my_center|LOCUS_02250 233506 232838 gene locus_tag LOCUS_02260 gene rpe 233506 232838 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_02260 234406 233510 gene locus_tag LOCUS_02270 gene rsgA 234406 233510 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_02270 236644 234452 gene locus_tag LOCUS_02280 gene prkC 236644 234452 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_02280 237426 236641 gene locus_tag LOCUS_02290 237426 236641 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_02290 238469 237423 gene locus_tag LOCUS_02300 gene rlmN 238469 237423 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_02300 240089 238614 gene locus_tag LOCUS_02310 gene rsmB 240089 238614 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_02310 241018 240086 gene locus_tag LOCUS_02320 gene fmt 241018 240086 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_02320 241511 241035 gene locus_tag LOCUS_02330 gene def 241511 241035 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_02330 244189 241610 gene locus_tag LOCUS_02340 gene priA 244189 241610 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_02340 245421 244189 gene locus_tag LOCUS_02350 gene coaBC 245421 244189 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_02350 245885 245658 gene locus_tag LOCUS_02360 245885 245658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 246496 245924 gene locus_tag LOCUS_02370 gene gmk 246496 245924 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_02370 246770 246510 gene locus_tag LOCUS_02380 246770 246510 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_02380 247705 246812 gene locus_tag LOCUS_02390 247705 246812 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_02390 249636 247741 gene locus_tag LOCUS_02400 249636 247741 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_02400 250699 249812 gene locus_tag LOCUS_02410 gene dapF 250699 249812 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_02410 253562 250761 gene locus_tag LOCUS_02420 253562 250761 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_02420 253737 255494 gene locus_tag LOCUS_02430 253737 255494 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_02430 257311 255578 gene locus_tag LOCUS_02440 257311 255578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 258159 257314 gene locus_tag LOCUS_02450 258159 257314 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_02450 259070 258156 gene locus_tag LOCUS_02460 259070 258156 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_02460 259680 259168 gene locus_tag LOCUS_02470 259680 259168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 260047 259784 gene locus_tag LOCUS_02480 260047 259784 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262674.1 protein_id gnl|my_center|LOCUS_02480 260527 260090 gene locus_tag LOCUS_02490 260527 260090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 262869 260632 gene locus_tag LOCUS_02500 262869 260632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 264636 262870 gene locus_tag LOCUS_02510 264636 262870 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_02510 266106 264919 gene locus_tag LOCUS_02520 gene sndC 266106 264919 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_02520 266388 266606 gene locus_tag LOCUS_02530 266388 266606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 266603 267889 gene locus_tag LOCUS_02540 gene spoVE 266603 267889 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_02540 268366 268004 gene locus_tag LOCUS_02550 268366 268004 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_02550 268590 269660 gene locus_tag LOCUS_02560 gene cax 268590 269660 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_02560 270073 269762 gene locus_tag LOCUS_02570 270073 269762 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135694.1 protein_id gnl|my_center|LOCUS_02570 270505 270260 gene locus_tag LOCUS_02580 270505 270260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 271713 270598 gene locus_tag LOCUS_02590 271713 270598 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_02590 272692 271856 gene locus_tag LOCUS_02600 272692 271856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 274805 272790 gene locus_tag LOCUS_02610 274805 272790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 275250 275849 gene locus_tag LOCUS_02620 gene rpsD 275250 275849 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_02620 277177 275924 gene locus_tag LOCUS_02630 gene tyrS 277177 275924 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_02630 277652 280753 gene locus_tag LOCUS_02640 277652 280753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 282586 280856 gene locus_tag LOCUS_02650 gene acsA 282586 280856 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_02650 282846 283508 gene locus_tag LOCUS_02660 gene acuA 282846 283508 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_02660 285517 283577 gene locus_tag LOCUS_02670 285517 283577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 288300 286975 gene locus_tag LOCUS_02680 288300 286975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 289276 288575 gene locus_tag LOCUS_02690 289276 288575 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421518.1 protein_id gnl|my_center|LOCUS_02690 290386 289382 gene locus_tag LOCUS_02700 gene ccpA 290386 289382 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_02700 290839 290495 gene locus_tag LOCUS_02710 gene ytxJ 290839 290495 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_02710 291444 291013 gene locus_tag LOCUS_02720 291444 291013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 293498 291771 gene locus_tag LOCUS_02730 gene ptsP 293498 291771 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_02730 294138 293701 gene locus_tag LOCUS_02740 294138 293701 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 protein_id gnl|my_center|LOCUS_02740 295496 294198 gene locus_tag LOCUS_02750 gene aroA 295496 294198 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_02750 296037 295525 gene locus_tag LOCUS_02760 296037 295525 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_02760 297585 296179 gene locus_tag LOCUS_02770 gene gndA 297585 296179 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_02770 298374 297775 gene locus_tag LOCUS_02780 298374 297775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 298651 299274 gene locus_tag LOCUS_02790 298651 299274 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_02790 300763 299420 gene locus_tag LOCUS_02800 300763 299420 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 protein_id gnl|my_center|LOCUS_02800 300969 302444 gene locus_tag LOCUS_02810 gene speA 300969 302444 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084882.1 protein_id gnl|my_center|LOCUS_02810 302836 302525 gene locus_tag LOCUS_02820 302836 302525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 303505 302948 gene locus_tag LOCUS_02830 303505 302948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 305682 303622 gene locus_tag LOCUS_02840 305682 303622 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_02840 306389 306153 gene locus_tag LOCUS_02850 306389 306153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 306912 306469 gene locus_tag LOCUS_02860 306912 306469 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_02860 307296 307003 gene locus_tag LOCUS_02870 307296 307003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 307683 307555 gene locus_tag LOCUS_02880 307683 307555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 308441 308289 gene locus_tag LOCUS_02890 308441 308289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 308643 308572 gene locus_tag LOCUS_t00010 308643 308572 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 309409 308735 gene locus_tag LOCUS_02900 309409 308735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 310137 309709 gene locus_tag LOCUS_02910 310137 309709 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 protein_id gnl|my_center|LOCUS_02910 310325 310594 gene locus_tag LOCUS_02920 310325 310594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 310687 311034 gene locus_tag LOCUS_02930 310687 311034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 311529 311062 gene locus_tag LOCUS_02940 311529 311062 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100074.1 protein_id gnl|my_center|LOCUS_02940 311891 312424 gene locus_tag LOCUS_02950 311891 312424 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_02950 313190 312612 gene locus_tag LOCUS_02960 313190 312612 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 protein_id gnl|my_center|LOCUS_02960 314301 313273 gene locus_tag LOCUS_02970 314301 313273 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_02970 314408 315352 gene locus_tag LOCUS_02980 gene manA 314408 315352 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989899.1 protein_id gnl|my_center|LOCUS_02980 315794 315579 gene locus_tag LOCUS_02990 315794 315579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 316735 315800 gene locus_tag LOCUS_03000 316735 315800 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_03000 319048 316907 gene locus_tag LOCUS_03010 319048 316907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 319603 319175 gene locus_tag LOCUS_03020 319603 319175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 320290 319628 gene locus_tag LOCUS_03030 320290 319628 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706565.1 protein_id gnl|my_center|LOCUS_03030 321042 320389 gene locus_tag LOCUS_03040 321042 320389 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_03040 321287 321832 gene locus_tag LOCUS_03050 321287 321832 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_03050 322009 321920 gene locus_tag LOCUS_t00020 322009 321920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 322544 322122 gene locus_tag LOCUS_03060 322544 322122 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282829.1 protein_id gnl|my_center|LOCUS_03060 322701 323498 gene locus_tag LOCUS_03070 gene pdaB 322701 323498 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_03070 323648 323833 gene locus_tag LOCUS_03080 323648 323833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 325806 323989 gene locus_tag LOCUS_03090 325806 323989 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254889.1 protein_id gnl|my_center|LOCUS_03090 326155 326316 gene locus_tag LOCUS_03100 326155 326316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 326948 326430 gene locus_tag LOCUS_03110 gene msrA 326948 326430 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291883.1 protein_id gnl|my_center|LOCUS_03110 327108 327446 gene locus_tag LOCUS_03120 327108 327446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 329012 327606 gene locus_tag LOCUS_03130 329012 327606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 329854 329171 gene locus_tag LOCUS_03140 329854 329171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_03140 330057 330773 gene locus_tag LOCUS_03150 330057 330773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 332287 330932 gene locus_tag LOCUS_03160 332287 330932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_03160 333101 332322 gene locus_tag LOCUS_03170 333101 332322 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_03170 334908 333076 gene locus_tag LOCUS_03180 gene yesM 334908 333076 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_03180 335842 334922 gene locus_tag LOCUS_03190 335842 334922 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948837.1 protein_id gnl|my_center|LOCUS_03190 335978 338155 gene locus_tag LOCUS_03200 335978 338155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 338700 338302 gene locus_tag LOCUS_03210 338700 338302 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089903.1 protein_id gnl|my_center|LOCUS_03210 338904 340178 gene locus_tag LOCUS_03220 gene kinB 338904 340178 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420390.1 protein_id gnl|my_center|LOCUS_03220 341115 340279 gene locus_tag LOCUS_03230 341115 340279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 342303 341380 gene locus_tag LOCUS_03240 gene mneP 342303 341380 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_03240 342508 342711 gene locus_tag LOCUS_03250 342508 342711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 344529 342832 gene locus_tag LOCUS_03260 344529 342832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 345184 344600 gene locus_tag LOCUS_03270 345184 344600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 345526 345453 gene locus_tag LOCUS_t00030 345526 345453 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 345611 345538 gene locus_tag LOCUS_t00040 345611 345538 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 345836 345672 gene locus_tag LOCUS_03280 345836 345672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 347510 345987 gene locus_tag LOCUS_03290 347510 345987 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_03290 348400 347507 gene locus_tag LOCUS_03300 348400 347507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_03300 351343 348404 gene locus_tag LOCUS_03310 351343 348404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 352461 351343 gene locus_tag LOCUS_03320 gene macA 352461 351343 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746478.1 protein_id gnl|my_center|LOCUS_03320 353053 352427 gene locus_tag LOCUS_03330 353053 352427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_03330 353740 353928 gene locus_tag LOCUS_03340 353740 353928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 354649 354008 gene locus_tag LOCUS_03350 gene pyrE 354649 354008 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_03350 355379 354642 gene locus_tag LOCUS_03360 gene pyrF 355379 354642 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03360 358747 355520 gene locus_tag LOCUS_03370 gene carB 358747 355520 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_03370 359888 358752 gene locus_tag LOCUS_03380 359888 358752 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_03380 361230 359935 gene locus_tag LOCUS_03390 gene pyrC 361230 359935 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_03390 362250 361336 gene locus_tag LOCUS_03400 362250 361336 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_03400 362798 362250 gene locus_tag LOCUS_03410 gene pyrR 362798 362250 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_03410 364318 363332 gene locus_tag LOCUS_03420 364318 363332 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_03420 364812 364315 gene locus_tag LOCUS_03430 gene lspA 364812 364315 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_03430 365017 365754 gene locus_tag LOCUS_03440 365017 365754 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957385.1 protein_id gnl|my_center|LOCUS_03440 366122 365751 gene locus_tag LOCUS_03450 366122 365751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 369372 366274 gene locus_tag LOCUS_03460 gene ileS 369372 366274 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754926.1 protein_id gnl|my_center|LOCUS_03460 370328 369813 gene locus_tag LOCUS_03470 gene divIVA 370328 369813 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_03470 371285 370497 gene locus_tag LOCUS_03480 371285 370497 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_03480 371556 371287 gene locus_tag LOCUS_03490 371556 371287 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_03490 372008 371559 gene locus_tag LOCUS_03500 gene sepF 372008 371559 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_03500 372677 372009 gene locus_tag LOCUS_03510 372677 372009 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_03510 373562 372711 gene locus_tag LOCUS_03520 gene pgeF 373562 372711 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_03520 374005 373661 gene locus_tag LOCUS_03530 374005 373661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 374910 374128 gene locus_tag LOCUS_03540 gene sigG 374910 374128 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_03540 375739 375017 gene locus_tag LOCUS_03550 gene sigE 375739 375017 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_03550 376786 375821 gene locus_tag LOCUS_03560 gene spoIIGA 376786 375821 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 protein_id gnl|my_center|LOCUS_03560 378243 377134 gene locus_tag LOCUS_03570 gene ftsZ 378243 377134 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_03570 379565 378303 gene locus_tag LOCUS_03580 gene ftsA 379565 378303 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 protein_id gnl|my_center|LOCUS_03580 380552 379815 gene locus_tag LOCUS_03590 380552 379815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 381892 380615 gene locus_tag LOCUS_03600 gene murA 381892 380615 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_03600 383533 382421 gene locus_tag LOCUS_03610 gene murG 383533 382421 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_03610 384635 383538 gene locus_tag LOCUS_03620 gene spoVE 384635 383538 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_03620 386112 384688 gene locus_tag LOCUS_03630 gene murD 386112 384688 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_03630 387084 386116 gene locus_tag LOCUS_03640 gene mraY 387084 386116 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_03640 388561 387101 gene locus_tag LOCUS_03650 388561 387101 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_03650 390048 388558 gene locus_tag LOCUS_03660 gene murE 390048 388558 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_03660 392124 390151 gene locus_tag LOCUS_03670 392124 390151 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_03670 394496 392253 gene locus_tag LOCUS_03680 394496 392253 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_03680 394967 394539 gene locus_tag LOCUS_03690 394967 394539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 395976 395014 gene locus_tag LOCUS_03700 gene rsmH 395976 395014 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_03700 396472 396035 gene locus_tag LOCUS_03710 gene mraZ 396472 396035 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_03710 397971 396706 gene locus_tag LOCUS_03720 397971 396706 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_03720 399618 397993 gene locus_tag LOCUS_03730 gene bshC 399618 397993 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 protein_id gnl|my_center|LOCUS_03730 400703 399768 gene locus_tag LOCUS_03740 400703 399768 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_03740 401695 400700 gene locus_tag LOCUS_03750 401695 400700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854337.1 protein_id gnl|my_center|LOCUS_03750 402657 401707 gene locus_tag LOCUS_03760 gene oppC 402657 401707 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 protein_id gnl|my_center|LOCUS_03760 403593 402661 gene locus_tag LOCUS_03770 gene oppB 403593 402661 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_03770 405475 403763 gene locus_tag LOCUS_03780 gene oppA 405475 403763 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_03780 406106 405723 gene locus_tag LOCUS_03790 406106 405723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 407083 406127 gene locus_tag LOCUS_03800 gene panE 407083 406127 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782397.1 protein_id gnl|my_center|LOCUS_03800 407873 407223 gene locus_tag LOCUS_03810 gene gerR 407873 407223 CDS product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 protein_id gnl|my_center|LOCUS_03810 408186 409262 gene locus_tag LOCUS_03820 408186 409262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 410608 409331 gene locus_tag LOCUS_03830 410608 409331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 412057 410720 gene locus_tag LOCUS_03840 412057 410720 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 protein_id gnl|my_center|LOCUS_03840 412184 412843 gene locus_tag LOCUS_03850 412184 412843 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 protein_id gnl|my_center|LOCUS_03850 413884 412913 gene locus_tag LOCUS_03860 413884 412913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 415986 414145 gene locus_tag LOCUS_03870 gene typA 415986 414145 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_03870 416612 416115 gene locus_tag LOCUS_03880 416612 416115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 417548 416889 gene locus_tag LOCUS_03890 417548 416889 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362617.1 protein_id gnl|my_center|LOCUS_03890 417699 418406 gene locus_tag LOCUS_03900 417699 418406 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_03900 419840 418554 gene locus_tag LOCUS_03910 gene thiI 419840 418554 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188892867.1 protein_id gnl|my_center|LOCUS_03910 420995 419847 gene locus_tag LOCUS_03920 420995 419847 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_03920 421951 421136 gene locus_tag LOCUS_03930 421951 421136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 422560 422135 gene locus_tag LOCUS_03940 422560 422135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 423461 422961 gene locus_tag LOCUS_03950 423461 422961 CDS product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064519.1 protein_id gnl|my_center|LOCUS_03950 423698 425674 gene locus_tag LOCUS_03960 423698 425674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 427425 426310 gene locus_tag LOCUS_03970 427425 426310 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036219.1 protein_id gnl|my_center|LOCUS_03970 428159 427401 gene locus_tag LOCUS_03980 428159 427401 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_03980 428980 428156 gene locus_tag LOCUS_03990 428980 428156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 430228 429098 gene locus_tag LOCUS_04000 gene rpoD 430228 429098 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_04000 432087 430273 gene locus_tag LOCUS_04010 gene dnaG 432087 430273 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_04010 432583 432128 gene locus_tag LOCUS_04020 432583 432128 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 protein_id gnl|my_center|LOCUS_04020 434698 432617 gene locus_tag LOCUS_04030 gene glyS 434698 432617 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_04030 435575 434691 gene locus_tag LOCUS_04040 gene glyQ 435575 434691 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_04040 436655 435909 gene locus_tag LOCUS_04050 gene recO 436655 435909 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487015.1 protein_id gnl|my_center|LOCUS_04050 436849 436709 gene locus_tag LOCUS_04060 436849 436709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 437845 436946 gene locus_tag LOCUS_04070 gene era 437845 436946 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_04070 438290 437877 gene locus_tag LOCUS_04080 438290 437877 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_04080 438713 438339 gene locus_tag LOCUS_04090 438713 438339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 439210 438713 gene locus_tag LOCUS_04100 gene ybeY 439210 438713 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_04100 441395 439182 gene locus_tag LOCUS_04110 gene pgpH 441395 439182 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_04110 442642 441674 gene locus_tag LOCUS_04120 442642 441674 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_04120 443830 442649 gene locus_tag LOCUS_04130 gene yqfD 443830 442649 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_04130 444120 443827 gene locus_tag LOCUS_04140 gene yqfC 444120 443827 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_04140 444792 444349 gene locus_tag LOCUS_04150 444792 444349 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 protein_id gnl|my_center|LOCUS_04150 444981 444808 gene locus_tag LOCUS_04160 444981 444808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 445697 445332 gene locus_tag LOCUS_04170 445697 445332 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131883.1 protein_id gnl|my_center|LOCUS_04170 449402 445992 gene locus_tag LOCUS_04180 gene sbcC 449402 445992 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 protein_id gnl|my_center|LOCUS_04180 450586 449399 gene locus_tag LOCUS_04190 450586 449399 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_04190 454813 450638 gene locus_tag LOCUS_04200 gene addA 454813 450638 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_04200 458406 454801 gene locus_tag LOCUS_04210 gene addB 458406 454801 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_04210 459982 458621 gene locus_tag LOCUS_04220 459982 458621 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_04220 460155 461132 gene locus_tag LOCUS_04230 460155 461132 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945015.1 protein_id gnl|my_center|LOCUS_04230 461572 461141 gene locus_tag LOCUS_04240 461572 461141 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228981.1 protein_id gnl|my_center|LOCUS_04240 463070 461727 gene locus_tag LOCUS_04250 gene mtaB 463070 461727 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_04250 463838 463074 gene locus_tag LOCUS_04260 463838 463074 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_04260 464643 463957 gene locus_tag LOCUS_04270 464643 463957 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_04270 465620 464646 gene locus_tag LOCUS_04280 gene prmA 465620 464646 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_04280 465932 465756 gene locus_tag LOCUS_04290 465932 465756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 466333 465989 gene locus_tag LOCUS_04300 466333 465989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272592.1 protein_id gnl|my_center|LOCUS_04300 466624 467061 gene locus_tag LOCUS_04310 466624 467061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 467065 467343 gene locus_tag LOCUS_04320 467065 467343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 468598 467474 gene locus_tag LOCUS_04330 gene dnaJ 468598 467474 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_04330 470571 468733 gene locus_tag LOCUS_04340 gene dnaK 470571 468733 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_04340 471581 470961 gene locus_tag LOCUS_04350 471581 470961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 472665 471637 gene locus_tag LOCUS_04360 gene hrcA 472665 471637 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_04360 473238 472771 gene locus_tag LOCUS_04370 473238 472771 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686683.1 protein_id gnl|my_center|LOCUS_04370 474702 473464 gene locus_tag LOCUS_04380 gene hemW 474702 473464 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_04380 476637 474820 gene locus_tag LOCUS_04390 gene lepA 476637 474820 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_04390 477324 476740 gene locus_tag LOCUS_04400 477324 476740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 478727 477342 gene locus_tag LOCUS_04410 478727 477342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 479952 478948 gene locus_tag LOCUS_04420 gene gpr 479952 478948 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_04420 480129 480401 gene locus_tag LOCUS_04430 gene rpsT 480129 480401 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_04430 481576 480557 gene locus_tag LOCUS_04440 gene holA 481576 480557 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_04440 483114 481843 gene locus_tag LOCUS_04450 483114 481843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 483686 483138 gene locus_tag LOCUS_04460 483686 483138 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_04460 486575 483861 gene locus_tag LOCUS_04470 486575 483861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 487331 486816 gene locus_tag LOCUS_04480 487331 486816 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393866.1 protein_id gnl|my_center|LOCUS_04480 488002 487352 gene locus_tag LOCUS_04490 488002 487352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 490697 488253 gene locus_tag LOCUS_04500 gene leuS 490697 488253 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_04500 492083 491202 gene locus_tag LOCUS_04510 492083 491202 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 protein_id gnl|my_center|LOCUS_04510 493237 492227 gene locus_tag LOCUS_04520 gene namA 493237 492227 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 protein_id gnl|my_center|LOCUS_04520 494255 493431 gene locus_tag LOCUS_04530 494255 493431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_04530 495259 494369 gene locus_tag LOCUS_04540 495259 494369 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281259.1 protein_id gnl|my_center|LOCUS_04540 495609 495262 gene locus_tag LOCUS_04550 gene rsfS 495609 495262 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_04550 496247 495636 gene locus_tag LOCUS_04560 gene yqeK 496247 495636 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_04560 496839 496231 gene locus_tag LOCUS_04570 496839 496231 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_04570 497156 496854 gene locus_tag LOCUS_04580 gene yhbY 497156 496854 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_04580 498067 497189 gene locus_tag LOCUS_04590 498067 497189 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_04590 499233 498097 gene locus_tag LOCUS_04600 gene yqeH 499233 498097 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575406.1 protein_id gnl|my_center|LOCUS_04600 499784 499230 gene locus_tag LOCUS_04610 499784 499230 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_04610 502418 500064 gene locus_tag LOCUS_04620 502418 500064 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631786.1 protein_id gnl|my_center|LOCUS_04620 503848 502415 gene locus_tag LOCUS_04630 503848 502415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 504811 503855 gene locus_tag LOCUS_04640 504811 503855 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_04640 505449 505099 gene locus_tag LOCUS_04650 gene spoVAE 505449 505099 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_04650 506470 505451 gene locus_tag LOCUS_04660 gene spoVAD 506470 505451 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938965.1 protein_id gnl|my_center|LOCUS_04660 506973 506470 gene locus_tag LOCUS_04670 506973 506470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 507401 508474 gene locus_tag LOCUS_04680 507401 508474 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 protein_id gnl|my_center|LOCUS_04680 510629 508596 gene locus_tag LOCUS_04690 510629 508596 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_04690 510790 511596 gene locus_tag LOCUS_04700 510790 511596 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_04700 513095 511752 gene locus_tag LOCUS_04710 513095 511752 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_04710 515656 513194 gene locus_tag LOCUS_04720 515656 513194 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_04720 517476 515758 gene locus_tag LOCUS_04730 517476 515758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_04730 518612 517710 gene locus_tag LOCUS_04740 518612 517710 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_04740 519422 518625 gene locus_tag LOCUS_04750 519422 518625 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_04750 521603 519819 gene locus_tag LOCUS_04760 521603 519819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 524083 521789 gene locus_tag LOCUS_04770 gene yicI 524083 521789 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094875.1 protein_id gnl|my_center|LOCUS_04770 524243 525139 gene locus_tag LOCUS_04780 524243 525139 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_04780 525254 526216 gene locus_tag LOCUS_04790 525254 526216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 527939 526359 gene locus_tag LOCUS_04800 527939 526359 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_04800 528739 530040 gene locus_tag LOCUS_04810 528739 530040 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676255.1 protein_id gnl|my_center|LOCUS_04810 531532 530108 gene locus_tag LOCUS_04820 531532 530108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 protein_id gnl|my_center|LOCUS_04820 532017 531529 gene locus_tag LOCUS_04830 532017 531529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 533029 532007 gene locus_tag LOCUS_04840 533029 532007 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_04840 533149 533292 gene locus_tag LOCUS_04850 533149 533292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 533890 533432 gene locus_tag LOCUS_04860 gene hutP 533890 533432 CDS product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926516.1 protein_id gnl|my_center|LOCUS_04860 534863 534045 gene locus_tag LOCUS_04870 534863 534045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 536936 535128 gene locus_tag LOCUS_04880 536936 535128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 537237 538157 gene locus_tag LOCUS_04890 537237 538157 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_04890 543934 538310 gene locus_tag LOCUS_04900 543934 538310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 545908 544112 gene locus_tag LOCUS_04910 545908 544112 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_04910 546931 546053 gene locus_tag LOCUS_04920 546931 546053 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_04920 547999 546944 gene locus_tag LOCUS_04930 547999 546944 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_04930 548122 549867 gene locus_tag LOCUS_04940 548122 549867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 549897 551573 gene locus_tag LOCUS_04950 549897 551573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 551833 551660 gene locus_tag LOCUS_04960 551833 551660 CDS product FeoB-associated Cys-rich membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111117.1 protein_id gnl|my_center|LOCUS_04960 553876 551870 gene locus_tag LOCUS_04970 gene feoB 553876 551870 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_04970 554100 553873 gene locus_tag LOCUS_04980 554100 553873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 554384 555562 gene locus_tag LOCUS_04990 554384 555562 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_04990 555685 556341 gene locus_tag LOCUS_05000 555685 556341 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 protein_id gnl|my_center|LOCUS_05000 558480 556504 gene locus_tag LOCUS_05010 558480 556504 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_05010 558611 559423 gene locus_tag LOCUS_05020 558611 559423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 561010 559556 gene locus_tag LOCUS_05030 561010 559556 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083410.1 protein_id gnl|my_center|LOCUS_05030 562062 561511 gene locus_tag LOCUS_05040 562062 561511 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_05040 562309 562794 gene locus_tag LOCUS_05050 562309 562794 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050142.1 protein_id gnl|my_center|LOCUS_05050 564450 562885 gene locus_tag LOCUS_05060 564450 562885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 565421 564510 gene locus_tag LOCUS_05070 565421 564510 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 protein_id gnl|my_center|LOCUS_05070 566345 565467 gene locus_tag LOCUS_05080 566345 565467 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994448.1 protein_id gnl|my_center|LOCUS_05080 567665 566421 gene locus_tag LOCUS_05090 567665 566421 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584079.1 protein_id gnl|my_center|LOCUS_05090 567967 568887 gene locus_tag LOCUS_05100 567967 568887 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_05100 569116 571665 gene locus_tag LOCUS_05110 569116 571665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 572807 571767 gene locus_tag LOCUS_05120 572807 571767 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_05120 573844 572990 gene locus_tag LOCUS_05130 573844 572990 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_05130 574825 573848 gene locus_tag LOCUS_05140 574825 573848 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_05140 576311 574893 gene locus_tag LOCUS_05150 576311 574893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 577442 576576 gene locus_tag LOCUS_05160 577442 576576 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692220.1 protein_id gnl|my_center|LOCUS_05160 578014 577496 gene locus_tag LOCUS_05170 578014 577496 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094816.1 protein_id gnl|my_center|LOCUS_05170 578297 578731 gene locus_tag LOCUS_05180 578297 578731 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315975.1 protein_id gnl|my_center|LOCUS_05180 580017 578878 gene locus_tag LOCUS_05190 580017 578878 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392037.1 protein_id gnl|my_center|LOCUS_05190 581042 580029 gene locus_tag LOCUS_05200 581042 580029 CDS product FxLYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392038.1 protein_id gnl|my_center|LOCUS_05200 583581 581641 gene locus_tag LOCUS_05210 583581 581641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 584159 583770 gene locus_tag LOCUS_05220 584159 583770 CDS product DUF6379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705011.1 protein_id gnl|my_center|LOCUS_05220 585209 584220 gene locus_tag LOCUS_05230 585209 584220 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705012.1 protein_id gnl|my_center|LOCUS_05230 587729 585240 gene locus_tag LOCUS_05240 587729 585240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 588730 587762 gene locus_tag LOCUS_05250 588730 587762 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_05250 589858 588758 gene locus_tag LOCUS_05260 589858 588758 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_05260 591168 590077 gene locus_tag LOCUS_05270 591168 590077 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_05270 591985 591194 gene locus_tag LOCUS_05280 591985 591194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 592839 592201 gene locus_tag LOCUS_05290 592839 592201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 593898 592942 gene locus_tag LOCUS_05300 gene glcK 593898 592942 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_05300 595487 594084 gene locus_tag LOCUS_05310 595487 594084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_05310 596734 595682 gene locus_tag LOCUS_05320 596734 595682 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_05320 599543 596985 gene locus_tag LOCUS_05330 599543 596985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 601432 599699 gene locus_tag LOCUS_05340 601432 599699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 603144 601501 gene locus_tag LOCUS_05350 603144 601501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_05350 604069 603179 gene locus_tag LOCUS_05360 604069 603179 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_05360 605024 604098 gene locus_tag LOCUS_05370 605024 604098 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_05370 606377 605079 gene locus_tag LOCUS_05380 606377 605079 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 protein_id gnl|my_center|LOCUS_05380 607408 606434 gene locus_tag LOCUS_05390 607408 606434 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_05390 608419 607430 gene locus_tag LOCUS_05400 608419 607430 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_05400 610709 608742 gene locus_tag LOCUS_05410 610709 608742 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_05410 611656 610760 gene locus_tag LOCUS_05420 611656 610760 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_05420 612666 611686 gene locus_tag LOCUS_05430 612666 611686 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_05430 614417 612771 gene locus_tag LOCUS_05440 614417 612771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800407.1 protein_id gnl|my_center|LOCUS_05440 616370 614556 gene locus_tag LOCUS_05450 616370 614556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 617965 616367 gene locus_tag LOCUS_05460 617965 616367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 620569 618212 gene locus_tag LOCUS_05470 620569 618212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 623912 620583 gene locus_tag LOCUS_05480 623912 620583 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_05480 624105 624986 gene locus_tag LOCUS_05490 624105 624986 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_05490 625222 626562 gene locus_tag LOCUS_05500 625222 626562 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_05500 626797 627557 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctacgtgagtgcgtggattgaaat 627831 628691 gene locus_tag LOCUS_05510 627831 628691 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_05510 628752 629090 gene locus_tag LOCUS_05520 628752 629090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 629348 630604 gene locus_tag LOCUS_05530 629348 630604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 631426 630716 gene locus_tag LOCUS_05540 631426 630716 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759544.1 protein_id gnl|my_center|LOCUS_05540 631529 631888 gene locus_tag LOCUS_05550 631529 631888 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_05550 633312 631993 gene locus_tag LOCUS_05560 gene hemL 633312 631993 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181462.1 protein_id gnl|my_center|LOCUS_05560 634460 633444 gene locus_tag LOCUS_05570 634460 633444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 634655 635152 gene locus_tag LOCUS_05580 gene bcp 634655 635152 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_05580 636121 635375 gene locus_tag LOCUS_05590 636121 635375 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454753.1 protein_id gnl|my_center|LOCUS_05590 636235 637527 gene locus_tag LOCUS_05600 636235 637527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 637537 637710 gene locus_tag LOCUS_05610 637537 637710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 637688 638671 gene locus_tag LOCUS_05620 637688 638671 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_05620 638668 640188 gene locus_tag LOCUS_05630 638668 640188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 640145 642592 gene locus_tag LOCUS_05640 640145 642592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 642674 644212 gene locus_tag LOCUS_05650 gene guaA 642674 644212 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_05650 644795 646165 gene locus_tag LOCUS_05660 644795 646165 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_05660 646393 650286 gene locus_tag LOCUS_05670 646393 650286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence02 266 357 gene locus_tag LOCUS_t00050 266 357 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 389 465 gene locus_tag LOCUS_t00060 389 465 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 482 557 gene locus_tag LOCUS_t00070 482 557 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 563 638 gene locus_tag LOCUS_t00080 563 638 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 651 727 gene locus_tag LOCUS_t00090 651 727 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 805 880 gene locus_tag LOCUS_t00100 805 880 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 898 973 gene locus_tag LOCUS_t00110 898 973 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 979 1064 gene locus_tag LOCUS_t00120 979 1064 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1071 1147 gene locus_tag LOCUS_t00130 1071 1147 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1333 2433 gene locus_tag LOCUS_05680 1333 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2558 3679 gene locus_tag LOCUS_05690 gene ugpC 2558 3679 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_05690 3895 4836 gene locus_tag LOCUS_05700 gene hprK 3895 4836 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_05700 4849 5892 gene locus_tag LOCUS_05710 4849 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5907 6554 gene locus_tag LOCUS_05720 gene ppaX 5907 6554 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_05720 6563 7051 gene locus_tag LOCUS_05730 6563 7051 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_05730 7255 8463 gene locus_tag LOCUS_05740 7255 8463 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 protein_id gnl|my_center|LOCUS_05740 8596 8769 gene locus_tag LOCUS_05750 8596 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 8766 10007 gene locus_tag LOCUS_05760 8766 10007 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_05760 10058 10696 gene locus_tag LOCUS_05770 gene hisG 10058 10696 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_05770 10755 12062 gene locus_tag LOCUS_05780 gene hisD 10755 12062 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_05780 12059 12670 gene locus_tag LOCUS_05790 gene hisB 12059 12670 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_05790 12673 13290 gene locus_tag LOCUS_05800 gene hisH 12673 13290 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_05800 13421 14158 gene locus_tag LOCUS_05810 gene hisA 13421 14158 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_05810 14289 15047 gene locus_tag LOCUS_05820 gene hisF 14289 15047 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 protein_id gnl|my_center|LOCUS_05820 15044 15793 gene locus_tag LOCUS_05830 gene hisIE 15044 15793 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_05830 15830 16660 gene locus_tag LOCUS_05840 gene hisJ 15830 16660 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_05840 16733 17689 gene locus_tag LOCUS_05850 16733 17689 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_05850 17861 19597 gene locus_tag LOCUS_05860 17861 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19670 20626 gene locus_tag LOCUS_05870 gene trxB 19670 20626 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_05870 21080 22030 gene locus_tag LOCUS_05880 gene glcK 21080 22030 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_05880 22110 23003 gene locus_tag LOCUS_05890 gene rapZ 22110 23003 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_05890 23017 24006 gene locus_tag LOCUS_05900 gene mgfK 23017 24006 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_05900 24012 24941 gene locus_tag LOCUS_05910 gene whiA 24012 24941 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_05910 25032 25301 gene locus_tag LOCUS_05920 25032 25301 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_05920 25557 26267 gene locus_tag LOCUS_05930 25557 26267 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_05930 26431 27069 gene locus_tag LOCUS_05940 gene lipC 26431 27069 CDS product spore germination lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234415.1 protein_id gnl|my_center|LOCUS_05940 27292 28410 gene locus_tag LOCUS_05950 27292 28410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 28382 28561 gene locus_tag LOCUS_05960 28382 28561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28608 30722 gene locus_tag LOCUS_05970 28608 30722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 31448 30852 gene locus_tag LOCUS_05980 gene clpP 31448 30852 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_05980 31805 31731 gene locus_tag LOCUS_t00140 31805 31731 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32089 33114 gene locus_tag LOCUS_05990 gene cggR 32089 33114 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258187.1 protein_id gnl|my_center|LOCUS_05990 33211 34221 gene locus_tag LOCUS_06000 gene gap 33211 34221 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732485.1 protein_id gnl|my_center|LOCUS_06000 34340 35521 gene locus_tag LOCUS_06010 34340 35521 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_06010 35577 36329 gene locus_tag LOCUS_06020 gene tpiA 35577 36329 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_06020 36331 37881 gene locus_tag LOCUS_06030 gene gpmI 36331 37881 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_06030 38020 39306 gene locus_tag LOCUS_06040 gene eno 38020 39306 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_06040 39452 39913 gene locus_tag LOCUS_06050 39452 39913 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 protein_id gnl|my_center|LOCUS_06050 41086 40073 gene locus_tag LOCUS_06060 41086 40073 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 protein_id gnl|my_center|LOCUS_06060 41324 41554 gene locus_tag LOCUS_06070 gene secG 41324 41554 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727926.1 protein_id gnl|my_center|LOCUS_06070 42632 41646 gene locus_tag LOCUS_06080 42632 41646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 42861 45659 gene locus_tag LOCUS_06090 gene rnr 42861 45659 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_06090 45819 46301 gene locus_tag LOCUS_06100 gene smpB 45819 46301 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_06100 46608 46968 gene locus_tag LOCUS_tm00010 46608 46968 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 47413 48360 gene locus_tag LOCUS_06110 47413 48360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 48657 48487 gene locus_tag LOCUS_06120 48657 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 49360 48965 gene locus_tag LOCUS_06130 49360 48965 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_06130 49681 50754 gene locus_tag LOCUS_06140 49681 50754 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_06140 50862 51677 gene locus_tag LOCUS_06150 50862 51677 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 protein_id gnl|my_center|LOCUS_06150 52419 51790 gene locus_tag LOCUS_06160 52419 51790 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722624.1 protein_id gnl|my_center|LOCUS_06160 53446 52697 gene locus_tag LOCUS_06170 53446 52697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 53647 54486 gene locus_tag LOCUS_06180 53647 54486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_06180 55114 54494 gene locus_tag LOCUS_06190 55114 54494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 55384 55136 gene locus_tag LOCUS_06200 55384 55136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 55889 56692 gene locus_tag LOCUS_06210 55889 56692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 56720 57754 gene locus_tag LOCUS_06220 56720 57754 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_06220 57751 58575 gene locus_tag LOCUS_06230 57751 58575 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 protein_id gnl|my_center|LOCUS_06230 58673 59725 gene locus_tag LOCUS_06240 58673 59725 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 protein_id gnl|my_center|LOCUS_06240 60155 62863 gene locus_tag LOCUS_06250 60155 62863 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_06250 63552 65339 gene locus_tag LOCUS_06260 gene thrS 63552 65339 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663074.1 protein_id gnl|my_center|LOCUS_06260 66423 65539 gene locus_tag LOCUS_06270 66423 65539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_06270 66617 67873 gene locus_tag LOCUS_06280 66617 67873 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_06280 68211 74669 gene locus_tag LOCUS_06290 68211 74669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 75718 75053 gene locus_tag LOCUS_06300 gene zmp1 75718 75053 CDS product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861706.1 protein_id gnl|my_center|LOCUS_06300 79442 76323 gene locus_tag LOCUS_06310 79442 76323 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062821765.1 protein_id gnl|my_center|LOCUS_06310 80082 79435 gene locus_tag LOCUS_06320 80082 79435 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902402.1 protein_id gnl|my_center|LOCUS_06320 80321 86536 gene locus_tag LOCUS_06330 80321 86536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 86759 87001 gene locus_tag LOCUS_06340 86759 87001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 87117 88334 gene locus_tag LOCUS_06350 87117 88334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 88470 88958 gene locus_tag LOCUS_06360 88470 88958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 89693 89058 gene locus_tag LOCUS_06370 gene udk 89693 89058 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_06370 90025 91452 gene locus_tag LOCUS_06380 90025 91452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 91466 91708 gene locus_tag LOCUS_06390 91466 91708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 91711 93894 gene locus_tag LOCUS_06400 91711 93894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 94170 96236 gene locus_tag LOCUS_06410 94170 96236 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 protein_id gnl|my_center|LOCUS_06410 96321 97439 gene locus_tag LOCUS_06420 96321 97439 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_06420 97775 99001 gene locus_tag LOCUS_06430 97775 99001 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_06430 99222 99911 gene locus_tag LOCUS_06440 99222 99911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 100139 99948 gene locus_tag LOCUS_06450 100139 99948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 100356 100147 gene locus_tag LOCUS_06460 100356 100147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 100508 101506 gene locus_tag LOCUS_06470 gene hpxD 100508 101506 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_06470 101584 102654 gene locus_tag LOCUS_06480 gene hpxD 101584 102654 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_06480 102803 103384 gene locus_tag LOCUS_06490 102803 103384 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_06490 103628 104389 gene locus_tag LOCUS_06500 103628 104389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_06500 104464 105024 gene locus_tag LOCUS_06510 104464 105024 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966655.1 protein_id gnl|my_center|LOCUS_06510 105060 105812 gene locus_tag LOCUS_06520 105060 105812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_06520 107664 106075 gene locus_tag LOCUS_06530 107664 106075 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229647.1 protein_id gnl|my_center|LOCUS_06530 108620 108072 gene locus_tag LOCUS_06540 108620 108072 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020694.1 protein_id gnl|my_center|LOCUS_06540 108784 109212 gene locus_tag LOCUS_06550 108784 109212 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071557.1 protein_id gnl|my_center|LOCUS_06550 109230 109907 gene locus_tag LOCUS_06560 109230 109907 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_06560 109932 110702 gene locus_tag LOCUS_06570 109932 110702 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982927.1 protein_id gnl|my_center|LOCUS_06570 111381 110851 gene locus_tag LOCUS_06580 111381 110851 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378961.1 protein_id gnl|my_center|LOCUS_06580 112711 111473 gene locus_tag LOCUS_06590 gene fabF 112711 111473 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_06590 112873 113718 gene locus_tag LOCUS_06600 112873 113718 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_06600 113801 114211 gene locus_tag LOCUS_06610 gene crcB 113801 114211 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944500.1 protein_id gnl|my_center|LOCUS_06610 114211 114588 gene locus_tag LOCUS_06620 gene crcB 114211 114588 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568601.1 protein_id gnl|my_center|LOCUS_06620 115603 114746 gene locus_tag LOCUS_06630 115603 114746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 115851 116972 gene locus_tag LOCUS_06640 115851 116972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 118077 117088 gene locus_tag LOCUS_06650 118077 117088 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 protein_id gnl|my_center|LOCUS_06650 121765 118271 gene locus_tag LOCUS_06660 121765 118271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 123516 121762 gene locus_tag LOCUS_06670 123516 121762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939120.1 protein_id gnl|my_center|LOCUS_06670 123901 123551 gene locus_tag LOCUS_06680 123901 123551 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_06680 124720 123914 gene locus_tag LOCUS_06690 124720 123914 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896431.1 protein_id gnl|my_center|LOCUS_06690 124830 125285 gene locus_tag LOCUS_06700 124830 125285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 125562 126236 gene locus_tag LOCUS_06710 gene hitR 125562 126236 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612413.1 protein_id gnl|my_center|LOCUS_06710 126233 127546 gene locus_tag LOCUS_06720 gene hitS 126233 127546 CDS product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231621.1 protein_id gnl|my_center|LOCUS_06720 127662 128138 gene locus_tag LOCUS_06730 127662 128138 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966557.1 protein_id gnl|my_center|LOCUS_06730 128199 129941 gene locus_tag LOCUS_06740 128199 129941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_06740 129938 131827 gene locus_tag LOCUS_06750 129938 131827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966555.1 protein_id gnl|my_center|LOCUS_06750 133148 132483 gene locus_tag LOCUS_06760 133148 132483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016561.1 protein_id gnl|my_center|LOCUS_06760 133443 135674 gene locus_tag LOCUS_06770 133443 135674 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716548.1 protein_id gnl|my_center|LOCUS_06770 136485 135790 gene locus_tag LOCUS_06780 136485 135790 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_06780 136783 137235 gene locus_tag LOCUS_06790 136783 137235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 138295 137351 gene locus_tag LOCUS_06800 138295 137351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 139022 138288 gene locus_tag LOCUS_06810 139022 138288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 139348 139022 gene locus_tag LOCUS_06820 139348 139022 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732635.1 protein_id gnl|my_center|LOCUS_06820 141185 139623 gene locus_tag LOCUS_06830 141185 139623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199987.1 protein_id gnl|my_center|LOCUS_06830 141485 141880 gene locus_tag LOCUS_06840 gene perR 141485 141880 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 protein_id gnl|my_center|LOCUS_06840 141856 142659 gene locus_tag LOCUS_06850 141856 142659 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_06850 142711 143538 gene locus_tag LOCUS_06860 142711 143538 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence03 543 1025 gene locus_tag LOCUS_06870 543 1025 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393497.1 protein_id gnl|my_center|LOCUS_06870 1421 1609 gene locus_tag LOCUS_06880 1421 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393369.1 protein_id gnl|my_center|LOCUS_06880 1680 2585 gene locus_tag LOCUS_06890 gene accD 1680 2585 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_06890 2575 3531 gene locus_tag LOCUS_06900 2575 3531 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_06900 3748 5169 gene locus_tag LOCUS_06910 gene pyk 3748 5169 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_06910 5268 5777 gene locus_tag LOCUS_06920 5268 5777 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831194.1 protein_id gnl|my_center|LOCUS_06920 5817 6209 gene locus_tag LOCUS_06930 gene fxsA 5817 6209 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871642.1 protein_id gnl|my_center|LOCUS_06930 7446 6328 gene locus_tag LOCUS_06940 gene ytvI 7446 6328 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_06940 7792 8904 gene locus_tag LOCUS_06950 gene citZ 7792 8904 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_06950 9172 10467 gene locus_tag LOCUS_06960 gene icd 9172 10467 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_06960 10698 11108 gene locus_tag LOCUS_06970 10698 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 11404 12195 gene locus_tag LOCUS_06980 11404 12195 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245662.1 protein_id gnl|my_center|LOCUS_06980 12387 13955 gene locus_tag LOCUS_06990 gene fumA 12387 13955 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_06990 14032 15843 gene locus_tag LOCUS_07000 14032 15843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_07000 15970 16713 gene locus_tag LOCUS_07010 15970 16713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 protein_id gnl|my_center|LOCUS_07010 18781 16814 gene locus_tag LOCUS_07020 18781 16814 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517290.1 protein_id gnl|my_center|LOCUS_07020 19063 20199 gene locus_tag LOCUS_07030 19063 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20287 21042 gene locus_tag LOCUS_07040 gene pstB 20287 21042 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_07040 21062 21721 gene locus_tag LOCUS_07050 gene phoU 21062 21721 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 protein_id gnl|my_center|LOCUS_07050 21929 24595 gene locus_tag LOCUS_07060 gene polA 21929 24595 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_07060 24649 25485 gene locus_tag LOCUS_07070 gene mutM 24649 25485 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_07070 25513 26109 gene locus_tag LOCUS_07080 gene coaE 25513 26109 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_07080 26085 26669 gene locus_tag LOCUS_07090 26085 26669 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_07090 26960 26739 gene locus_tag LOCUS_07100 26960 26739 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_07100 27100 27570 gene locus_tag LOCUS_07110 gene nrdR 27100 27570 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_07110 27700 28020 gene locus_tag LOCUS_07120 27700 28020 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461632.1 protein_id gnl|my_center|LOCUS_07120 28063 28974 gene locus_tag LOCUS_07130 28063 28974 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 protein_id gnl|my_center|LOCUS_07130 29106 29264 gene locus_tag LOCUS_07140 29106 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 29550 29635 gene locus_tag LOCUS_t00150 29550 29635 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29647 29721 gene locus_tag LOCUS_t00160 29647 29721 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31299 29806 gene locus_tag LOCUS_07150 31299 29806 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_07150 31838 34000 gene locus_tag LOCUS_07160 31838 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 35285 34122 gene locus_tag LOCUS_07170 35285 34122 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_07170 35604 38006 gene locus_tag LOCUS_07180 35604 38006 CDS product NdvB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275544.1 protein_id gnl|my_center|LOCUS_07180 38096 38548 gene locus_tag LOCUS_07190 38096 38548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 38934 38560 gene locus_tag LOCUS_07200 38934 38560 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_07200 39128 40027 gene locus_tag LOCUS_07210 39128 40027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 40222 41190 gene locus_tag LOCUS_07220 40222 41190 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_07220 41187 42011 gene locus_tag LOCUS_07230 41187 42011 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_07230 42083 43492 gene locus_tag LOCUS_07240 42083 43492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_07240 43684 44865 gene locus_tag LOCUS_07250 43684 44865 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_07250 45939 44971 gene locus_tag LOCUS_07260 45939 44971 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 protein_id gnl|my_center|LOCUS_07260 46173 46652 gene locus_tag LOCUS_07270 46173 46652 CDS product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943189.1 protein_id gnl|my_center|LOCUS_07270 46676 47059 gene locus_tag LOCUS_07280 46676 47059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 47177 47914 gene locus_tag LOCUS_07290 47177 47914 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_07290 49140 47989 gene locus_tag LOCUS_07300 49140 47989 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261636.1 protein_id gnl|my_center|LOCUS_07300 49514 50260 gene locus_tag LOCUS_07310 49514 50260 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957279.1 protein_id gnl|my_center|LOCUS_07310 50263 51177 gene locus_tag LOCUS_07320 gene pfkB 50263 51177 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 protein_id gnl|my_center|LOCUS_07320 51225 53135 gene locus_tag LOCUS_07330 51225 53135 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704632.1 protein_id gnl|my_center|LOCUS_07330 53395 55206 gene locus_tag LOCUS_07340 53395 55206 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_07340 55429 56331 gene locus_tag LOCUS_07350 55429 56331 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917171.1 protein_id gnl|my_center|LOCUS_07350 57920 56460 gene locus_tag LOCUS_07360 57920 56460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 58605 57910 gene locus_tag LOCUS_07370 58605 57910 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259363.1 protein_id gnl|my_center|LOCUS_07370 58808 59200 gene locus_tag LOCUS_07380 58808 59200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 59221 60237 gene locus_tag LOCUS_07390 59221 60237 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_07390 60253 60861 gene locus_tag LOCUS_07400 60253 60861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 60922 61878 gene locus_tag LOCUS_07410 60922 61878 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_07410 62097 62699 gene locus_tag LOCUS_07420 62097 62699 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_07420 63059 62877 gene locus_tag LOCUS_07430 63059 62877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 63249 63500 gene locus_tag LOCUS_07440 63249 63500 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357967.1 protein_id gnl|my_center|LOCUS_07440 63740 64462 gene locus_tag LOCUS_07450 63740 64462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 64558 64845 gene locus_tag LOCUS_07460 64558 64845 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_07460 64894 65316 gene locus_tag LOCUS_07470 64894 65316 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274006.1 protein_id gnl|my_center|LOCUS_07470 65430 65825 gene locus_tag LOCUS_07480 65430 65825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 65988 66815 gene locus_tag LOCUS_07490 gene racE 65988 66815 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774005.1 protein_id gnl|my_center|LOCUS_07490 67034 67969 gene locus_tag LOCUS_07500 67034 67969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68021 68263 gene locus_tag LOCUS_07510 68021 68263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 68379 68681 gene locus_tag LOCUS_07520 68379 68681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 68706 68942 gene locus_tag LOCUS_07530 68706 68942 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 protein_id gnl|my_center|LOCUS_07530 71063 68982 gene locus_tag LOCUS_07540 71063 68982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 72321 71176 gene locus_tag LOCUS_07550 72321 71176 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_07550 72437 73066 gene locus_tag LOCUS_07560 72437 73066 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_07560 74305 73088 gene locus_tag LOCUS_07570 74305 73088 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362074.1 protein_id gnl|my_center|LOCUS_07570 74453 75517 gene locus_tag LOCUS_07580 gene hemE 74453 75517 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 protein_id gnl|my_center|LOCUS_07580 75549 76496 gene locus_tag LOCUS_07590 gene hemH 75549 76496 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162881.1 protein_id gnl|my_center|LOCUS_07590 76502 77920 gene locus_tag LOCUS_07600 gene hemY 76502 77920 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_07600 78076 79473 gene locus_tag LOCUS_07610 78076 79473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 79598 80374 gene locus_tag LOCUS_07620 79598 80374 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_07620 80379 81005 gene locus_tag LOCUS_07630 80379 81005 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461121.1 protein_id gnl|my_center|LOCUS_07630 81009 81884 gene locus_tag LOCUS_07640 81009 81884 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_07640 82030 82596 gene locus_tag LOCUS_07650 82030 82596 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817154.1 protein_id gnl|my_center|LOCUS_07650 82627 84600 gene locus_tag LOCUS_07660 82627 84600 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_07660 85973 84660 gene locus_tag LOCUS_07670 gene serS 85973 84660 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_07670 87359 86328 gene locus_tag LOCUS_07680 87359 86328 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356506.1 protein_id gnl|my_center|LOCUS_07680 87851 87396 gene locus_tag LOCUS_07690 87851 87396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 89746 87956 gene locus_tag LOCUS_07700 gene pepF 89746 87956 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_07700 90155 89973 gene locus_tag LOCUS_07710 90155 89973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 90428 90195 gene locus_tag LOCUS_07720 90428 90195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 90676 90873 gene locus_tag LOCUS_07730 gene cspD 90676 90873 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_07730 91036 91356 gene locus_tag LOCUS_07740 91036 91356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417218.1 protein_id gnl|my_center|LOCUS_07740 91443 92522 gene locus_tag LOCUS_07750 91443 92522 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657152.1 protein_id gnl|my_center|LOCUS_07750 92664 93635 gene locus_tag LOCUS_07760 gene pfkA 92664 93635 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_07760 95069 93699 gene locus_tag LOCUS_07770 95069 93699 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 protein_id gnl|my_center|LOCUS_07770 95407 95213 gene locus_tag LOCUS_07780 95407 95213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 96444 95623 gene locus_tag LOCUS_07790 96444 95623 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_07790 96746 98317 gene locus_tag LOCUS_07800 96746 98317 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206592.1 protein_id gnl|my_center|LOCUS_07800 98490 99305 gene locus_tag LOCUS_07810 98490 99305 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 protein_id gnl|my_center|LOCUS_07810 99719 100111 gene locus_tag LOCUS_07820 99719 100111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 100716 100198 gene locus_tag LOCUS_07830 gene tpx 100716 100198 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_07830 100873 101496 gene locus_tag LOCUS_07840 100873 101496 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 protein_id gnl|my_center|LOCUS_07840 101536 102438 gene locus_tag LOCUS_07850 gene gltC 101536 102438 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_07850 103177 102494 gene locus_tag LOCUS_07860 103177 102494 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_07860 103637 103209 gene locus_tag LOCUS_07870 103637 103209 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 protein_id gnl|my_center|LOCUS_07870 103956 105332 gene locus_tag LOCUS_07880 103956 105332 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_07880 105379 106455 gene locus_tag LOCUS_07890 105379 106455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 106452 107186 gene locus_tag LOCUS_07900 106452 107186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 107691 107173 gene locus_tag LOCUS_07910 107691 107173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 107790 108368 gene locus_tag LOCUS_07920 107790 108368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 110068 108449 gene locus_tag LOCUS_07930 gene cimA 110068 108449 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_07930 110225 111511 gene locus_tag LOCUS_07940 110225 111511 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_07940 111634 111876 gene locus_tag LOCUS_07950 111634 111876 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225461.1 protein_id gnl|my_center|LOCUS_07950 112077 113561 gene locus_tag LOCUS_07960 112077 113561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 113699 113562 gene locus_tag LOCUS_07970 113699 113562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 114036 115016 gene locus_tag LOCUS_07980 114036 115016 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887146.1 protein_id gnl|my_center|LOCUS_07980 115044 115865 gene locus_tag LOCUS_07990 115044 115865 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963961.1 protein_id gnl|my_center|LOCUS_07990 115855 116328 gene locus_tag LOCUS_08000 115855 116328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 116512 118110 gene locus_tag LOCUS_08010 gene rsmF 116512 118110 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_08010 118113 118874 gene locus_tag LOCUS_08020 118113 118874 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393245.1 protein_id gnl|my_center|LOCUS_08020 118904 119728 gene locus_tag LOCUS_08030 118904 119728 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_08030 121262 119826 gene locus_tag LOCUS_08040 121262 119826 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160248.1 protein_id gnl|my_center|LOCUS_08040 121492 122616 gene locus_tag LOCUS_08050 121492 122616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 123765 122722 gene locus_tag LOCUS_08060 123765 122722 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003293891.1 protein_id gnl|my_center|LOCUS_08060 123947 124519 gene locus_tag LOCUS_08070 123947 124519 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 protein_id gnl|my_center|LOCUS_08070 124629 124964 gene locus_tag LOCUS_08080 124629 124964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 125107 125334 gene locus_tag LOCUS_08090 125107 125334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 125440 125769 gene locus_tag LOCUS_08100 125440 125769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 125902 125989 gene locus_tag LOCUS_t00170 125902 125989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 126970 126092 gene locus_tag LOCUS_08110 126970 126092 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_08110 127073 128593 gene locus_tag LOCUS_08120 gene zwf 127073 128593 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445335.1 protein_id gnl|my_center|LOCUS_08120 128724 130244 gene locus_tag LOCUS_08130 128724 130244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 130438 131829 gene locus_tag LOCUS_08140 130438 131829 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_08140 131924 132862 gene locus_tag LOCUS_08150 131924 132862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 133682 132864 gene locus_tag LOCUS_08160 133682 132864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 133853 134062 gene locus_tag LOCUS_08170 133853 134062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 135222 134209 gene locus_tag LOCUS_08180 135222 134209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 136303 135371 gene locus_tag LOCUS_08190 136303 135371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 138076 136307 gene locus_tag LOCUS_08200 138076 136307 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100037.1 protein_id gnl|my_center|LOCUS_08200 138358 139059 gene locus_tag LOCUS_08210 138358 139059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence04 740 483 gene locus_tag LOCUS_08220 740 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 869 2683 gene locus_tag LOCUS_08230 gene pepF 869 2683 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655834.1 protein_id gnl|my_center|LOCUS_08230 5861 2805 gene locus_tag LOCUS_08240 5861 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6952 6146 gene locus_tag LOCUS_08250 gene pdaA 6952 6146 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681209.1 protein_id gnl|my_center|LOCUS_08250 7940 7047 gene locus_tag LOCUS_08260 7940 7047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_08260 8098 8478 gene locus_tag LOCUS_08270 8098 8478 CDS product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227375.1 protein_id gnl|my_center|LOCUS_08270 8475 9158 gene locus_tag LOCUS_08280 8475 9158 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227371.1 protein_id gnl|my_center|LOCUS_08280 9476 10864 gene locus_tag LOCUS_08290 9476 10864 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_08290 10901 12337 gene locus_tag LOCUS_08300 10901 12337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13270 12614 gene locus_tag LOCUS_08310 13270 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 13836 13273 gene locus_tag LOCUS_08320 13836 13273 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233428.1 protein_id gnl|my_center|LOCUS_08320 14077 14712 gene locus_tag LOCUS_08330 14077 14712 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071404.1 protein_id gnl|my_center|LOCUS_08330 14721 16289 gene locus_tag LOCUS_08340 14721 16289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_08340 16557 17009 gene locus_tag LOCUS_08350 16557 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 17122 17766 gene locus_tag LOCUS_08360 17122 17766 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 protein_id gnl|my_center|LOCUS_08360 17953 18306 gene locus_tag LOCUS_08370 17953 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 18309 18722 gene locus_tag LOCUS_08380 18309 18722 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 protein_id gnl|my_center|LOCUS_08380 18887 19042 gene locus_tag LOCUS_08390 18887 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19133 20164 gene locus_tag LOCUS_08400 19133 20164 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379233.1 protein_id gnl|my_center|LOCUS_08400 22279 20423 gene locus_tag LOCUS_08410 gene cydC 22279 20423 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244401.1 protein_id gnl|my_center|LOCUS_08410 24201 22279 gene locus_tag LOCUS_08420 24201 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 25392 24376 gene locus_tag LOCUS_08430 gene cydB 25392 24376 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727651.1 protein_id gnl|my_center|LOCUS_08430 26785 25379 gene locus_tag LOCUS_08440 26785 25379 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722078.1 protein_id gnl|my_center|LOCUS_08440 29273 27366 gene locus_tag LOCUS_08450 gene ade 29273 27366 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531322.1 protein_id gnl|my_center|LOCUS_08450 31026 29563 gene locus_tag LOCUS_08460 gene katB 31026 29563 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069157.1 protein_id gnl|my_center|LOCUS_08460 31259 31387 gene locus_tag LOCUS_08470 31259 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 32948 31533 gene locus_tag LOCUS_08480 gene pyk 32948 31533 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_08480 33259 33047 gene locus_tag LOCUS_08490 33259 33047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 34559 33327 gene locus_tag LOCUS_08500 34559 33327 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231622.1 protein_id gnl|my_center|LOCUS_08500 35749 34556 gene locus_tag LOCUS_08510 gene gerKC 35749 34556 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_08510 37831 35795 gene locus_tag LOCUS_08520 37831 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 39258 37999 gene locus_tag LOCUS_08530 gene pbuO 39258 37999 CDS product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 protein_id gnl|my_center|LOCUS_08530 40114 39638 gene locus_tag LOCUS_08540 40114 39638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 40216 40515 gene locus_tag LOCUS_08550 40216 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 protein_id gnl|my_center|LOCUS_08550 42620 40575 gene locus_tag LOCUS_08560 gene tet 42620 40575 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_08560 44046 42790 gene locus_tag LOCUS_08570 44046 42790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 45370 44084 gene locus_tag LOCUS_08580 45370 44084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 46700 45519 gene locus_tag LOCUS_08590 46700 45519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043202.1 protein_id gnl|my_center|LOCUS_08590 47181 46747 gene locus_tag LOCUS_08600 47181 46747 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220510.1 protein_id gnl|my_center|LOCUS_08600 47757 48083 gene locus_tag LOCUS_08610 47757 48083 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147952.1 protein_id gnl|my_center|LOCUS_08610 48431 49561 gene locus_tag LOCUS_08620 gene egsA 48431 49561 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_08620 50639 49713 gene locus_tag LOCUS_08630 50639 49713 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_08630 50985 52499 gene locus_tag LOCUS_08640 gene abfA 50985 52499 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_08640 52711 54045 gene locus_tag LOCUS_08650 52711 54045 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_08650 54124 55017 gene locus_tag LOCUS_08660 54124 55017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_08660 55022 55861 gene locus_tag LOCUS_08670 gene araQ 55022 55861 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_08670 55915 57405 gene locus_tag LOCUS_08680 gene abfB 55915 57405 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_08680 57402 57722 gene locus_tag LOCUS_08690 57402 57722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 57749 58735 gene locus_tag LOCUS_08700 57749 58735 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_08700 58912 59079 gene locus_tag LOCUS_08710 58912 59079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 59765 59220 gene locus_tag LOCUS_08720 59765 59220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 59993 60511 gene locus_tag LOCUS_08730 59993 60511 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043111304.1 protein_id gnl|my_center|LOCUS_08730 61001 60651 gene locus_tag LOCUS_08740 61001 60651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 60897 61241 gene locus_tag LOCUS_08750 60897 61241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 61649 63169 gene locus_tag LOCUS_08760 61649 63169 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_08760 63389 64561 gene locus_tag LOCUS_08770 63389 64561 CDS product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 protein_id gnl|my_center|LOCUS_08770 66051 64843 gene locus_tag LOCUS_08780 gene hmpA 66051 64843 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 protein_id gnl|my_center|LOCUS_08780 67332 66169 gene locus_tag LOCUS_08790 67332 66169 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301163.1 protein_id gnl|my_center|LOCUS_08790 68189 67476 gene locus_tag LOCUS_08800 gene dapD 68189 67476 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 protein_id gnl|my_center|LOCUS_08800 70962 68317 gene locus_tag LOCUS_08810 gene mprF 70962 68317 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010848.1 protein_id gnl|my_center|LOCUS_08810 72053 70980 gene locus_tag LOCUS_08820 72053 70980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_08820 72871 72050 gene locus_tag LOCUS_08830 72871 72050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 protein_id gnl|my_center|LOCUS_08830 73671 72868 gene locus_tag LOCUS_08840 73671 72868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 protein_id gnl|my_center|LOCUS_08840 74767 73661 gene locus_tag LOCUS_08850 74767 73661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 protein_id gnl|my_center|LOCUS_08850 74944 76182 gene locus_tag LOCUS_08860 gene pepT 74944 76182 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_08860 76395 78032 gene locus_tag LOCUS_08870 76395 78032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 78176 79195 gene locus_tag LOCUS_08880 78176 79195 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902706.1 protein_id gnl|my_center|LOCUS_08880 79195 80217 gene locus_tag LOCUS_08890 79195 80217 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722667.1 protein_id gnl|my_center|LOCUS_08890 80261 81307 gene locus_tag LOCUS_08900 80261 81307 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728223.1 protein_id gnl|my_center|LOCUS_08900 81595 83007 gene locus_tag LOCUS_08910 81595 83007 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_08910 83528 83815 gene locus_tag LOCUS_08920 83528 83815 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229270.1 protein_id gnl|my_center|LOCUS_08920 85211 84021 gene locus_tag LOCUS_08930 85211 84021 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809346.1 protein_id gnl|my_center|LOCUS_08930 85448 87232 gene locus_tag LOCUS_08940 85448 87232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_08940 87229 89169 gene locus_tag LOCUS_08950 87229 89169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 89769 89251 gene locus_tag LOCUS_08960 89769 89251 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 protein_id gnl|my_center|LOCUS_08960 89959 90399 gene locus_tag LOCUS_08970 89959 90399 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_08970 90626 91261 gene locus_tag LOCUS_08980 90626 91261 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_08980 91954 91376 gene locus_tag LOCUS_08990 gene lepB 91954 91376 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_08990 92876 92004 gene locus_tag LOCUS_09000 92876 92004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 93758 92988 gene locus_tag LOCUS_09010 93758 92988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 94285 93776 gene locus_tag LOCUS_09020 94285 93776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 95331 94720 gene locus_tag LOCUS_09030 95331 94720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 96934 95315 gene locus_tag LOCUS_09040 96934 95315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 97699 96950 gene locus_tag LOCUS_09050 97699 96950 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886586.1 protein_id gnl|my_center|LOCUS_09050 98263 97772 gene locus_tag LOCUS_09060 98263 97772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 99658 98453 gene locus_tag LOCUS_09070 99658 98453 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_09070 100707 99658 gene locus_tag LOCUS_09080 100707 99658 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_09080 102395 100731 gene locus_tag LOCUS_09090 102395 100731 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09090 102696 104969 gene locus_tag LOCUS_09100 102696 104969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 106956 105091 gene locus_tag LOCUS_09110 106956 105091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 107544 106969 gene locus_tag LOCUS_09120 107544 106969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 108160 107528 gene locus_tag LOCUS_09130 108160 107528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 108385 109401 gene locus_tag LOCUS_09140 108385 109401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_09140 109470 109637 gene locus_tag LOCUS_09150 109470 109637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 109910 109725 gene locus_tag LOCUS_09160 109910 109725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence05 56 130 gene locus_tag LOCUS_t00180 56 130 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 138 213 gene locus_tag LOCUS_t00190 138 213 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 241 314 gene locus_tag LOCUS_t00200 241 314 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 394 470 gene locus_tag LOCUS_t00210 394 470 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 485 558 gene locus_tag LOCUS_t00220 485 558 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 573 647 gene locus_tag LOCUS_t00230 573 647 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 654 730 gene locus_tag LOCUS_t00240 654 730 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 755 837 gene locus_tag LOCUS_t00250 755 837 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 844 919 gene locus_tag LOCUS_t00260 844 919 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1136 1753 gene locus_tag LOCUS_09170 1136 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1947 2450 gene locus_tag LOCUS_09180 gene ruvC 1947 2450 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_09180 2447 3061 gene locus_tag LOCUS_09190 gene ruvA 2447 3061 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464508.1 protein_id gnl|my_center|LOCUS_09190 3092 4096 gene locus_tag LOCUS_09200 gene ruvB 3092 4096 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_09200 4225 6318 gene locus_tag LOCUS_09210 4225 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6327 7355 gene locus_tag LOCUS_09220 gene queA 6327 7355 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_09220 7383 8522 gene locus_tag LOCUS_09230 gene tgt 7383 8522 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125362.1 protein_id gnl|my_center|LOCUS_09230 8604 8882 gene locus_tag LOCUS_09240 gene yajC 8604 8882 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 protein_id gnl|my_center|LOCUS_09240 9793 8966 gene locus_tag LOCUS_09250 9793 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10277 9885 gene locus_tag LOCUS_09260 10277 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11942 10347 gene locus_tag LOCUS_09270 gene spoVB 11942 10347 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 protein_id gnl|my_center|LOCUS_09270 12180 12437 gene locus_tag LOCUS_09280 12180 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 12567 13841 gene locus_tag LOCUS_09290 12567 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 13831 14778 gene locus_tag LOCUS_09300 13831 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09300 14870 15820 gene locus_tag LOCUS_09310 14870 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 15863 18262 gene locus_tag LOCUS_09320 gene recJ 15863 18262 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_09320 18312 18830 gene locus_tag LOCUS_09330 18312 18830 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 protein_id gnl|my_center|LOCUS_09330 20250 18934 gene locus_tag LOCUS_09340 gene uraA 20250 18934 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703151.1 protein_id gnl|my_center|LOCUS_09340 20597 22777 gene locus_tag LOCUS_09350 gene relA 20597 22777 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_09350 22843 23289 gene locus_tag LOCUS_09360 gene dtd 22843 23289 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_09360 23787 24293 gene locus_tag LOCUS_09370 gene yhbO 23787 24293 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_09370 24363 24821 gene locus_tag LOCUS_09380 24363 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 25437 26681 gene locus_tag LOCUS_09390 gene hisS 25437 26681 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027084.1 protein_id gnl|my_center|LOCUS_09390 26731 28527 gene locus_tag LOCUS_09400 gene aspS 26731 28527 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_09400 28569 29336 gene locus_tag LOCUS_09410 28569 29336 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_09410 29547 31700 gene locus_tag LOCUS_09420 29547 31700 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059519.1 protein_id gnl|my_center|LOCUS_09420 32231 31923 gene locus_tag LOCUS_09430 32231 31923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 32712 34028 gene locus_tag LOCUS_09440 32712 34028 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_09440 35261 34131 gene locus_tag LOCUS_09450 gene mnmA 35261 34131 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_09450 35534 35953 gene locus_tag LOCUS_09460 gene cymR 35534 35953 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_09460 36167 37018 gene locus_tag LOCUS_09470 36167 37018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 37755 37057 gene locus_tag LOCUS_09480 37755 37057 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126322.1 protein_id gnl|my_center|LOCUS_09480 38045 39202 gene locus_tag LOCUS_09490 gene nifS 38045 39202 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_09490 39264 39767 gene locus_tag LOCUS_09500 39264 39767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 39794 40006 gene locus_tag LOCUS_09510 39794 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_09510 40244 41311 gene locus_tag LOCUS_09520 40244 41311 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_09520 41687 44314 gene locus_tag LOCUS_09530 gene alaS 41687 44314 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_09530 44493 44753 gene locus_tag LOCUS_09540 44493 44753 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_09540 44792 45208 gene locus_tag LOCUS_09550 gene ruvX 44792 45208 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_09550 45233 45523 gene locus_tag LOCUS_09560 45233 45523 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_09560 45523 45828 gene locus_tag LOCUS_09570 45523 45828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 45963 47015 gene locus_tag LOCUS_09580 gene mltG 45963 47015 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_09580 47035 47970 gene locus_tag LOCUS_09590 47035 47970 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 protein_id gnl|my_center|LOCUS_09590 47998 49329 gene locus_tag LOCUS_09600 47998 49329 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217969.1 protein_id gnl|my_center|LOCUS_09600 49506 51668 gene locus_tag LOCUS_09610 49506 51668 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812357.1 protein_id gnl|my_center|LOCUS_09610 51822 53708 gene locus_tag LOCUS_09620 51822 53708 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_09620 53822 55294 gene locus_tag LOCUS_09630 53822 55294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 57208 55523 gene locus_tag LOCUS_09640 gene ilvD 57208 55523 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_09640 57918 57661 gene locus_tag LOCUS_09650 57918 57661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 59094 58042 gene locus_tag LOCUS_09660 59094 58042 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 protein_id gnl|my_center|LOCUS_09660 59329 60129 gene locus_tag LOCUS_09670 59329 60129 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968837.1 protein_id gnl|my_center|LOCUS_09670 60126 60887 gene locus_tag LOCUS_09680 60126 60887 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_09680 61020 62036 gene locus_tag LOCUS_09690 gene mgrA 61020 62036 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_09690 62985 62110 gene locus_tag LOCUS_09700 62985 62110 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_09700 63144 64325 gene locus_tag LOCUS_09710 63144 64325 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_09710 64327 65316 gene locus_tag LOCUS_09720 gene galE 64327 65316 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 protein_id gnl|my_center|LOCUS_09720 65319 66914 gene locus_tag LOCUS_09730 gene galT 65319 66914 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 protein_id gnl|my_center|LOCUS_09730 67091 68254 gene locus_tag LOCUS_09740 67091 68254 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179100.1 protein_id gnl|my_center|LOCUS_09740 68398 68952 gene locus_tag LOCUS_09750 68398 68952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460096.1 protein_id gnl|my_center|LOCUS_09750 68939 70471 gene locus_tag LOCUS_09760 68939 70471 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_09760 70616 71461 gene locus_tag LOCUS_09770 gene glcT 70616 71461 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073864.1 protein_id gnl|my_center|LOCUS_09770 71756 73819 gene locus_tag LOCUS_09780 gene ptsG 71756 73819 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 protein_id gnl|my_center|LOCUS_09780 73915 74187 gene locus_tag LOCUS_09790 73915 74187 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_09790 74184 75896 gene locus_tag LOCUS_09800 gene ptsP 74184 75896 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174207.1 protein_id gnl|my_center|LOCUS_09800 76154 76807 gene locus_tag LOCUS_09810 76154 76807 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_09810 77077 81507 gene locus_tag LOCUS_09820 77077 81507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 81651 82394 gene locus_tag LOCUS_09830 81651 82394 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841307.1 protein_id gnl|my_center|LOCUS_09830 82400 82885 gene locus_tag LOCUS_09840 82400 82885 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_09840 83232 82930 gene locus_tag LOCUS_09850 83232 82930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_09850 83384 84280 gene locus_tag LOCUS_09860 83384 84280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 85055 84408 gene locus_tag LOCUS_09870 85055 84408 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428273.1 protein_id gnl|my_center|LOCUS_09870 85288 85590 gene locus_tag LOCUS_09880 85288 85590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 85950 87350 gene locus_tag LOCUS_09890 85950 87350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 87608 87778 gene locus_tag LOCUS_09900 87608 87778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 88110 87868 gene locus_tag LOCUS_09910 88110 87868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 87992 89182 gene locus_tag LOCUS_09920 87992 89182 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085672.1 protein_id gnl|my_center|LOCUS_09920 89179 90513 gene locus_tag LOCUS_09930 89179 90513 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_09930 90535 91491 gene locus_tag LOCUS_09940 90535 91491 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_09940 92541 91618 gene locus_tag LOCUS_09950 92541 91618 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_09950 93074 94189 gene locus_tag LOCUS_09960 93074 94189 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 protein_id gnl|my_center|LOCUS_09960 94377 95276 gene locus_tag LOCUS_09970 94377 95276 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_09970 95294 96112 gene locus_tag LOCUS_09980 95294 96112 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_09980 96144 97142 gene locus_tag LOCUS_09990 96144 97142 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210384.1 protein_id gnl|my_center|LOCUS_09990 97364 99529 gene locus_tag LOCUS_10000 97364 99529 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_10000 99676 103092 gene locus_tag LOCUS_10010 99676 103092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 protein_id gnl|my_center|LOCUS_10010 103470 104498 gene locus_tag LOCUS_10020 103470 104498 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_10020 104712 105638 gene locus_tag LOCUS_10030 gene moaA 104712 105638 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844143.1 protein_id gnl|my_center|LOCUS_10030 105774 106121 gene locus_tag LOCUS_10040 105774 106121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 106250 108619 gene locus_tag LOCUS_10050 106250 108619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence06 419 1381 gene locus_tag LOCUS_10060 419 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1645 1983 gene locus_tag LOCUS_10070 1645 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2319 3179 gene locus_tag LOCUS_10080 2319 3179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 protein_id gnl|my_center|LOCUS_10080 3377 4663 gene locus_tag LOCUS_10090 3377 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5162 6520 gene locus_tag LOCUS_10100 5162 6520 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289543.1 protein_id gnl|my_center|LOCUS_10100 6674 7327 gene locus_tag LOCUS_10110 6674 7327 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983265.1 protein_id gnl|my_center|LOCUS_10110 7519 8340 gene locus_tag LOCUS_10120 7519 8340 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 protein_id gnl|my_center|LOCUS_10120 8638 10731 gene locus_tag LOCUS_10130 8638 10731 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 protein_id gnl|my_center|LOCUS_10130 10887 12119 gene locus_tag LOCUS_10140 10887 12119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 protein_id gnl|my_center|LOCUS_10140 12124 12612 gene locus_tag LOCUS_10150 12124 12612 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932068.1 protein_id gnl|my_center|LOCUS_10150 12669 13463 gene locus_tag LOCUS_10160 12669 13463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 protein_id gnl|my_center|LOCUS_10160 13674 15371 gene locus_tag LOCUS_10170 13674 15371 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_10170 15449 15973 gene locus_tag LOCUS_10180 15449 15973 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813074.1 protein_id gnl|my_center|LOCUS_10180 17266 16076 gene locus_tag LOCUS_10190 17266 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 17453 18082 gene locus_tag LOCUS_10200 17453 18082 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_10200 21365 18180 gene locus_tag LOCUS_10210 gene srfP 21365 18180 CDS product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 protein_id gnl|my_center|LOCUS_10210 21580 21377 gene locus_tag LOCUS_10220 21580 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 22475 21543 gene locus_tag LOCUS_10230 22475 21543 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659627.1 protein_id gnl|my_center|LOCUS_10230 22900 22583 gene locus_tag LOCUS_10240 22900 22583 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312623.1 protein_id gnl|my_center|LOCUS_10240 23240 22905 gene locus_tag LOCUS_10250 23240 22905 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 protein_id gnl|my_center|LOCUS_10250 23866 23237 gene locus_tag LOCUS_10260 23866 23237 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002005730.1 protein_id gnl|my_center|LOCUS_10260 24075 25583 gene locus_tag LOCUS_10270 24075 25583 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_10270 26957 25659 gene locus_tag LOCUS_10280 26957 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 27015 27533 gene locus_tag LOCUS_10290 27015 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 27734 28804 gene locus_tag LOCUS_10300 27734 28804 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_10300 29009 30160 gene locus_tag LOCUS_10310 gene fni 29009 30160 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_10310 30265 31365 gene locus_tag LOCUS_10320 gene ychF 30265 31365 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_10320 32346 31483 gene locus_tag LOCUS_10330 32346 31483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_10330 32623 33690 gene locus_tag LOCUS_10340 gene prfA 32623 33690 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887065.1 protein_id gnl|my_center|LOCUS_10340 33695 34600 gene locus_tag LOCUS_10350 gene prmC 33695 34600 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_10350 34727 35905 gene locus_tag LOCUS_10360 gene rodA 34727 35905 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964563.1 protein_id gnl|my_center|LOCUS_10360 36062 36649 gene locus_tag LOCUS_10370 36062 36649 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886423.1 protein_id gnl|my_center|LOCUS_10370 36764 37492 gene locus_tag LOCUS_10380 gene spoIIR 36764 37492 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_10380 37873 39012 gene locus_tag LOCUS_10390 37873 39012 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_10390 39152 40000 gene locus_tag LOCUS_10400 39152 40000 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_10400 40097 40657 gene locus_tag LOCUS_10410 40097 40657 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_10410 40734 41312 gene locus_tag LOCUS_10420 gene prpB 40734 41312 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_10420 41655 42242 gene locus_tag LOCUS_10430 41655 42242 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_10430 42334 43581 gene locus_tag LOCUS_10440 gene glyA 42334 43581 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_10440 43810 44439 gene locus_tag LOCUS_10450 gene upp 43810 44439 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_10450 44474 45649 gene locus_tag LOCUS_10460 gene wecB 44474 45649 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_10460 45826 46098 gene locus_tag LOCUS_10470 45826 46098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 46091 46510 gene locus_tag LOCUS_10480 46091 46510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 46549 47379 gene locus_tag LOCUS_10490 gene atpB 46549 47379 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399877.1 protein_id gnl|my_center|LOCUS_10490 47484 47708 gene locus_tag LOCUS_10500 47484 47708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 47841 48329 gene locus_tag LOCUS_10510 gene atpF 47841 48329 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_10510 48326 48877 gene locus_tag LOCUS_10520 48326 48877 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 protein_id gnl|my_center|LOCUS_10520 48893 50407 gene locus_tag LOCUS_10530 gene atpA 48893 50407 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 protein_id gnl|my_center|LOCUS_10530 50632 51498 gene locus_tag LOCUS_10540 gene atpG 50632 51498 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 protein_id gnl|my_center|LOCUS_10540 51626 53026 gene locus_tag LOCUS_10550 gene atpD 51626 53026 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 protein_id gnl|my_center|LOCUS_10550 53070 53489 gene locus_tag LOCUS_10560 gene atpC 53070 53489 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_10560 53968 54222 gene locus_tag LOCUS_10570 53968 54222 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 protein_id gnl|my_center|LOCUS_10570 54533 55873 gene locus_tag LOCUS_10580 gene murA 54533 55873 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411274.1 protein_id gnl|my_center|LOCUS_10580 56012 56794 gene locus_tag LOCUS_10590 56012 56794 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_10590 57404 57616 gene locus_tag LOCUS_10600 57404 57616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 57736 58773 gene locus_tag LOCUS_10610 gene spoIID 57736 58773 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672623.1 protein_id gnl|my_center|LOCUS_10610 58852 59637 gene locus_tag LOCUS_10620 58852 59637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 59920 60204 gene locus_tag LOCUS_10630 gene spoIIID 59920 60204 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 protein_id gnl|my_center|LOCUS_10630 60468 61463 gene locus_tag LOCUS_10640 60468 61463 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_10640 61541 62416 gene locus_tag LOCUS_10650 gene flhO 61541 62416 CDS product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 protein_id gnl|my_center|LOCUS_10650 62427 63263 gene locus_tag LOCUS_10660 gene flgG 62427 63263 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_10660 63276 63587 gene locus_tag LOCUS_10670 63276 63587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 63998 64420 gene locus_tag LOCUS_10680 gene fabZ 63998 64420 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_10680 64474 66192 gene locus_tag LOCUS_10690 gene pgcA 64474 66192 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_10690 66304 68322 gene locus_tag LOCUS_10700 66304 68322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 68295 69461 gene locus_tag LOCUS_10710 gene csaB 68295 69461 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241591.1 protein_id gnl|my_center|LOCUS_10710 69458 70216 gene locus_tag LOCUS_10720 69458 70216 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_10720 70333 71463 gene locus_tag LOCUS_10730 70333 71463 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_10730 71641 75609 gene locus_tag LOCUS_10740 71641 75609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 75769 76110 gene locus_tag LOCUS_10750 75769 76110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 76626 79637 gene locus_tag LOCUS_10760 76626 79637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 79811 82336 gene locus_tag LOCUS_10770 79811 82336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 82466 83002 gene locus_tag LOCUS_10780 82466 83002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 83121 83396 gene locus_tag LOCUS_10790 83121 83396 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124489.1 protein_id gnl|my_center|LOCUS_10790 83554 84756 gene locus_tag LOCUS_10800 gene metK 83554 84756 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_10800 84995 88975 gene locus_tag LOCUS_10810 84995 88975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 89251 91944 gene locus_tag LOCUS_10820 89251 91944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 91998 93161 gene locus_tag LOCUS_10830 gene degS 91998 93161 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_10830 93165 93893 gene locus_tag LOCUS_10840 gene degU 93165 93893 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_10840 94161 94592 gene locus_tag LOCUS_10850 94161 94592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence07 958 410 gene locus_tag LOCUS_10860 gene cotE 958 410 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_10860 2021 1050 gene locus_tag LOCUS_10870 2021 1050 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 protein_id gnl|my_center|LOCUS_10870 3100 2258 gene locus_tag LOCUS_10880 3100 2258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 protein_id gnl|my_center|LOCUS_10880 3885 3097 gene locus_tag LOCUS_10890 3885 3097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009036.1 protein_id gnl|my_center|LOCUS_10890 4908 3910 gene locus_tag LOCUS_10900 4908 3910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733213.1 protein_id gnl|my_center|LOCUS_10900 6683 5166 gene locus_tag LOCUS_10910 gene ypwA 6683 5166 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 protein_id gnl|my_center|LOCUS_10910 6939 7505 gene locus_tag LOCUS_10920 6939 7505 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838159.1 protein_id gnl|my_center|LOCUS_10920 9774 7702 gene locus_tag LOCUS_10930 9774 7702 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_10930 11510 9954 gene locus_tag LOCUS_10940 11510 9954 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_10940 13564 11690 gene locus_tag LOCUS_10950 gene bglP 13564 11690 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_10950 14582 13722 gene locus_tag LOCUS_10960 gene licT 14582 13722 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_10960 16248 14791 gene locus_tag LOCUS_10970 16248 14791 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_10970 16627 16869 gene locus_tag LOCUS_10980 16627 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18013 17120 gene locus_tag LOCUS_10990 18013 17120 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_10990 18134 19507 gene locus_tag LOCUS_11000 18134 19507 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_11000 19515 20147 gene locus_tag LOCUS_11010 gene lacA 19515 20147 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602186.1 protein_id gnl|my_center|LOCUS_11010 20194 21000 gene locus_tag LOCUS_11020 20194 21000 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081584.1 protein_id gnl|my_center|LOCUS_11020 23084 21120 gene locus_tag LOCUS_11030 23084 21120 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986616.1 protein_id gnl|my_center|LOCUS_11030 23930 23148 gene locus_tag LOCUS_11040 23930 23148 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_11040 24141 24947 gene locus_tag LOCUS_11050 24141 24947 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260128.1 protein_id gnl|my_center|LOCUS_11050 25647 25042 gene locus_tag LOCUS_11060 25647 25042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 26650 25778 gene locus_tag LOCUS_11070 26650 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27647 26691 gene locus_tag LOCUS_11080 27647 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 27837 28832 gene locus_tag LOCUS_11090 27837 28832 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_11090 29937 28825 gene locus_tag LOCUS_11100 29937 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 31012 30053 gene locus_tag LOCUS_11110 31012 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 31694 31248 gene locus_tag LOCUS_11120 31694 31248 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964877.1 protein_id gnl|my_center|LOCUS_11120 32665 31922 gene locus_tag LOCUS_11130 32665 31922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 33014 32712 gene locus_tag LOCUS_11140 33014 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 33379 33083 gene locus_tag LOCUS_11150 33379 33083 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_11150 34345 33431 gene locus_tag LOCUS_11160 34345 33431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 34769 34389 gene locus_tag LOCUS_11170 34769 34389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 34883 35299 gene locus_tag LOCUS_11180 34883 35299 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 protein_id gnl|my_center|LOCUS_11180 35460 35618 gene locus_tag LOCUS_11190 35460 35618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 35790 35909 gene locus_tag LOCUS_11200 35790 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 35933 36202 gene locus_tag LOCUS_11210 35933 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 37099 36245 gene locus_tag LOCUS_11220 37099 36245 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_11220 37326 40274 gene locus_tag LOCUS_11230 37326 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 40314 41954 gene locus_tag LOCUS_11240 40314 41954 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_11240 42195 43151 gene locus_tag LOCUS_11250 42195 43151 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_11250 43203 44099 gene locus_tag LOCUS_11260 43203 44099 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_11260 44158 46077 gene locus_tag LOCUS_11270 44158 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 46974 46228 gene locus_tag LOCUS_11280 46974 46228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 47800 47069 gene locus_tag LOCUS_11290 47800 47069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 50350 47921 gene locus_tag LOCUS_11300 50350 47921 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 protein_id gnl|my_center|LOCUS_11300 51761 50613 gene locus_tag LOCUS_11310 51761 50613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651900.1 protein_id gnl|my_center|LOCUS_11310 52888 51764 gene locus_tag LOCUS_11320 52888 51764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020136.1 protein_id gnl|my_center|LOCUS_11320 53841 52900 gene locus_tag LOCUS_11330 53841 52900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_11330 55091 53937 gene locus_tag LOCUS_11340 55091 53937 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397664.1 protein_id gnl|my_center|LOCUS_11340 55791 55084 gene locus_tag LOCUS_11350 55791 55084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694093.1 protein_id gnl|my_center|LOCUS_11350 56283 55972 gene locus_tag LOCUS_11360 56283 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 57167 56388 gene locus_tag LOCUS_11370 57167 56388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_11370 57482 58357 gene locus_tag LOCUS_11380 57482 58357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109503.1 protein_id gnl|my_center|LOCUS_11380 58493 59356 gene locus_tag LOCUS_11390 58493 59356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_11390 59359 60093 gene locus_tag LOCUS_11400 59359 60093 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_11400 60723 60268 gene locus_tag LOCUS_11410 60723 60268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 63394 60932 gene locus_tag LOCUS_11420 gene parC 63394 60932 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_11420 65403 63424 gene locus_tag LOCUS_11430 gene parE 65403 63424 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062207.1 protein_id gnl|my_center|LOCUS_11430 66473 65484 gene locus_tag LOCUS_11440 66473 65484 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206490.1 protein_id gnl|my_center|LOCUS_11440 67461 66466 gene locus_tag LOCUS_11450 67461 66466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 protein_id gnl|my_center|LOCUS_11450 68329 67508 gene locus_tag LOCUS_11460 68329 67508 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256988.1 protein_id gnl|my_center|LOCUS_11460 68539 68611 gene locus_tag LOCUS_t00270 68539 68611 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 69268 68741 gene locus_tag LOCUS_11470 69268 68741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 70244 69363 gene locus_tag LOCUS_11480 70244 69363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 70933 70427 gene locus_tag LOCUS_11490 70933 70427 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051742.1 protein_id gnl|my_center|LOCUS_11490 71755 71084 gene locus_tag LOCUS_11500 71755 71084 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110287.1 protein_id gnl|my_center|LOCUS_11500 72959 71952 gene locus_tag LOCUS_11510 gene mglC 72959 71952 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 protein_id gnl|my_center|LOCUS_11510 74488 72986 gene locus_tag LOCUS_11520 gene mglA 74488 72986 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162291.1 protein_id gnl|my_center|LOCUS_11520 75529 74507 gene locus_tag LOCUS_11530 gene mglB 75529 74507 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_11530 76786 75809 gene locus_tag LOCUS_11540 76786 75809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_11540 78571 76790 gene locus_tag LOCUS_11550 78571 76790 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_11550 80247 78568 gene locus_tag LOCUS_11560 80247 78568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 80860 80471 gene locus_tag LOCUS_11570 80860 80471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 82108 80930 gene locus_tag LOCUS_11580 gene purT 82108 80930 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 protein_id gnl|my_center|LOCUS_11580 84149 82263 gene locus_tag LOCUS_11590 84149 82263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_11590 85908 84154 gene locus_tag LOCUS_11600 85908 84154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_11600 <88235 86246 gene locus_tag LOCUS_11610 <88235 86246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000182166.1:dynamin family protein >Feature sequence08 280 1371 gene locus_tag LOCUS_11620 gene wecB 280 1371 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_11620 1364 2350 gene locus_tag LOCUS_11630 1364 2350 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_11630 2347 3186 gene locus_tag LOCUS_11640 2347 3186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_11640 3179 4165 gene locus_tag LOCUS_11650 3179 4165 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739077.1 protein_id gnl|my_center|LOCUS_11650 4183 5118 gene locus_tag LOCUS_11660 4183 5118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_11660 5213 5983 gene locus_tag LOCUS_11670 gene rfbF 5213 5983 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_11670 6010 7008 gene locus_tag LOCUS_11680 6010 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7184 7372 gene locus_tag LOCUS_11690 7184 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7482 7751 gene locus_tag LOCUS_11700 7482 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 8201 10615 gene locus_tag LOCUS_11710 8201 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 10608 12101 gene locus_tag LOCUS_11720 10608 12101 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_11720 12091 12678 gene locus_tag LOCUS_11730 12091 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12668 13729 gene locus_tag LOCUS_11740 12668 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 13782 14765 gene locus_tag LOCUS_11750 13782 14765 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 protein_id gnl|my_center|LOCUS_11750 14788 15399 gene locus_tag LOCUS_11760 14788 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 15400 18312 gene locus_tag LOCUS_11770 15400 18312 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_11770 18492 19013 gene locus_tag LOCUS_11780 18492 19013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414677.1 protein_id gnl|my_center|LOCUS_11780 19010 19963 gene locus_tag LOCUS_11790 19010 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 21262 20135 gene locus_tag LOCUS_11800 gene pseC 21262 20135 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_11800 21962 21276 gene locus_tag LOCUS_11810 21962 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11810 22760 21987 gene locus_tag LOCUS_11820 22760 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 23334 22783 gene locus_tag LOCUS_11830 gene rfbC 23334 22783 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869415.1 protein_id gnl|my_center|LOCUS_11830 24449 23331 gene locus_tag LOCUS_11840 gene rfbG 24449 23331 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_11840 24658 25131 gene locus_tag LOCUS_11850 24658 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 25167 25628 gene locus_tag LOCUS_11860 25167 25628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 25631 25831 gene locus_tag LOCUS_11870 25631 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 25844 27361 gene locus_tag LOCUS_11880 25844 27361 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130010.1 protein_id gnl|my_center|LOCUS_11880 27351 28061 gene locus_tag LOCUS_11890 27351 28061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 28063 29181 gene locus_tag LOCUS_11900 28063 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 29218 30252 gene locus_tag LOCUS_11910 29218 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 31300 30407 gene locus_tag LOCUS_11920 31300 30407 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963396.1 protein_id gnl|my_center|LOCUS_11920 32056 31391 gene locus_tag LOCUS_11930 32056 31391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 32224 33291 gene locus_tag LOCUS_11940 32224 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 34584 33382 gene locus_tag LOCUS_11950 gene nagA 34584 33382 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_11950 35309 34581 gene locus_tag LOCUS_11960 gene nagB 35309 34581 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_11960 36129 35350 gene locus_tag LOCUS_11970 36129 35350 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_11970 36485 36943 gene locus_tag LOCUS_11980 36485 36943 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132365.1 protein_id gnl|my_center|LOCUS_11980 38931 37024 gene locus_tag LOCUS_11990 38931 37024 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900389.1 protein_id gnl|my_center|LOCUS_11990 40292 38952 gene locus_tag LOCUS_12000 gene efeB 40292 38952 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_12000 41216 40296 gene locus_tag LOCUS_12010 41216 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 41402 42892 gene locus_tag LOCUS_12020 gene glpK 41402 42892 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_12020 43113 43337 gene locus_tag LOCUS_12030 gene gerE 43113 43337 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_12030 44789 43431 gene locus_tag LOCUS_12040 44789 43431 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_12040 45013 46242 gene locus_tag LOCUS_12050 45013 46242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 46439 47443 gene locus_tag LOCUS_12060 46439 47443 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_12060 48121 47549 gene locus_tag LOCUS_12070 48121 47549 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665103.1 protein_id gnl|my_center|LOCUS_12070 48252 49622 gene locus_tag LOCUS_12080 48252 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 49793 50542 gene locus_tag LOCUS_12090 49793 50542 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261765.1 protein_id gnl|my_center|LOCUS_12090 50539 51165 gene locus_tag LOCUS_12100 50539 51165 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_12100 53109 51265 gene locus_tag LOCUS_12110 gene asnB 53109 51265 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_12110 53267 53617 gene locus_tag LOCUS_12120 53267 53617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 53741 53817 gene locus_tag LOCUS_t00280 53741 53817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54177 54845 gene locus_tag LOCUS_12130 54177 54845 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_12130 55069 56523 gene locus_tag LOCUS_12140 55069 56523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 56523 57239 gene locus_tag LOCUS_12150 56523 57239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_12150 57236 58408 gene locus_tag LOCUS_12160 57236 58408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_12160 58643 59509 gene locus_tag LOCUS_12170 58643 59509 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966597.1 protein_id gnl|my_center|LOCUS_12170 59538 60206 gene locus_tag LOCUS_12180 59538 60206 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966598.1 protein_id gnl|my_center|LOCUS_12180 60219 60971 gene locus_tag LOCUS_12190 60219 60971 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966599.1 protein_id gnl|my_center|LOCUS_12190 61797 61108 gene locus_tag LOCUS_12200 61797 61108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168185.1 protein_id gnl|my_center|LOCUS_12200 62991 61846 gene locus_tag LOCUS_12210 62991 61846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 protein_id gnl|my_center|LOCUS_12210 63722 62988 gene locus_tag LOCUS_12220 63722 62988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812699.1 protein_id gnl|my_center|LOCUS_12220 64280 63903 gene locus_tag LOCUS_12230 64280 63903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 66189 64372 gene locus_tag LOCUS_12240 66189 64372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_12240 67927 66182 gene locus_tag LOCUS_12250 67927 66182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_12250 68537 68055 gene locus_tag LOCUS_12260 gene bsaA 68537 68055 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219417.1 protein_id gnl|my_center|LOCUS_12260 69806 68697 gene locus_tag LOCUS_12270 69806 68697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 72606 70240 gene locus_tag LOCUS_12280 72606 70240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence09 <1 596 gene locus_tag LOCUS_12290 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000997695.1:IS256-like element ISEf1 family transposase 668 1549 gene locus_tag LOCUS_12300 668 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_12300 1827 4511 gene locus_tag LOCUS_12310 1827 4511 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_12310 4727 7270 gene locus_tag LOCUS_12320 4727 7270 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_12320 7904 8431 gene locus_tag LOCUS_12330 7904 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8471 10732 gene locus_tag LOCUS_12340 8471 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10707 12209 gene locus_tag LOCUS_12350 10707 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 12231 13166 gene locus_tag LOCUS_12360 12231 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 13298 14365 gene locus_tag LOCUS_12370 13298 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14362 17475 gene locus_tag LOCUS_12380 14362 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 17441 19912 gene locus_tag LOCUS_12390 17441 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 19958 22009 gene locus_tag LOCUS_12400 19958 22009 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922436.1 protein_id gnl|my_center|LOCUS_12400 22024 23901 gene locus_tag LOCUS_12410 22024 23901 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775114.1 protein_id gnl|my_center|LOCUS_12410 23912 24871 gene locus_tag LOCUS_12420 23912 24871 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_12420 24892 25110 gene locus_tag LOCUS_12430 24892 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 25688 25179 gene locus_tag LOCUS_12440 25688 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 26270 28465 gene locus_tag LOCUS_12450 26270 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 28462 30723 gene locus_tag LOCUS_12460 28462 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 30742 33060 gene locus_tag LOCUS_12470 30742 33060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 33035 34372 gene locus_tag LOCUS_12480 33035 34372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 34400 34765 gene locus_tag LOCUS_12490 34400 34765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 34758 35324 gene locus_tag LOCUS_12500 34758 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 37195 35621 gene locus_tag LOCUS_12510 37195 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 37353 37192 gene locus_tag LOCUS_12520 37353 37192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 37930 38532 gene locus_tag LOCUS_12530 37930 38532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 38543 39634 gene locus_tag LOCUS_12540 38543 39634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 40601 41581 gene locus_tag LOCUS_12550 40601 41581 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022848.1 protein_id gnl|my_center|LOCUS_12550 41737 42306 gene locus_tag LOCUS_12560 41737 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_12560 43169 42507 gene locus_tag LOCUS_12570 43169 42507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 43221 43436 gene locus_tag LOCUS_12580 43221 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 43820 44395 gene locus_tag LOCUS_12590 43820 44395 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775681.1 protein_id gnl|my_center|LOCUS_12590 44392 47601 gene locus_tag LOCUS_12600 44392 47601 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 protein_id gnl|my_center|LOCUS_12600 47646 48260 gene locus_tag LOCUS_12610 47646 48260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 48200 48562 gene locus_tag LOCUS_12620 48200 48562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 48559 49725 gene locus_tag LOCUS_12630 48559 49725 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476039.1 protein_id gnl|my_center|LOCUS_12630 49741 50355 gene locus_tag LOCUS_12640 49741 50355 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_12640 50392 51990 gene locus_tag LOCUS_12650 50392 51990 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775679.1 protein_id gnl|my_center|LOCUS_12650 52093 52587 gene locus_tag LOCUS_12660 52093 52587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 53535 52603 gene locus_tag LOCUS_12670 53535 52603 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058548.1 protein_id gnl|my_center|LOCUS_12670 53791 54771 gene locus_tag LOCUS_12680 53791 54771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 54768 54947 gene locus_tag LOCUS_12690 54768 54947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 55171 56334 gene locus_tag LOCUS_12700 55171 56334 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459653.1 protein_id gnl|my_center|LOCUS_12700 56753 57658 gene locus_tag LOCUS_12710 56753 57658 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_12710 57762 58331 gene locus_tag LOCUS_12720 57762 58331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 58432 58992 gene locus_tag LOCUS_12730 58432 58992 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_12730 59301 59960 gene locus_tag LOCUS_12740 59301 59960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 59935 60390 gene locus_tag LOCUS_12750 59935 60390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 61154 60615 gene locus_tag LOCUS_12760 61154 60615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 61461 61243 gene locus_tag LOCUS_12770 61461 61243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence10 810 583 gene locus_tag LOCUS_12780 810 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1556 951 gene locus_tag LOCUS_12790 1556 951 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_12790 1735 2550 gene locus_tag LOCUS_12800 gene pdaB 1735 2550 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 protein_id gnl|my_center|LOCUS_12800 2992 3471 gene locus_tag LOCUS_12810 2992 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4653 3538 gene locus_tag LOCUS_12820 4653 3538 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 protein_id gnl|my_center|LOCUS_12820 5491 4736 gene locus_tag LOCUS_12830 gene cwlD 5491 4736 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_12830 6731 5562 gene locus_tag LOCUS_12840 gene sat 6731 5562 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_12840 7440 6748 gene locus_tag LOCUS_12850 7440 6748 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830661.1 protein_id gnl|my_center|LOCUS_12850 8119 7727 gene locus_tag LOCUS_12860 gene rpsI 8119 7727 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_12860 8577 8140 gene locus_tag LOCUS_12870 gene rplM 8577 8140 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_12870 9229 8891 gene locus_tag LOCUS_12880 9229 8891 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942213.1 protein_id gnl|my_center|LOCUS_12880 10101 9322 gene locus_tag LOCUS_12890 gene truA 10101 9322 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_12890 10596 10231 gene locus_tag LOCUS_12900 gene rplQ 10596 10231 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_12900 11581 10637 gene locus_tag LOCUS_12910 gene rpoA 11581 10637 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_12910 12107 11712 gene locus_tag LOCUS_12920 gene rpsK 12107 11712 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810114.1 protein_id gnl|my_center|LOCUS_12920 12495 12127 gene locus_tag LOCUS_12930 gene rpsM 12495 12127 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_12930 13042 12827 gene locus_tag LOCUS_12940 gene infA 13042 12827 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_12940 13350 13045 gene locus_tag LOCUS_12950 13350 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14115 13363 gene locus_tag LOCUS_12960 gene map 14115 13363 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_12960 14765 14121 gene locus_tag LOCUS_12970 14765 14121 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_12970 16164 14866 gene locus_tag LOCUS_12980 gene secY 16164 14866 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_12980 16604 16164 gene locus_tag LOCUS_12990 gene rplO 16604 16164 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_12990 16834 16655 gene locus_tag LOCUS_13000 gene rpmD 16834 16655 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_13000 17345 16848 gene locus_tag LOCUS_13010 gene rpsE 17345 16848 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_13010 17750 17373 gene locus_tag LOCUS_13020 gene rplR 17750 17373 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_13020 18363 17821 gene locus_tag LOCUS_13030 gene rplF 18363 17821 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_13030 18792 18394 gene locus_tag LOCUS_13040 gene rpsH 18792 18394 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_13040 19008 18823 gene locus_tag LOCUS_13050 gene rpsN 19008 18823 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_13050 19596 19054 gene locus_tag LOCUS_13060 gene rplE 19596 19054 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 protein_id gnl|my_center|LOCUS_13060 19982 19629 gene locus_tag LOCUS_13070 gene rplX 19982 19629 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_13070 20429 20061 gene locus_tag LOCUS_13080 gene rplN 20429 20061 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_13080 20728 20465 gene locus_tag LOCUS_13090 gene rpsQ 20728 20465 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_13090 20978 20778 gene locus_tag LOCUS_13100 gene rpmC 20978 20778 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_13100 21402 20968 gene locus_tag LOCUS_13110 gene rplP 21402 20968 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_13110 22070 21405 gene locus_tag LOCUS_13120 gene rpsC 22070 21405 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_13120 22416 22084 gene locus_tag LOCUS_13130 gene rplV 22416 22084 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_13130 22729 22451 gene locus_tag LOCUS_13140 gene rpsS 22729 22451 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124353.1 protein_id gnl|my_center|LOCUS_13140 23639 22809 gene locus_tag LOCUS_13150 gene rplB 23639 22809 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_13150 23958 23668 gene locus_tag LOCUS_13160 gene rplW 23958 23668 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205558.1 protein_id gnl|my_center|LOCUS_13160 24581 23958 gene locus_tag LOCUS_13170 gene rplD 24581 23958 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_13170 25231 24608 gene locus_tag LOCUS_13180 gene rplC 25231 24608 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_13180 25583 25275 gene locus_tag LOCUS_13190 gene rpsJ 25583 25275 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_13190 27199 26009 gene locus_tag LOCUS_13200 gene tuf 27199 26009 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_13200 29371 27293 gene locus_tag LOCUS_13210 gene fusA 29371 27293 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090370.1 protein_id gnl|my_center|LOCUS_13210 29891 29421 gene locus_tag LOCUS_13220 gene rpsG 29891 29421 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_13220 30361 29939 gene locus_tag LOCUS_13230 gene rpsL 30361 29939 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_13230 30755 30504 gene locus_tag LOCUS_13240 30755 30504 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_13240 34589 30981 gene locus_tag LOCUS_13250 gene rpoC 34589 30981 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567939.1 protein_id gnl|my_center|LOCUS_13250 38036 34629 gene locus_tag LOCUS_13260 gene rpoB 38036 34629 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_13260 39207 38608 gene locus_tag LOCUS_13270 39207 38608 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304012.1 protein_id gnl|my_center|LOCUS_13270 39674 39312 gene locus_tag LOCUS_13280 gene rplL 39674 39312 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_13280 40251 39742 gene locus_tag LOCUS_13290 gene rplJ 40251 39742 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_13290 41236 40544 gene locus_tag LOCUS_13300 gene rplA 41236 40544 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 protein_id gnl|my_center|LOCUS_13300 41799 41374 gene locus_tag LOCUS_13310 gene rplK 41799 41374 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_13310 42398 41865 gene locus_tag LOCUS_13320 gene nusG 42398 41865 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_13320 42613 42422 gene locus_tag LOCUS_13330 42613 42422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 42784 42635 gene locus_tag LOCUS_13340 gene rpmG 42784 42635 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_13340 43826 43179 gene locus_tag LOCUS_13350 gene sigH 43826 43179 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_13350 44507 43986 gene locus_tag LOCUS_13360 44507 43986 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997886.1 protein_id gnl|my_center|LOCUS_13360 45266 44514 gene locus_tag LOCUS_13370 gene rlmB 45266 44514 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_13370 45766 45299 gene locus_tag LOCUS_13380 45766 45299 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_13380 47097 45763 gene locus_tag LOCUS_13390 gene cysS 47097 45763 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152268.1 protein_id gnl|my_center|LOCUS_13390 47950 47258 gene locus_tag LOCUS_13400 gene cysE 47950 47258 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_13400 49835 48378 gene locus_tag LOCUS_13410 gene gltX 49835 48378 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_13410 50470 49985 gene locus_tag LOCUS_13420 gene ispF 50470 49985 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_13420 51168 50467 gene locus_tag LOCUS_13430 gene ispD 51168 50467 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_13430 52329 51244 gene locus_tag LOCUS_13440 52329 51244 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_13440 52518 52913 gene locus_tag LOCUS_13450 52518 52913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966463.1 protein_id gnl|my_center|LOCUS_13450 53737 53015 gene locus_tag LOCUS_13460 gene pssA 53737 53015 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285422.1 protein_id gnl|my_center|LOCUS_13460 54963 53887 gene locus_tag LOCUS_13470 gene disA 54963 53887 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392163.1 protein_id gnl|my_center|LOCUS_13470 56344 54977 gene locus_tag LOCUS_13480 gene radA 56344 54977 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_13480 58975 56531 gene locus_tag LOCUS_13490 gene clpC 58975 56531 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_13490 60092 59025 gene locus_tag LOCUS_13500 60092 59025 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_13500 60383 60108 gene locus_tag LOCUS_13510 60383 60108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 61121 60660 gene locus_tag LOCUS_13520 gene ctsR 61121 60660 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_13520 61572 61384 gene locus_tag LOCUS_13530 61572 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 61768 61656 gene locus_tag LOCUS_r00010 61768 61656 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence11 324 436 gene locus_tag LOCUS_r00020 324 436 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 682 1110 gene locus_tag LOCUS_13540 682 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1739 1215 gene locus_tag LOCUS_13550 1739 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1945 2196 gene locus_tag LOCUS_13560 1945 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2306 3901 gene locus_tag LOCUS_13570 2306 3901 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_13570 3898 4536 gene locus_tag LOCUS_13580 gene tmk 3898 4536 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677237.1 protein_id gnl|my_center|LOCUS_13580 4623 4952 gene locus_tag LOCUS_13590 4623 4952 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_13590 5088 5531 gene locus_tag LOCUS_13600 5088 5531 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_13600 5617 6609 gene locus_tag LOCUS_13610 gene holB 5617 6609 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930814.1 protein_id gnl|my_center|LOCUS_13610 6710 7510 gene locus_tag LOCUS_13620 6710 7510 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_13620 7590 7913 gene locus_tag LOCUS_13630 gene yabA 7590 7913 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412056.1 protein_id gnl|my_center|LOCUS_13630 7977 8726 gene locus_tag LOCUS_13640 7977 8726 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 protein_id gnl|my_center|LOCUS_13640 8723 9619 gene locus_tag LOCUS_13650 gene rsmI 8723 9619 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 protein_id gnl|my_center|LOCUS_13650 10014 9760 gene locus_tag LOCUS_13660 10014 9760 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_13660 10309 11592 gene locus_tag LOCUS_13670 10309 11592 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262734.1 protein_id gnl|my_center|LOCUS_13670 11609 12376 gene locus_tag LOCUS_13680 11609 12376 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_13680 13110 12919 gene locus_tag LOCUS_13690 13110 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 13081 14232 gene locus_tag LOCUS_13700 13081 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 14436 14981 gene locus_tag LOCUS_13710 gene rnmV 14436 14981 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_13710 14986 15873 gene locus_tag LOCUS_13720 gene rsmA 14986 15873 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_13720 15926 16846 gene locus_tag LOCUS_13730 gene yabG 15926 16846 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173738.1 protein_id gnl|my_center|LOCUS_13730 17028 17294 gene locus_tag LOCUS_13740 17028 17294 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_13740 17443 17622 gene locus_tag LOCUS_13750 gene sspF 17443 17622 CDS product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 protein_id gnl|my_center|LOCUS_13750 17763 18617 gene locus_tag LOCUS_13760 gene ispE 17763 18617 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_13760 18712 19551 gene locus_tag LOCUS_13770 gene purR 18712 19551 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_13770 19771 20007 gene locus_tag LOCUS_13780 19771 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 20137 21540 gene locus_tag LOCUS_13790 gene glmU 20137 21540 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_13790 21639 22592 gene locus_tag LOCUS_13800 21639 22592 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_13800 22834 22709 gene locus_tag LOCUS_13810 22834 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 23019 23579 gene locus_tag LOCUS_13820 gene pth 23019 23579 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_13820 23654 23884 gene locus_tag LOCUS_13830 23654 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 24085 27615 gene locus_tag LOCUS_13840 gene mfd 24085 27615 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_13840 27602 28741 gene locus_tag LOCUS_13850 27602 28741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 28942 29484 gene locus_tag LOCUS_13860 gene spoVT 28942 29484 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458938.1 protein_id gnl|my_center|LOCUS_13860 29657 31291 gene locus_tag LOCUS_13870 29657 31291 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387598.1 protein_id gnl|my_center|LOCUS_13870 31771 33273 gene locus_tag LOCUS_13880 gene mazG 31771 33273 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 protein_id gnl|my_center|LOCUS_13880 33502 33777 gene locus_tag LOCUS_13890 33502 33777 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658248.1 protein_id gnl|my_center|LOCUS_13890 33777 34055 gene locus_tag LOCUS_13900 33777 34055 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_13900 34226 34513 gene locus_tag LOCUS_13910 gene yabP 34226 34513 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_13910 34531 35076 gene locus_tag LOCUS_13920 34531 35076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 35102 35437 gene locus_tag LOCUS_13930 35102 35437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 35593 36078 gene locus_tag LOCUS_13940 35593 36078 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021452.1 protein_id gnl|my_center|LOCUS_13940 36481 38979 gene locus_tag LOCUS_13950 gene spoIIE 36481 38979 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_13950 39245 39988 gene locus_tag LOCUS_13960 39245 39988 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068698953.1 protein_id gnl|my_center|LOCUS_13960 39972 40904 gene locus_tag LOCUS_13970 39972 40904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 40970 42454 gene locus_tag LOCUS_13980 gene tilS 40970 42454 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_13980 42481 43020 gene locus_tag LOCUS_13990 42481 43020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13990 43123 45246 gene locus_tag LOCUS_14000 gene ftsH 43123 45246 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_14000 45508 46446 gene locus_tag LOCUS_14010 gene nadA 45508 46446 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_14010 46482 48092 gene locus_tag LOCUS_14020 gene nadB 46482 48092 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_14020 48089 48955 gene locus_tag LOCUS_14030 gene nadC 48089 48955 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_14030 48959 49726 gene locus_tag LOCUS_14040 48959 49726 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_14040 49820 50704 gene locus_tag LOCUS_14050 gene hslO 49820 50704 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656372.1 protein_id gnl|my_center|LOCUS_14050 51062 52000 gene locus_tag LOCUS_14060 gene cysK 51062 52000 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_14060 52292 53875 gene locus_tag LOCUS_14070 gene pabB 52292 53875 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_14070 53891 54484 gene locus_tag LOCUS_14080 gene pabA 53891 54484 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_14080 54481 55392 gene locus_tag LOCUS_14090 gene pabC 54481 55392 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 protein_id gnl|my_center|LOCUS_14090 55389 56225 gene locus_tag LOCUS_14100 gene folP 55389 56225 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_14100 56329 56691 gene locus_tag LOCUS_14110 gene folB 56329 56691 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358063.1 protein_id gnl|my_center|LOCUS_14110 56701 57258 gene locus_tag LOCUS_14120 gene folK 56701 57258 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 protein_id gnl|my_center|LOCUS_14120 57204 57419 gene locus_tag LOCUS_14130 57204 57419 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 protein_id gnl|my_center|LOCUS_14130 57448 58449 gene locus_tag LOCUS_14140 gene dusB 57448 58449 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_14140 58763 59239 gene locus_tag LOCUS_14150 gene greA 58763 59239 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_14150 59343 60863 gene locus_tag LOCUS_14160 gene lysS 59343 60863 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence12 1443 4154 gene locus_tag LOCUS_14170 gene mutS 1443 4154 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209880066.1 protein_id gnl|my_center|LOCUS_14170 4247 6376 gene locus_tag LOCUS_14180 4247 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6392 7174 gene locus_tag LOCUS_14190 6392 7174 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_14190 7164 8147 gene locus_tag LOCUS_14200 gene miaA 7164 8147 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504930.1 protein_id gnl|my_center|LOCUS_14200 8171 8404 gene locus_tag LOCUS_14210 gene hfq 8171 8404 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221097.1 protein_id gnl|my_center|LOCUS_14210 8534 11113 gene locus_tag LOCUS_14220 8534 11113 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 protein_id gnl|my_center|LOCUS_14220 11291 11884 gene locus_tag LOCUS_14230 11291 11884 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824656.1 protein_id gnl|my_center|LOCUS_14230 11947 12531 gene locus_tag LOCUS_14240 11947 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12625 13623 gene locus_tag LOCUS_14250 gene spoVK 12625 13623 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_14250 13666 14955 gene locus_tag LOCUS_14260 gene hflX 13666 14955 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_14260 15072 16325 gene locus_tag LOCUS_14270 15072 16325 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 protein_id gnl|my_center|LOCUS_14270 16415 16825 gene locus_tag LOCUS_14280 gene glnR 16415 16825 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656783.1 protein_id gnl|my_center|LOCUS_14280 16946 18274 gene locus_tag LOCUS_14290 gene glnA 16946 18274 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_14290 18491 19534 gene locus_tag LOCUS_14300 gene ffoR 18491 19534 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234643.1 protein_id gnl|my_center|LOCUS_14300 20498 19626 gene locus_tag LOCUS_14310 20498 19626 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_14310 21287 20763 gene locus_tag LOCUS_14320 gene lexA 21287 20763 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_14320 21589 21975 gene locus_tag LOCUS_14330 21589 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 22154 22330 gene locus_tag LOCUS_14340 22154 22330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 22372 22887 gene locus_tag LOCUS_14350 22372 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23033 23710 gene locus_tag LOCUS_14360 23033 23710 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_14360 23864 27301 gene locus_tag LOCUS_14370 gene metH 23864 27301 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_14370 27412 28335 gene locus_tag LOCUS_14380 gene rnz 27412 28335 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989857.1 protein_id gnl|my_center|LOCUS_14380 28629 29429 gene locus_tag LOCUS_14390 28629 29429 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816184.1 protein_id gnl|my_center|LOCUS_14390 29433 30248 gene locus_tag LOCUS_14400 gene mutM 29433 30248 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989743.1 protein_id gnl|my_center|LOCUS_14400 30238 31098 gene locus_tag LOCUS_14410 30238 31098 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865102.1 protein_id gnl|my_center|LOCUS_14410 31138 31482 gene locus_tag LOCUS_14420 31138 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 31534 32667 gene locus_tag LOCUS_14430 31534 32667 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134749050.1 protein_id gnl|my_center|LOCUS_14430 32848 34311 gene locus_tag LOCUS_14440 32848 34311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 34408 35274 gene locus_tag LOCUS_14450 34408 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 35333 36058 gene locus_tag LOCUS_14460 35333 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 36043 36870 gene locus_tag LOCUS_14470 36043 36870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36870 38678 gene locus_tag LOCUS_14480 36870 38678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 38683 40737 gene locus_tag LOCUS_14490 38683 40737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 40755 41240 gene locus_tag LOCUS_14500 40755 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 41247 41666 gene locus_tag LOCUS_14510 41247 41666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 41682 42230 gene locus_tag LOCUS_14520 41682 42230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 42217 43209 gene locus_tag LOCUS_14530 42217 43209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 43317 44006 gene locus_tag LOCUS_14540 43317 44006 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_14540 44723 44031 gene locus_tag LOCUS_14550 44723 44031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 45682 45038 gene locus_tag LOCUS_14560 45682 45038 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026234.1 protein_id gnl|my_center|LOCUS_14560 45904 46503 gene locus_tag LOCUS_14570 45904 46503 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 protein_id gnl|my_center|LOCUS_14570 47266 46538 gene locus_tag LOCUS_14580 47266 46538 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084007.1 protein_id gnl|my_center|LOCUS_14580 47518 48585 gene locus_tag LOCUS_14590 gene pdhA 47518 48585 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_14590 48726 49703 gene locus_tag LOCUS_14600 gene pdhB 48726 49703 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 protein_id gnl|my_center|LOCUS_14600 49734 51383 gene locus_tag LOCUS_14610 49734 51383 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989651.1 protein_id gnl|my_center|LOCUS_14610 51387 52808 gene locus_tag LOCUS_14620 gene lpdA 51387 52808 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_14620 53015 53809 gene locus_tag LOCUS_14630 gene thyA 53015 53809 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 protein_id gnl|my_center|LOCUS_14630 53824 54312 gene locus_tag LOCUS_14640 53824 54312 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723427.1 protein_id gnl|my_center|LOCUS_14640 54426 55919 gene locus_tag LOCUS_14650 gene gltD 54426 55919 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_14650 56115 58376 gene locus_tag LOCUS_14660 56115 58376 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_14660 58459 58998 gene locus_tag LOCUS_14670 58459 58998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 59864 59097 gene locus_tag LOCUS_14680 59864 59097 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626347.1 protein_id gnl|my_center|LOCUS_14680 60849 59920 gene locus_tag LOCUS_14690 60849 59920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 61025 62227 gene locus_tag LOCUS_14700 61025 62227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062798.1 protein_id gnl|my_center|LOCUS_14700 62318 63049 gene locus_tag LOCUS_14710 gene phnC 62318 63049 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091766764.1 protein_id gnl|my_center|LOCUS_14710 63046 64311 gene locus_tag LOCUS_14720 63046 64311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174803.1 protein_id gnl|my_center|LOCUS_14720 64340 65038 gene locus_tag LOCUS_14730 64340 65038 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_14730 65035 66441 gene locus_tag LOCUS_14740 65035 66441 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824532.1 protein_id gnl|my_center|LOCUS_14740 66460 66984 gene locus_tag LOCUS_14750 66460 66984 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721769.1 protein_id gnl|my_center|LOCUS_14750 68319 67099 gene locus_tag LOCUS_14760 gene glgC 68319 67099 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_14760 68518 70554 gene locus_tag LOCUS_14770 gene glgB 68518 70554 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272358.1 protein_id gnl|my_center|LOCUS_14770 70651 72108 gene locus_tag LOCUS_14780 gene glgA 70651 72108 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_14780 73956 72208 gene locus_tag LOCUS_14790 73956 72208 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_14790 74177 75040 gene locus_tag LOCUS_14800 74177 75040 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_14800 75148 75810 gene locus_tag LOCUS_14810 75148 75810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 75797 76519 gene locus_tag LOCUS_14820 75797 76519 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_14820 76813 77544 gene locus_tag LOCUS_14830 76813 77544 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 protein_id gnl|my_center|LOCUS_14830 78426 77614 gene locus_tag LOCUS_14840 78426 77614 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291185.1 protein_id gnl|my_center|LOCUS_14840 78581 79282 gene locus_tag LOCUS_14850 78581 79282 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_14850 79275 80207 gene locus_tag LOCUS_14860 79275 80207 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_14860 80208 80540 gene locus_tag LOCUS_14870 80208 80540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 80852 82123 gene locus_tag LOCUS_14880 gene moeA 80852 82123 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229690.1 protein_id gnl|my_center|LOCUS_14880 82148 82678 gene locus_tag LOCUS_14890 82148 82678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 83765 82683 gene locus_tag LOCUS_14900 gene xerS 83765 82683 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703247.1 protein_id gnl|my_center|LOCUS_14900 83847 84128 gene locus_tag LOCUS_14910 83847 84128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 84107 84346 gene locus_tag LOCUS_14920 84107 84346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 84507 85226 gene locus_tag LOCUS_14930 84507 85226 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 protein_id gnl|my_center|LOCUS_14930 85764 87278 gene locus_tag LOCUS_14940 85764 87278 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393525.1 protein_id gnl|my_center|LOCUS_14940 87544 88428 gene locus_tag LOCUS_14950 87544 88428 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986610.1 protein_id gnl|my_center|LOCUS_14950 89272 88454 gene locus_tag LOCUS_14960 89272 88454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14960 89394 89576 gene locus_tag LOCUS_14970 89394 89576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 89872 90351 gene locus_tag LOCUS_14980 89872 90351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 90414 90689 gene locus_tag LOCUS_14990 90414 90689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 90996 90820 gene locus_tag LOCUS_15000 90996 90820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 91150 92211 gene locus_tag LOCUS_15010 gene cysP 91150 92211 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 protein_id gnl|my_center|LOCUS_15010 92455 93222 gene locus_tag LOCUS_15020 92455 93222 CDS product DUF3891 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577271.1 protein_id gnl|my_center|LOCUS_15020 93278 94189 gene locus_tag LOCUS_15030 93278 94189 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_15030 94221 95327 gene locus_tag LOCUS_15040 94221 95327 CDS product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 protein_id gnl|my_center|LOCUS_15040 96476 95547 gene locus_tag LOCUS_15050 96476 95547 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_15050 97250 97879 gene locus_tag LOCUS_15060 97250 97879 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597156.1 protein_id gnl|my_center|LOCUS_15060 97965 99260 gene locus_tag LOCUS_15070 97965 99260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 99436 99624 gene locus_tag LOCUS_15080 99436 99624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 99824 100234 gene locus_tag LOCUS_15090 99824 100234 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775211.1 protein_id gnl|my_center|LOCUS_15090 101649 100324 gene locus_tag LOCUS_15100 101649 100324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 101860 103233 gene locus_tag LOCUS_15110 101860 103233 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732087.1 protein_id gnl|my_center|LOCUS_15110 103252 105312 gene locus_tag LOCUS_15120 103252 105312 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040120974.1 protein_id gnl|my_center|LOCUS_15120 106421 105414 gene locus_tag LOCUS_15130 gene yclQ 106421 105414 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_15130 107340 106582 gene locus_tag LOCUS_15140 gene yclP 107340 106582 CDS product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 protein_id gnl|my_center|LOCUS_15140 108299 107337 gene locus_tag LOCUS_15150 gene yclO 108299 107337 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_15150 109249 108296 gene locus_tag LOCUS_15160 gene yclN 109249 108296 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_15160 110450 111076 gene locus_tag LOCUS_15170 110450 111076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 111235 117963 gene locus_tag LOCUS_15180 111235 117963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15180 117960 119672 gene locus_tag LOCUS_15190 117960 119672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15190 119665 119844 gene locus_tag LOCUS_15200 119665 119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 121100 119940 gene locus_tag LOCUS_15210 121100 119940 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 protein_id gnl|my_center|LOCUS_15210 122059 121358 gene locus_tag LOCUS_15220 122059 121358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15220 123294 122044 gene locus_tag LOCUS_15230 123294 122044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15230 123451 124341 gene locus_tag LOCUS_15240 123451 124341 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202094.1 protein_id gnl|my_center|LOCUS_15240 131944 124493 gene locus_tag LOCUS_15250 131944 124493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 133641 132382 gene locus_tag LOCUS_15260 gene aldO 133641 132382 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_15260 133809 134204 gene locus_tag LOCUS_15270 133809 134204 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 protein_id gnl|my_center|LOCUS_15270 136856 134241 gene locus_tag LOCUS_15280 gene ppsA 136856 134241 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 protein_id gnl|my_center|LOCUS_15280 137923 137066 gene locus_tag LOCUS_15290 137923 137066 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_15290 138946 137966 gene locus_tag LOCUS_15300 138946 137966 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_15300 139823 138981 gene locus_tag LOCUS_15310 139823 138981 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_15310 140595 139837 gene locus_tag LOCUS_15320 140595 139837 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_15320 140824 141408 gene locus_tag LOCUS_15330 140824 141408 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_15330 141499 141648 gene locus_tag LOCUS_15340 141499 141648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 142449 142036 gene locus_tag LOCUS_15350 142449 142036 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 protein_id gnl|my_center|LOCUS_15350 143345 142482 gene locus_tag LOCUS_15360 143345 142482 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_15360 143605 144168 gene locus_tag LOCUS_15370 143605 144168 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_15370 144746 144165 gene locus_tag LOCUS_15380 144746 144165 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_15380 145459 145034 gene locus_tag LOCUS_15390 145459 145034 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_15390 146907 145498 gene locus_tag LOCUS_15400 146907 145498 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_15400 147192 147680 gene locus_tag LOCUS_15410 147192 147680 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963865.1 protein_id gnl|my_center|LOCUS_15410 147986 147786 gene locus_tag LOCUS_15420 147986 147786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 149392 147983 gene locus_tag LOCUS_15430 149392 147983 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822542.1 protein_id gnl|my_center|LOCUS_15430 150095 149385 gene locus_tag LOCUS_15440 150095 149385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_15440 150375 150175 gene locus_tag LOCUS_15450 150375 150175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 151105 150515 gene locus_tag LOCUS_15460 151105 150515 CDS product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 protein_id gnl|my_center|LOCUS_15460 152044 151301 gene locus_tag LOCUS_15470 152044 151301 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_15470 152452 152213 gene locus_tag LOCUS_15480 152452 152213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 154896 152596 gene locus_tag LOCUS_15490 154896 152596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 155921 154893 gene locus_tag LOCUS_15500 155921 154893 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_15500 156168 157856 gene locus_tag LOCUS_15510 gene hcp 156168 157856 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_15510 157926 158153 gene locus_tag LOCUS_15520 157926 158153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 159382 158294 gene locus_tag LOCUS_15530 159382 158294 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_15530 160486 159518 gene locus_tag LOCUS_15540 gene yjfF 160486 159518 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_15540 161516 160476 gene locus_tag LOCUS_15550 161516 160476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_15550 163033 161522 gene locus_tag LOCUS_15560 163033 161522 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_15560 164140 163106 gene locus_tag LOCUS_15570 164140 163106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_15570 164413 166224 gene locus_tag LOCUS_15580 164413 166224 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_15580 166221 167813 gene locus_tag LOCUS_15590 166221 167813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 167814 168782 gene locus_tag LOCUS_15600 167814 168782 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_15600 169096 168923 gene locus_tag LOCUS_15610 169096 168923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 169780 169127 gene locus_tag LOCUS_15620 169780 169127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 169973 171106 gene locus_tag LOCUS_15630 169973 171106 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 protein_id gnl|my_center|LOCUS_15630 172062 171241 gene locus_tag LOCUS_15640 172062 171241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 172562 172062 gene locus_tag LOCUS_15650 172562 172062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 173103 172567 gene locus_tag LOCUS_15660 173103 172567 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_15660 174406 173114 gene locus_tag LOCUS_15670 174406 173114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 175010 174558 gene locus_tag LOCUS_15680 175010 174558 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 protein_id gnl|my_center|LOCUS_15680 175662 175075 gene locus_tag LOCUS_15690 175662 175075 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010584.1 protein_id gnl|my_center|LOCUS_15690 176292 175828 gene locus_tag LOCUS_15700 176292 175828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 protein_id gnl|my_center|LOCUS_15700 176796 176317 gene locus_tag LOCUS_15710 176796 176317 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801042.1 protein_id gnl|my_center|LOCUS_15710 176908 177861 gene locus_tag LOCUS_15720 176908 177861 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_15720 179256 178048 gene locus_tag LOCUS_15730 179256 178048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_15730 179482 180876 gene locus_tag LOCUS_15740 179482 180876 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_15740 180883 181815 gene locus_tag LOCUS_15750 180883 181815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 182263 181946 gene locus_tag LOCUS_15760 182263 181946 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_15760 183297 182398 gene locus_tag LOCUS_15770 183297 182398 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_15770 183975 183379 gene locus_tag LOCUS_15780 183975 183379 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 protein_id gnl|my_center|LOCUS_15780 184742 184017 gene locus_tag LOCUS_15790 184742 184017 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368890.1 protein_id gnl|my_center|LOCUS_15790 186274 184784 gene locus_tag LOCUS_15800 186274 184784 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_15800 186511 187326 gene locus_tag LOCUS_15810 186511 187326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 188021 187500 gene locus_tag LOCUS_15820 188021 187500 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_15820 188477 188893 gene locus_tag LOCUS_15830 188477 188893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 188890 190182 gene locus_tag LOCUS_15840 188890 190182 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_15840 191372 190296 gene locus_tag LOCUS_15850 191372 190296 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_15850 191499 192416 gene locus_tag LOCUS_15860 gene bsdA 191499 192416 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_15860 192870 192508 gene locus_tag LOCUS_15870 192870 192508 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_15870 194666 193026 gene locus_tag LOCUS_15880 194666 193026 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_15880 196297 195002 gene locus_tag LOCUS_15890 196297 195002 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_15890 197347 196469 gene locus_tag LOCUS_15900 197347 196469 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_15900 197464 198654 gene locus_tag LOCUS_15910 197464 198654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243939.1 protein_id gnl|my_center|LOCUS_15910 198837 200717 gene locus_tag LOCUS_15920 198837 200717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 201023 200796 gene locus_tag LOCUS_15930 201023 200796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 202224 201013 gene locus_tag LOCUS_15940 gene yedE 202224 201013 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 protein_id gnl|my_center|LOCUS_15940 203142 202468 gene locus_tag LOCUS_15950 203142 202468 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_15950 205990 203210 gene locus_tag LOCUS_15960 205990 203210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 206221 206069 gene locus_tag LOCUS_15970 206221 206069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 206283 207365 gene locus_tag LOCUS_15980 206283 207365 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_15980 207575 208327 gene locus_tag LOCUS_15990 207575 208327 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582876.1 protein_id gnl|my_center|LOCUS_15990 209069 208398 gene locus_tag LOCUS_16000 209069 208398 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 protein_id gnl|my_center|LOCUS_16000 209269 209958 gene locus_tag LOCUS_16010 209269 209958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 210120 211616 gene locus_tag LOCUS_16020 210120 211616 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_16020 212067 211699 gene locus_tag LOCUS_16030 212067 211699 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_16030 212394 212092 gene locus_tag LOCUS_16040 212394 212092 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529933.1 protein_id gnl|my_center|LOCUS_16040 213373 212483 gene locus_tag LOCUS_16050 213373 212483 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_16050 215184 213604 gene locus_tag LOCUS_16060 215184 213604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 216310 215417 gene locus_tag LOCUS_16070 gene lipM 216310 215417 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_16070 217219 216326 gene locus_tag LOCUS_16080 gene lipA 217219 216326 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_16080 218344 217478 gene locus_tag LOCUS_16090 218344 217478 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 protein_id gnl|my_center|LOCUS_16090 218551 219564 gene locus_tag LOCUS_16100 218551 219564 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_16100 219598 220656 gene locus_tag LOCUS_16110 219598 220656 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_16110 221677 220787 gene locus_tag LOCUS_16120 221677 220787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 222207 221866 gene locus_tag LOCUS_16130 222207 221866 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289570.1 protein_id gnl|my_center|LOCUS_16130 222670 222359 gene locus_tag LOCUS_16140 gene nirD 222670 222359 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_16140 225096 222676 gene locus_tag LOCUS_16150 gene nirB 225096 222676 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485232.1 protein_id gnl|my_center|LOCUS_16150 225955 225308 gene locus_tag LOCUS_16160 gene nreC 225955 225308 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_16160 227033 225975 gene locus_tag LOCUS_16170 gene nreB 227033 225975 CDS product nitrate respiration regulation sensor histidine kinase NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606546.1 protein_id gnl|my_center|LOCUS_16170 227485 227030 gene locus_tag LOCUS_16180 gene nreA 227485 227030 CDS product nitrate respiration regulation accessory nitrate sensor NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831592.1 protein_id gnl|my_center|LOCUS_16180 228139 227711 gene locus_tag LOCUS_16190 228139 227711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 229403 228273 gene locus_tag LOCUS_16200 229403 228273 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 protein_id gnl|my_center|LOCUS_16200 230074 229472 gene locus_tag LOCUS_16210 230074 229472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101468.1 protein_id gnl|my_center|LOCUS_16210 230344 231840 gene locus_tag LOCUS_16220 gene mdrT 230344 231840 CDS product cholic acid efflux MFS transporter MdrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733258.1 protein_id gnl|my_center|LOCUS_16220 233375 231912 gene locus_tag LOCUS_16230 233375 231912 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_16230 235356 233455 gene locus_tag LOCUS_16240 235356 233455 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964716.1 protein_id gnl|my_center|LOCUS_16240 236370 235531 gene locus_tag LOCUS_16250 236370 235531 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964715.1 protein_id gnl|my_center|LOCUS_16250 237786 236674 gene locus_tag LOCUS_16260 237786 236674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 238798 238643 gene locus_tag LOCUS_16270 238798 238643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 240082 239072 gene locus_tag LOCUS_16280 240082 239072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 240936 240274 gene locus_tag LOCUS_16290 240936 240274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573662.1 protein_id gnl|my_center|LOCUS_16290 243253 240977 gene locus_tag LOCUS_16300 243253 240977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 245054 243348 gene locus_tag LOCUS_16310 245054 243348 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_16310 245230 246090 gene locus_tag LOCUS_16320 245230 246090 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_16320 247672 246161 gene locus_tag LOCUS_16330 247672 246161 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_16330 247929 248660 gene locus_tag LOCUS_16340 247929 248660 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068586618.1 protein_id gnl|my_center|LOCUS_16340 248651 248968 gene locus_tag LOCUS_16350 248651 248968 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425954.1 protein_id gnl|my_center|LOCUS_16350 250997 249072 gene locus_tag LOCUS_16360 250997 249072 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_16360 250897 251211 gene locus_tag LOCUS_16370 250897 251211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 251888 251208 gene locus_tag LOCUS_16380 251888 251208 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_16380 252625 251885 gene locus_tag LOCUS_16390 252625 251885 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_16390 254146 252872 gene locus_tag LOCUS_16400 254146 252872 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_16400 254823 254146 gene locus_tag LOCUS_16410 254823 254146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_16410 255091 256116 gene locus_tag LOCUS_16420 255091 256116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 256180 256725 gene locus_tag LOCUS_16430 256180 256725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 256727 257407 gene locus_tag LOCUS_16440 gene pspA 256727 257407 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_16440 259359 257491 gene locus_tag LOCUS_16450 259359 257491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_16450 261091 259346 gene locus_tag LOCUS_16460 261091 259346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_16460 261598 261113 gene locus_tag LOCUS_16470 261598 261113 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_16470 262013 261585 gene locus_tag LOCUS_16480 262013 261585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 262294 262851 gene locus_tag LOCUS_16490 262294 262851 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966972.1 protein_id gnl|my_center|LOCUS_16490 264200 262920 gene locus_tag LOCUS_16500 264200 262920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_16500 265473 264364 gene locus_tag LOCUS_16510 265473 264364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 266564 265470 gene locus_tag LOCUS_16520 266564 265470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 267939 266557 gene locus_tag LOCUS_16530 267939 266557 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_16530 268277 268095 gene locus_tag LOCUS_16540 268277 268095 CDS product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 protein_id gnl|my_center|LOCUS_16540 268983 268348 gene locus_tag LOCUS_16550 gene azoRB 268983 268348 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_16550 270208 269021 gene locus_tag LOCUS_16560 gene alr 270208 269021 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 protein_id gnl|my_center|LOCUS_16560 270459 270809 gene locus_tag LOCUS_16570 270459 270809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16570 270870 271862 gene locus_tag LOCUS_16580 270870 271862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16580 272856 271942 gene locus_tag LOCUS_16590 272856 271942 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690435.1 protein_id gnl|my_center|LOCUS_16590 274390 272930 gene locus_tag LOCUS_16600 274390 272930 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471646.1 protein_id gnl|my_center|LOCUS_16600 275286 274489 gene locus_tag LOCUS_16610 275286 274489 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_16610 276179 275445 gene locus_tag LOCUS_16620 276179 275445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 277420 276530 gene locus_tag LOCUS_16630 gene murB 277420 276530 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057087.1 protein_id gnl|my_center|LOCUS_16630 278489 277566 gene locus_tag LOCUS_16640 gene cysK 278489 277566 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762272.1 protein_id gnl|my_center|LOCUS_16640 280055 278688 gene locus_tag LOCUS_16650 280055 278688 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_16650 280850 280197 gene locus_tag LOCUS_16660 280850 280197 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966965.1 protein_id gnl|my_center|LOCUS_16660 281058 281576 gene locus_tag LOCUS_16670 281058 281576 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600589.1 protein_id gnl|my_center|LOCUS_16670 282908 281598 gene locus_tag LOCUS_16680 282908 281598 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_16680 283050 283364 gene locus_tag LOCUS_16690 283050 283364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 283892 283437 gene locus_tag LOCUS_16700 283892 283437 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_16700 284903 283926 gene locus_tag LOCUS_16710 284903 283926 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273903.1 protein_id gnl|my_center|LOCUS_16710 286559 285117 gene locus_tag LOCUS_16720 gene bglC 286559 285117 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246242.1 protein_id gnl|my_center|LOCUS_16720 286847 288196 gene locus_tag LOCUS_16730 286847 288196 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228313.1 protein_id gnl|my_center|LOCUS_16730 289800 288283 gene locus_tag LOCUS_16740 289800 288283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 290399 289914 gene locus_tag LOCUS_16750 290399 289914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 291076 290399 gene locus_tag LOCUS_16760 291076 290399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16760 291530 293257 gene locus_tag LOCUS_16770 291530 293257 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583934.1 protein_id gnl|my_center|LOCUS_16770 294110 293397 gene locus_tag LOCUS_16780 294110 293397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_16780 295974 294349 gene locus_tag LOCUS_16790 295974 294349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 297953 296289 gene locus_tag LOCUS_16800 297953 296289 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_16800 301526 298392 gene locus_tag LOCUS_16810 301526 298392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 303390 301717 gene locus_tag LOCUS_16820 303390 301717 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838584.1 protein_id gnl|my_center|LOCUS_16820 303626 304249 gene locus_tag LOCUS_16830 303626 304249 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 protein_id gnl|my_center|LOCUS_16830 305809 304292 gene locus_tag LOCUS_16840 305809 304292 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128216.1 protein_id gnl|my_center|LOCUS_16840 306033 306806 gene locus_tag LOCUS_16850 306033 306806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 307266 306790 gene locus_tag LOCUS_16860 307266 306790 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966218.1 protein_id gnl|my_center|LOCUS_16860 307806 307330 gene locus_tag LOCUS_16870 307806 307330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887755.1 protein_id gnl|my_center|LOCUS_16870 308519 307803 gene locus_tag LOCUS_16880 308519 307803 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431597.1 protein_id gnl|my_center|LOCUS_16880 309005 308544 gene locus_tag LOCUS_16890 309005 308544 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_16890 310226 309159 gene locus_tag LOCUS_16900 310226 309159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 310790 310467 gene locus_tag LOCUS_16910 gene hmoA 310790 310467 CDS product heme-degrading oxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243958.1 protein_id gnl|my_center|LOCUS_16910 311661 310804 gene locus_tag LOCUS_16920 gene besA 311661 310804 CDS product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 protein_id gnl|my_center|LOCUS_16920 312782 311727 gene locus_tag LOCUS_16930 312782 311727 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920462.1 protein_id gnl|my_center|LOCUS_16930 313791 312772 gene locus_tag LOCUS_16940 313791 312772 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173074.1 protein_id gnl|my_center|LOCUS_16940 314623 313817 gene locus_tag LOCUS_16950 gene feuA 314623 313817 CDS product iron ABC transporter substrate-binding protein FeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234978.1 protein_id gnl|my_center|LOCUS_16950 314691 314900 gene locus_tag LOCUS_16960 314691 314900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 316599 314968 gene locus_tag LOCUS_16970 gene btr 316599 314968 CDS product bacillibactin transport transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234977.1 protein_id gnl|my_center|LOCUS_16970 318018 316804 gene locus_tag LOCUS_16980 318018 316804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 318247 318843 gene locus_tag LOCUS_16990 318247 318843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 319841 318885 gene locus_tag LOCUS_17000 319841 318885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 320716 319862 gene locus_tag LOCUS_17010 320716 319862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17010 321588 320923 gene locus_tag LOCUS_17020 gene fsa 321588 320923 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210267.1 protein_id gnl|my_center|LOCUS_17020 322516 321842 gene locus_tag LOCUS_17030 322516 321842 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_17030 323645 322707 gene locus_tag LOCUS_17040 323645 322707 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_17040 323803 324147 gene locus_tag LOCUS_17050 323803 324147 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_17050 325498 324230 gene locus_tag LOCUS_17060 325498 324230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 326600 325692 gene locus_tag LOCUS_17070 326600 325692 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 protein_id gnl|my_center|LOCUS_17070 327314 326667 gene locus_tag LOCUS_17080 327314 326667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 328642 327503 gene locus_tag LOCUS_17090 328642 327503 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649088.1 protein_id gnl|my_center|LOCUS_17090 329214 328747 gene locus_tag LOCUS_17100 329214 328747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 330402 329320 gene locus_tag LOCUS_17110 330402 329320 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_17110 330718 330449 gene locus_tag LOCUS_17120 330718 330449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 333548 330720 gene locus_tag LOCUS_17130 333548 330720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084970.1 protein_id gnl|my_center|LOCUS_17130 333716 334261 gene locus_tag LOCUS_17140 333716 334261 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287456.1 protein_id gnl|my_center|LOCUS_17140 334332 335564 gene locus_tag LOCUS_17150 334332 335564 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 protein_id gnl|my_center|LOCUS_17150 336904 335669 gene locus_tag LOCUS_17160 336904 335669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_17160 337063 337650 gene locus_tag LOCUS_17170 337063 337650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 339235 337916 gene locus_tag LOCUS_17180 339235 337916 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 protein_id gnl|my_center|LOCUS_17180 339944 339516 gene locus_tag LOCUS_17190 339944 339516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 340439 340017 gene locus_tag LOCUS_17200 gene cwlJ 340439 340017 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 protein_id gnl|my_center|LOCUS_17200 340680 341264 gene locus_tag LOCUS_17210 340680 341264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 341833 341375 gene locus_tag LOCUS_17220 341833 341375 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815091.1 protein_id gnl|my_center|LOCUS_17220 342085 343560 gene locus_tag LOCUS_17230 342085 343560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100971.1 protein_id gnl|my_center|LOCUS_17230 344214 343696 gene locus_tag LOCUS_17240 gene tpx 344214 343696 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_17240 344463 345014 gene locus_tag LOCUS_17250 344463 345014 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642469.1 protein_id gnl|my_center|LOCUS_17250 345156 345935 gene locus_tag LOCUS_17260 345156 345935 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 protein_id gnl|my_center|LOCUS_17260 346014 346772 gene locus_tag LOCUS_17270 346014 346772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 348618 346894 gene locus_tag LOCUS_17280 gene cysI 348618 346894 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_17280 350506 348668 gene locus_tag LOCUS_17290 350506 348668 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_17290 350804 352663 gene locus_tag LOCUS_17300 gene ltaP 350804 352663 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_17300 352969 354198 gene locus_tag LOCUS_17310 352969 354198 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832093.1 protein_id gnl|my_center|LOCUS_17310 355423 354302 gene locus_tag LOCUS_17320 355423 354302 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_17320 357108 355507 gene locus_tag LOCUS_17330 357108 355507 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 protein_id gnl|my_center|LOCUS_17330 357325 358680 gene locus_tag LOCUS_17340 357325 358680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286788.1 protein_id gnl|my_center|LOCUS_17340 358713 359648 gene locus_tag LOCUS_17350 358713 359648 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_17350 359648 360562 gene locus_tag LOCUS_17360 359648 360562 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_17360 362179 360701 gene locus_tag LOCUS_17370 362179 360701 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_17370 363445 362198 gene locus_tag LOCUS_17380 363445 362198 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_17380 363581 364423 gene locus_tag LOCUS_17390 363581 364423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 364984 364454 gene locus_tag LOCUS_17400 gene thpR 364984 364454 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418986.1 protein_id gnl|my_center|LOCUS_17400 366408 365287 gene locus_tag LOCUS_17410 gene thiO 366408 365287 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_17410 367266 366436 gene locus_tag LOCUS_17420 gene thiG 367266 366436 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 protein_id gnl|my_center|LOCUS_17420 367467 367270 gene locus_tag LOCUS_17430 367467 367270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 368093 367458 gene locus_tag LOCUS_17440 gene thiE 368093 367458 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_17440 369245 368235 gene locus_tag LOCUS_17450 369245 368235 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840950.1 protein_id gnl|my_center|LOCUS_17450 370146 369253 gene locus_tag LOCUS_17460 370146 369253 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670421.1 protein_id gnl|my_center|LOCUS_17460 371069 370314 gene locus_tag LOCUS_17470 371069 370314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080857.1 protein_id gnl|my_center|LOCUS_17470 371941 371066 gene locus_tag LOCUS_17480 371941 371066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_17480 373393 372272 gene locus_tag LOCUS_17490 373393 372272 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_17490 374005 373526 gene locus_tag LOCUS_17500 374005 373526 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105559683.1 protein_id gnl|my_center|LOCUS_17500 375584 374103 gene locus_tag LOCUS_17510 375584 374103 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405420.1 protein_id gnl|my_center|LOCUS_17510 375889 375680 gene locus_tag LOCUS_17520 375889 375680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 378054 376150 gene locus_tag LOCUS_17530 gene ltaP 378054 376150 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_17530 379239 378289 gene locus_tag LOCUS_17540 379239 378289 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 protein_id gnl|my_center|LOCUS_17540 380162 379236 gene locus_tag LOCUS_17550 380162 379236 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_17550 380314 380889 gene locus_tag LOCUS_17560 380314 380889 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 protein_id gnl|my_center|LOCUS_17560 382239 380989 gene locus_tag LOCUS_17570 382239 380989 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757481.1 protein_id gnl|my_center|LOCUS_17570 382715 382299 gene locus_tag LOCUS_17580 382715 382299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 382935 384284 gene locus_tag LOCUS_17590 gene nagZ 382935 384284 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_17590 384753 384352 gene locus_tag LOCUS_17600 384753 384352 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246356.1 protein_id gnl|my_center|LOCUS_17600 384983 386059 gene locus_tag LOCUS_17610 384983 386059 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804212.1 protein_id gnl|my_center|LOCUS_17610 386076 387008 gene locus_tag LOCUS_17620 386076 387008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 387055 388437 gene locus_tag LOCUS_17630 387055 388437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 388421 389386 gene locus_tag LOCUS_17640 388421 389386 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 protein_id gnl|my_center|LOCUS_17640 389604 389422 gene locus_tag LOCUS_17650 389604 389422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 390025 391257 gene locus_tag LOCUS_17660 390025 391257 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_17660 391290 395747 gene locus_tag LOCUS_17670 391290 395747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 396614 395841 gene locus_tag LOCUS_17680 gene murI 396614 395841 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_17680 397299 396640 gene locus_tag LOCUS_17690 397299 396640 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 protein_id gnl|my_center|LOCUS_17690 399288 397564 gene locus_tag LOCUS_17700 gene poxB 399288 397564 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211361.1 protein_id gnl|my_center|LOCUS_17700 400062 399358 gene locus_tag LOCUS_17710 400062 399358 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875893.1 protein_id gnl|my_center|LOCUS_17710 400629 400141 gene locus_tag LOCUS_17720 400629 400141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 401272 400658 gene locus_tag LOCUS_17730 401272 400658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 401855 401385 gene locus_tag LOCUS_17740 401855 401385 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_17740 402728 401964 gene locus_tag LOCUS_17750 402728 401964 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_17750 404433 403423 gene locus_tag LOCUS_17760 gene spoVAD 404433 403423 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938965.1 protein_id gnl|my_center|LOCUS_17760 404956 404486 gene locus_tag LOCUS_17770 gene spoVAC 404956 404486 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 protein_id gnl|my_center|LOCUS_17770 405830 404970 gene locus_tag LOCUS_17780 405830 404970 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 protein_id gnl|my_center|LOCUS_17780 406000 406206 gene locus_tag LOCUS_17790 406000 406206 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 protein_id gnl|my_center|LOCUS_17790 407242 406298 gene locus_tag LOCUS_17800 gene glsA 407242 406298 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_17800 407705 407235 gene locus_tag LOCUS_17810 407705 407235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 408294 407728 gene locus_tag LOCUS_17820 408294 407728 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109179.1 protein_id gnl|my_center|LOCUS_17820 408772 408326 gene locus_tag LOCUS_17830 408772 408326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 409264 408800 gene locus_tag LOCUS_17840 409264 408800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223866.1 protein_id gnl|my_center|LOCUS_17840 410286 409414 gene locus_tag LOCUS_17850 410286 409414 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 protein_id gnl|my_center|LOCUS_17850 410815 410396 gene locus_tag LOCUS_17860 410815 410396 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_17860 411669 411043 gene locus_tag LOCUS_17870 411669 411043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 412173 411697 gene locus_tag LOCUS_17880 412173 411697 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704309.1 protein_id gnl|my_center|LOCUS_17880 412443 412252 gene locus_tag LOCUS_17890 412443 412252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 412995 412456 gene locus_tag LOCUS_17900 412995 412456 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_17900 413514 413197 gene locus_tag LOCUS_17910 413514 413197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 414267 413686 gene locus_tag LOCUS_17920 414267 413686 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_17920 414711 414526 gene locus_tag LOCUS_17930 414711 414526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17930 415353 414832 gene locus_tag LOCUS_17940 415353 414832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424650.1 protein_id gnl|my_center|LOCUS_17940 416121 415651 gene locus_tag LOCUS_17950 416121 415651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_17950 416559 416203 gene locus_tag LOCUS_17960 416559 416203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 417770 417219 gene locus_tag LOCUS_17970 417770 417219 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_17970 418284 417925 gene locus_tag LOCUS_17980 418284 417925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 419281 418736 gene locus_tag LOCUS_17990 419281 418736 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_17990 420494 420195 gene locus_tag LOCUS_18000 420494 420195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 421523 421029 gene locus_tag LOCUS_18010 421523 421029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 422527 421682 gene locus_tag LOCUS_18020 422527 421682 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986969.1 protein_id gnl|my_center|LOCUS_18020 422721 423293 gene locus_tag LOCUS_18030 422721 423293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 423460 423290 gene locus_tag LOCUS_18040 423460 423290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 424408 423560 gene locus_tag LOCUS_18050 424408 423560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 425002 424577 gene locus_tag LOCUS_18060 425002 424577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 425110 425832 gene locus_tag LOCUS_18070 425110 425832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 427059 426163 gene locus_tag LOCUS_18080 gene galU 427059 426163 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 protein_id gnl|my_center|LOCUS_18080 428100 427117 gene locus_tag LOCUS_18090 428100 427117 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_18090 430358 428106 gene locus_tag LOCUS_18100 430358 428106 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245387.1 protein_id gnl|my_center|LOCUS_18100 430632 431312 gene locus_tag LOCUS_18110 430632 431312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807742.1 protein_id gnl|my_center|LOCUS_18110 431309 433081 gene locus_tag LOCUS_18120 431309 433081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 434153 433260 gene locus_tag LOCUS_18130 gene gnd 434153 433260 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195924.1 protein_id gnl|my_center|LOCUS_18130 435689 434238 gene locus_tag LOCUS_18140 gene zwf 435689 434238 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445335.1 protein_id gnl|my_center|LOCUS_18140 435984 437078 gene locus_tag LOCUS_18150 435984 437078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 438101 437148 gene locus_tag LOCUS_18160 438101 437148 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_18160 439021 438185 gene locus_tag LOCUS_18170 gene znuB 439021 438185 CDS product zinc ABC transporter permease ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246340.1 protein_id gnl|my_center|LOCUS_18170 439674 438964 gene locus_tag LOCUS_18180 gene znuC 439674 438964 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234730.1 protein_id gnl|my_center|LOCUS_18180 440530 440105 gene locus_tag LOCUS_18190 440530 440105 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_18190 440712 441944 gene locus_tag LOCUS_18200 gene ytvI 440712 441944 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_18200 443153 442056 gene locus_tag LOCUS_18210 gene rpoD 443153 442056 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_18210 445852 443654 gene locus_tag LOCUS_18220 445852 443654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 447329 446007 gene locus_tag LOCUS_18230 447329 446007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399402.1 protein_id gnl|my_center|LOCUS_18230 449209 447512 gene locus_tag LOCUS_18240 449209 447512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 451035 449212 gene locus_tag LOCUS_18250 451035 449212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 451209 452096 gene locus_tag LOCUS_18260 451209 452096 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836858.1 protein_id gnl|my_center|LOCUS_18260 452096 452926 gene locus_tag LOCUS_18270 452096 452926 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_18270 454444 453080 gene locus_tag LOCUS_18280 454444 453080 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 protein_id gnl|my_center|LOCUS_18280 454611 455684 gene locus_tag LOCUS_18290 454611 455684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_18290 456760 455798 gene locus_tag LOCUS_18300 456760 455798 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 protein_id gnl|my_center|LOCUS_18300 458754 456799 gene locus_tag LOCUS_18310 458754 456799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 459659 459054 gene locus_tag LOCUS_18320 459659 459054 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641140.1 protein_id gnl|my_center|LOCUS_18320 459846 461300 gene locus_tag LOCUS_18330 459846 461300 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121215506.1 protein_id gnl|my_center|LOCUS_18330 463432 461393 gene locus_tag LOCUS_18340 463432 461393 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 protein_id gnl|my_center|LOCUS_18340 464558 463521 gene locus_tag LOCUS_18350 464558 463521 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 protein_id gnl|my_center|LOCUS_18350 465619 464555 gene locus_tag LOCUS_18360 465619 464555 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 protein_id gnl|my_center|LOCUS_18360 468302 465864 gene locus_tag LOCUS_18370 468302 465864 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_18370 469439 468336 gene locus_tag LOCUS_18380 gene glgD 469439 468336 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_18380 470602 469436 gene locus_tag LOCUS_18390 gene glgC 470602 469436 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_18390 470872 471888 gene locus_tag LOCUS_18400 470872 471888 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418716.1 protein_id gnl|my_center|LOCUS_18400 471918 472856 gene locus_tag LOCUS_18410 471918 472856 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409939.1 protein_id gnl|my_center|LOCUS_18410 474288 472927 gene locus_tag LOCUS_18420 474288 472927 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 protein_id gnl|my_center|LOCUS_18420 474555 475787 gene locus_tag LOCUS_18430 474555 475787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 476424 475915 gene locus_tag LOCUS_18440 476424 475915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_18440 476604 476792 gene locus_tag LOCUS_18450 476604 476792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 477788 476874 gene locus_tag LOCUS_18460 477788 476874 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_18460 479508 477820 gene locus_tag LOCUS_18470 gene malL 479508 477820 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_18470 480501 479755 gene locus_tag LOCUS_18480 480501 479755 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_18480 480924 480520 gene locus_tag LOCUS_18490 480924 480520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 481499 480963 gene locus_tag LOCUS_18500 481499 480963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399302.1 protein_id gnl|my_center|LOCUS_18500 482557 481715 gene locus_tag LOCUS_18510 gene pgoN 482557 481715 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_18510 483325 482705 gene locus_tag LOCUS_18520 483325 482705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 484198 483521 gene locus_tag LOCUS_18530 484198 483521 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262990.1 protein_id gnl|my_center|LOCUS_18530 484762 484247 gene locus_tag LOCUS_18540 484762 484247 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401930.1 protein_id gnl|my_center|LOCUS_18540 486053 484932 gene locus_tag LOCUS_18550 486053 484932 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243312.1 protein_id gnl|my_center|LOCUS_18550 486741 486043 gene locus_tag LOCUS_18560 486741 486043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435805.1 protein_id gnl|my_center|LOCUS_18560 487615 486851 gene locus_tag LOCUS_18570 487615 486851 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982927.1 protein_id gnl|my_center|LOCUS_18570 488400 487687 gene locus_tag LOCUS_18580 488400 487687 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119510.1 protein_id gnl|my_center|LOCUS_18580 489246 488620 gene locus_tag LOCUS_18590 489246 488620 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722807.1 protein_id gnl|my_center|LOCUS_18590 489752 489390 gene locus_tag LOCUS_18600 gene rtp 489752 489390 CDS product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 protein_id gnl|my_center|LOCUS_18600 490699 490013 gene locus_tag LOCUS_18610 490699 490013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_18610 491579 490764 gene locus_tag LOCUS_18620 491579 490764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 493203 491746 gene locus_tag LOCUS_18630 gene nagE 493203 491746 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987109.1 protein_id gnl|my_center|LOCUS_18630 493731 493228 gene locus_tag LOCUS_18640 493731 493228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 494659 493796 gene locus_tag LOCUS_18650 gene glcT 494659 493796 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073856.1 protein_id gnl|my_center|LOCUS_18650 495534 494953 gene locus_tag LOCUS_18660 495534 494953 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100102.1 protein_id gnl|my_center|LOCUS_18660 498185 495657 gene locus_tag LOCUS_18670 gene hrpB 498185 495657 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_18670 498363 499334 gene locus_tag LOCUS_18680 gene gluQRS 498363 499334 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_18680 500362 499556 gene locus_tag LOCUS_18690 500362 499556 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061320.1 protein_id gnl|my_center|LOCUS_18690 501218 500544 gene locus_tag LOCUS_18700 501218 500544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 502070 501222 gene locus_tag LOCUS_18710 502070 501222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 502386 502706 gene locus_tag LOCUS_18720 502386 502706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 502912 502769 gene locus_tag LOCUS_18730 502912 502769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 504393 503176 gene locus_tag LOCUS_18740 gene mdtG 504393 503176 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 protein_id gnl|my_center|LOCUS_18740 505116 504664 gene locus_tag LOCUS_18750 505116 504664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 505875 505240 gene locus_tag LOCUS_18760 505875 505240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 506041 507069 gene locus_tag LOCUS_18770 506041 507069 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_18770 507056 507508 gene locus_tag LOCUS_18780 507056 507508 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208553.1 protein_id gnl|my_center|LOCUS_18780 509391 507613 gene locus_tag LOCUS_18790 509391 507613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_18790 509501 510007 gene locus_tag LOCUS_18800 509501 510007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 510426 510139 gene locus_tag LOCUS_18810 510426 510139 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406139.1 protein_id gnl|my_center|LOCUS_18810 510998 512743 gene locus_tag LOCUS_18820 gene bmrC 510998 512743 CDS product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 protein_id gnl|my_center|LOCUS_18820 512761 514836 gene locus_tag LOCUS_18830 512761 514836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116616.1 protein_id gnl|my_center|LOCUS_18830 515100 516029 gene locus_tag LOCUS_18840 gene cmrA 515100 516029 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_18840 516164 517147 gene locus_tag LOCUS_18850 516164 517147 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172293.1 protein_id gnl|my_center|LOCUS_18850 517173 518024 gene locus_tag LOCUS_18860 517173 518024 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 protein_id gnl|my_center|LOCUS_18860 519285 518125 gene locus_tag LOCUS_18870 519285 518125 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100927.1 protein_id gnl|my_center|LOCUS_18870 519722 519285 gene locus_tag LOCUS_18880 519722 519285 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_18880 521811 519742 gene locus_tag LOCUS_18890 gene mtlR 521811 519742 CDS product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 protein_id gnl|my_center|LOCUS_18890 523344 521893 gene locus_tag LOCUS_18900 523344 521893 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_18900 524051 523713 gene locus_tag LOCUS_18910 524051 523713 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 protein_id gnl|my_center|LOCUS_18910 525358 524261 gene locus_tag LOCUS_18920 525358 524261 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044933.1 protein_id gnl|my_center|LOCUS_18920 525519 526058 gene locus_tag LOCUS_18930 525519 526058 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_18930 527846 526389 gene locus_tag LOCUS_18940 527846 526389 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150184.1 protein_id gnl|my_center|LOCUS_18940 528430 527876 gene locus_tag LOCUS_18950 528430 527876 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 protein_id gnl|my_center|LOCUS_18950 529313 528537 gene locus_tag LOCUS_18960 529313 528537 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989490.1 protein_id gnl|my_center|LOCUS_18960 529747 529346 gene locus_tag LOCUS_18970 529747 529346 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064308.1 protein_id gnl|my_center|LOCUS_18970 530334 529882 gene locus_tag LOCUS_18980 530334 529882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 531920 530370 gene locus_tag LOCUS_18990 gene miaB 531920 530370 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_18990 532729 532157 gene locus_tag LOCUS_19000 532729 532157 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_19000 533765 532899 gene locus_tag LOCUS_19010 533765 532899 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_19010 535539 533752 gene locus_tag LOCUS_19020 535539 533752 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 protein_id gnl|my_center|LOCUS_19020 536718 535756 gene locus_tag LOCUS_19030 536718 535756 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732488.1 protein_id gnl|my_center|LOCUS_19030 537098 536838 gene locus_tag LOCUS_19040 gene spoVS 537098 536838 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_19040 538051 537257 gene locus_tag LOCUS_19050 gene ymdB 538051 537257 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_19050 539693 538152 gene locus_tag LOCUS_19060 gene rny 539693 538152 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_19060 540686 539967 gene locus_tag LOCUS_19070 540686 539967 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_19070 541853 540792 gene locus_tag LOCUS_19080 gene recA 541853 540792 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_19080 543376 542114 gene locus_tag LOCUS_19090 gene cinA 543376 542114 CDS product competence/damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990712.1 protein_id gnl|my_center|LOCUS_19090 543999 543415 gene locus_tag LOCUS_19100 gene pgsA 543999 543415 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_19100 544683 544192 gene locus_tag LOCUS_19110 544683 544192 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_19110 544996 544832 gene locus_tag LOCUS_19120 544996 544832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 546080 545094 gene locus_tag LOCUS_19130 546080 545094 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 protein_id gnl|my_center|LOCUS_19130 546899 546120 gene locus_tag LOCUS_19140 546899 546120 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_19140 547420 547166 gene locus_tag LOCUS_19150 547420 547166 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393333.1 protein_id gnl|my_center|LOCUS_19150 548238 547510 gene locus_tag LOCUS_19160 548238 547510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_19160 549557 548274 gene locus_tag LOCUS_19170 549557 548274 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_19170 550841 549561 gene locus_tag LOCUS_19180 550841 549561 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772418.1 protein_id gnl|my_center|LOCUS_19180 551807 550965 gene locus_tag LOCUS_19190 gene sleB 551807 550965 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249053.1 protein_id gnl|my_center|LOCUS_19190 554773 551993 gene locus_tag LOCUS_19200 554773 551993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 555072 554839 gene locus_tag LOCUS_19210 555072 554839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 555848 555069 gene locus_tag LOCUS_19220 gene tepA 555848 555069 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_19220 557667 555988 gene locus_tag LOCUS_19230 557667 555988 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838584.1 protein_id gnl|my_center|LOCUS_19230 558908 558015 gene locus_tag LOCUS_19240 gene dapA 558908 558015 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_19240 560184 558967 gene locus_tag LOCUS_19250 gene dapG 560184 558967 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 protein_id gnl|my_center|LOCUS_19250 561343 560309 gene locus_tag LOCUS_19260 gene asd 561343 560309 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 protein_id gnl|my_center|LOCUS_19260 562018 561425 gene locus_tag LOCUS_19270 gene dpaB 562018 561425 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049484.1 protein_id gnl|my_center|LOCUS_19270 562914 562015 gene locus_tag LOCUS_19280 gene dpaA 562914 562015 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954724.1 protein_id gnl|my_center|LOCUS_19280 563621 563172 gene locus_tag LOCUS_19290 gene dut 563621 563172 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_19290 564864 563599 gene locus_tag LOCUS_19300 564864 563599 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592996.1 protein_id gnl|my_center|LOCUS_19300 566063 565029 gene locus_tag LOCUS_19310 566063 565029 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 protein_id gnl|my_center|LOCUS_19310 568321 566219 gene locus_tag LOCUS_19320 gene pnp 568321 566219 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_19320 568800 568531 gene locus_tag LOCUS_19330 gene rpsO 568800 568531 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_19330 569935 568991 gene locus_tag LOCUS_19340 gene ribF 569935 568991 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766711.1 protein_id gnl|my_center|LOCUS_19340 570949 570029 gene locus_tag LOCUS_19350 gene truB 570949 570029 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_19350 571926 570949 gene locus_tag LOCUS_19360 571926 570949 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_19360 572293 571943 gene locus_tag LOCUS_19370 gene rbfA 572293 571943 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_19370 575048 572412 gene locus_tag LOCUS_19380 575048 572412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 575373 575041 gene locus_tag LOCUS_19390 575373 575041 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439520.1 protein_id gnl|my_center|LOCUS_19390 575677 575357 gene locus_tag LOCUS_19400 575677 575357 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_19400 576801 575704 gene locus_tag LOCUS_19410 gene nusA 576801 575704 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_19410 577314 576853 gene locus_tag LOCUS_19420 gene rimP 577314 576853 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 protein_id gnl|my_center|LOCUS_19420 581853 577531 gene locus_tag LOCUS_19430 581853 577531 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_19430 583306 582032 gene locus_tag LOCUS_19440 gene rseP 583306 582032 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_19440 584660 583521 gene locus_tag LOCUS_19450 584660 583521 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_19450 585492 584692 gene locus_tag LOCUS_19460 gene cdsA 585492 584692 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_19460 586282 585515 gene locus_tag LOCUS_19470 gene uppS 586282 585515 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971301.1 protein_id gnl|my_center|LOCUS_19470 586995 586441 gene locus_tag LOCUS_19480 gene frr 586995 586441 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 protein_id gnl|my_center|LOCUS_19480 587723 586995 gene locus_tag LOCUS_19490 gene pyrH 587723 586995 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 protein_id gnl|my_center|LOCUS_19490 588578 587928 gene locus_tag LOCUS_19500 gene tsf 588578 587928 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_19500 589397 588699 gene locus_tag LOCUS_19510 gene rpsB 589397 588699 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_19510 590178 589594 gene locus_tag LOCUS_19520 590178 589594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 590792 590175 gene locus_tag LOCUS_19530 590792 590175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 591143 590817 gene locus_tag LOCUS_19540 591143 590817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 592645 591239 gene locus_tag LOCUS_19550 592645 591239 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_19550 593468 592680 gene locus_tag LOCUS_19560 gene sigD 593468 592680 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_19560 593750 593484 gene locus_tag LOCUS_19570 593750 593484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 594415 593918 gene locus_tag LOCUS_19580 gene cheD 594415 593918 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_19580 595037 594408 gene locus_tag LOCUS_19590 595037 594408 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_19590 595501 595040 gene locus_tag LOCUS_19600 595501 595040 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_19600 597640 595553 gene locus_tag LOCUS_19610 gene cheA 597640 595553 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_19610 599050 597671 gene locus_tag LOCUS_19620 599050 597671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 599978 599076 gene locus_tag LOCUS_19630 599978 599076 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986948.1 protein_id gnl|my_center|LOCUS_19630 601393 599975 gene locus_tag LOCUS_19640 601393 599975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 603423 601390 gene locus_tag LOCUS_19650 gene flhA 603423 601390 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_19650 604535 603447 gene locus_tag LOCUS_19660 gene flhB 604535 603447 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_19660 605348 604566 gene locus_tag LOCUS_19670 gene fliR 605348 604566 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_19670 605630 605361 gene locus_tag LOCUS_19680 gene fliQ 605630 605361 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_19680 606439 605684 gene locus_tag LOCUS_19690 gene fliP 606439 605684 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_19690 606981 606436 gene locus_tag LOCUS_19700 606981 606436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 607359 606994 gene locus_tag LOCUS_19710 gene cheY 607359 606994 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_19710 608655 607387 gene locus_tag LOCUS_19720 gene fliY 608655 607387 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460753.1 protein_id gnl|my_center|LOCUS_19720 609643 608645 gene locus_tag LOCUS_19730 gene fliM 609643 608645 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_19730 610160 609681 gene locus_tag LOCUS_19740 610160 609681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 610381 610157 gene locus_tag LOCUS_19750 610381 610157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 611253 610435 gene locus_tag LOCUS_19760 gene flgG 611253 610435 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_19760 611731 611345 gene locus_tag LOCUS_19770 611731 611345 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_19770 612264 611728 gene locus_tag LOCUS_19780 612264 611728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 613796 612303 gene locus_tag LOCUS_19790 613796 612303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 614777 613830 gene locus_tag LOCUS_19800 614777 613830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 615259 614816 gene locus_tag LOCUS_19810 615259 614816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 616580 615267 gene locus_tag LOCUS_19820 gene fliI 616580 615267 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090887161.1 protein_id gnl|my_center|LOCUS_19820 617421 616573 gene locus_tag LOCUS_19830 gene fliH 617421 616573 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_19830 618430 617414 gene locus_tag LOCUS_19840 gene fliG 618430 617414 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_19840 620026 618443 gene locus_tag LOCUS_19850 gene fliF 620026 618443 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_19850 620372 620064 gene locus_tag LOCUS_19860 620372 620064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 620861 620409 gene locus_tag LOCUS_19870 gene flgC 620861 620409 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_19870 621274 620864 gene locus_tag LOCUS_19880 gene flgB 621274 620864 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_19880 623091 621676 gene locus_tag LOCUS_19890 gene hslU 623091 621676 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 protein_id gnl|my_center|LOCUS_19890 623749 623207 gene locus_tag LOCUS_19900 gene hslV 623749 623207 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829498.1 protein_id gnl|my_center|LOCUS_19900 625093 623765 gene locus_tag LOCUS_19910 gene trmFO 625093 623765 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_19910 627218 625113 gene locus_tag LOCUS_19920 gene topA 627218 625113 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_19920 628355 627285 gene locus_tag LOCUS_19930 gene dprA 628355 627285 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_19930 629432 628503 gene locus_tag LOCUS_19940 gene sucD 629432 628503 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_19940 630664 629504 gene locus_tag LOCUS_19950 gene sucC 630664 629504 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_19950 632469 630883 gene locus_tag LOCUS_19960 632469 630883 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_19960 633027 632617 gene locus_tag LOCUS_19970 633027 632617 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_19970 633328 633017 gene locus_tag LOCUS_19980 633328 633017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 <634266 633325 gene locus_tag LOCUS_19990 <634266 633325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164545570.1:flagellar hook-length control protein FliK note possible pseudo, frameshifted >Feature sequence13 2934 1447 gene locus_tag LOCUS_20000 2934 1447 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_20000 4427 3150 gene locus_tag LOCUS_20010 4427 3150 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_20010 5426 4512 gene locus_tag LOCUS_20020 gene ftsX 5426 4512 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645028.1 protein_id gnl|my_center|LOCUS_20020 6102 5416 gene locus_tag LOCUS_20030 gene ftsE 6102 5416 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_20030 6339 7787 gene locus_tag LOCUS_20040 6339 7787 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_20040 7870 8469 gene locus_tag LOCUS_20050 7870 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10183 8630 gene locus_tag LOCUS_20060 10183 8630 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229620.1 protein_id gnl|my_center|LOCUS_20060 10955 10281 gene locus_tag LOCUS_20070 10955 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245825.1 protein_id gnl|my_center|LOCUS_20070 11756 11013 gene locus_tag LOCUS_20080 11756 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400906.1 protein_id gnl|my_center|LOCUS_20080 12396 11770 gene locus_tag LOCUS_20090 12396 11770 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102258.1 protein_id gnl|my_center|LOCUS_20090 13175 12603 gene locus_tag LOCUS_20100 13175 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 14809 13391 gene locus_tag LOCUS_20110 gene argH 14809 13391 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_20110 16411 15176 gene locus_tag LOCUS_20120 16411 15176 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_20120 17391 16435 gene locus_tag LOCUS_20130 gene argF 17391 16435 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_20130 18660 17395 gene locus_tag LOCUS_20140 18660 17395 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_20140 19596 18745 gene locus_tag LOCUS_20150 gene argB 19596 18745 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_20150 20908 19679 gene locus_tag LOCUS_20160 gene argJ 20908 19679 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_20160 21987 20929 gene locus_tag LOCUS_20170 gene argC 21987 20929 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_20170 22280 22059 gene locus_tag LOCUS_20180 22280 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 22828 22277 gene locus_tag LOCUS_20190 22828 22277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 23978 23136 gene locus_tag LOCUS_20200 23978 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 24280 23960 gene locus_tag LOCUS_20210 24280 23960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 25356 24469 gene locus_tag LOCUS_20220 25356 24469 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_20220 26505 25486 gene locus_tag LOCUS_20230 gene prfB 26505 25486 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_20230 29286 26782 gene locus_tag LOCUS_20240 gene secA 29286 26782 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_20240 30101 29538 gene locus_tag LOCUS_20250 gene raiA 30101 29538 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_20250 30516 30319 gene locus_tag LOCUS_20260 30516 30319 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_20260 31507 30785 gene locus_tag LOCUS_20270 31507 30785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 33057 31507 gene locus_tag LOCUS_20280 33057 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 33782 33075 gene locus_tag LOCUS_20290 33782 33075 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776620.1 protein_id gnl|my_center|LOCUS_20290 34473 33787 gene locus_tag LOCUS_20300 34473 33787 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776619.1 protein_id gnl|my_center|LOCUS_20300 34692 36173 gene locus_tag LOCUS_20310 34692 36173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 36190 36588 gene locus_tag LOCUS_20320 gene tagD 36190 36588 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_20320 36609 38555 gene locus_tag LOCUS_20330 36609 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 38933 38607 gene locus_tag LOCUS_20340 38933 38607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 39330 38926 gene locus_tag LOCUS_20350 gene fliS 39330 38926 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272503.1 protein_id gnl|my_center|LOCUS_20350 41094 39352 gene locus_tag LOCUS_20360 41094 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 41494 41105 gene locus_tag LOCUS_20370 41494 41105 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965506.1 protein_id gnl|my_center|LOCUS_20370 42645 41578 gene locus_tag LOCUS_20380 42645 41578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 43515 42748 gene locus_tag LOCUS_20390 gene hag 43515 42748 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_20390 43887 43657 gene locus_tag LOCUS_20400 gene csrA 43887 43657 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 protein_id gnl|my_center|LOCUS_20400 44336 43887 gene locus_tag LOCUS_20410 gene fliW 44336 43887 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_20410 45418 44510 gene locus_tag LOCUS_20420 gene flgL 45418 44510 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 protein_id gnl|my_center|LOCUS_20420 46969 45446 gene locus_tag LOCUS_20430 gene flgK 46969 45446 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_20430 47488 46985 gene locus_tag LOCUS_20440 47488 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 47780 47490 gene locus_tag LOCUS_20450 47780 47490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 48287 47880 gene locus_tag LOCUS_20460 48287 47880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_20460 49013 48411 gene locus_tag LOCUS_20470 49013 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 50331 49360 gene locus_tag LOCUS_20480 50331 49360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 50376 50534 gene locus_tag LOCUS_20490 50376 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 50599 50766 gene locus_tag LOCUS_20500 50599 50766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence14 1361 174 gene locus_tag LOCUS_20510 1361 174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861316.1 protein_id gnl|my_center|LOCUS_20510 1549 2178 gene locus_tag LOCUS_20520 1549 2178 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355893.1 protein_id gnl|my_center|LOCUS_20520 3203 2355 gene locus_tag LOCUS_20530 3203 2355 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963628.1 protein_id gnl|my_center|LOCUS_20530 3988 3200 gene locus_tag LOCUS_20540 3988 3200 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_20540 4283 6277 gene locus_tag LOCUS_20550 gene uvrB 4283 6277 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_20550 6296 9157 gene locus_tag LOCUS_20560 gene uvrA 6296 9157 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_20560 9491 10663 gene locus_tag LOCUS_20570 9491 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10736 12748 gene locus_tag LOCUS_20580 10736 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 12941 13564 gene locus_tag LOCUS_20590 gene dgk 12941 13564 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247138.1 protein_id gnl|my_center|LOCUS_20590 13566 14231 gene locus_tag LOCUS_20600 gene dck 13566 14231 CDS product deoxyadenosine/deoxycytidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226792.1 protein_id gnl|my_center|LOCUS_20600 14878 17385 gene locus_tag LOCUS_20610 14878 17385 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_20610 20183 17724 gene locus_tag LOCUS_20620 20183 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 21063 22346 gene locus_tag LOCUS_20630 21063 22346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_20630 22365 25625 gene locus_tag LOCUS_20640 22365 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 25640 26989 gene locus_tag LOCUS_20650 25640 26989 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250060.1 protein_id gnl|my_center|LOCUS_20650 28296 28865 gene locus_tag LOCUS_20660 28296 28865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 29569 29883 gene locus_tag LOCUS_20670 29569 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 29849 30856 gene locus_tag LOCUS_20680 29849 30856 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_20680 30870 32201 gene locus_tag LOCUS_20690 gene tuaD 30870 32201 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_20690 32271 33014 gene locus_tag LOCUS_20700 32271 33014 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_20700 33033 33581 gene locus_tag LOCUS_20710 gene rfbC 33033 33581 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_20710 33612 34637 gene locus_tag LOCUS_20720 gene rfbB 33612 34637 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_20720 34634 35518 gene locus_tag LOCUS_20730 gene rfbD 34634 35518 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_20730 35792 36892 gene locus_tag LOCUS_20740 gene rffA 35792 36892 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211981.1 protein_id gnl|my_center|LOCUS_20740 38366 38929 gene locus_tag LOCUS_20750 38366 38929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 38958 39710 gene locus_tag LOCUS_20760 38958 39710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 39707 40486 gene locus_tag LOCUS_20770 39707 40486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 41077 40559 gene locus_tag LOCUS_20780 41077 40559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 41251 42162 gene locus_tag LOCUS_20790 41251 42162 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_20790 42159 43559 gene locus_tag LOCUS_20800 42159 43559 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_20800 43678 43929 gene locus_tag LOCUS_20810 43678 43929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 43893 44078 gene locus_tag LOCUS_20820 43893 44078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 44325 45011 gene locus_tag LOCUS_20830 44325 45011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244492.1 protein_id gnl|my_center|LOCUS_20830 45180 46055 gene locus_tag LOCUS_20840 gene galU 45180 46055 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097988.1 protein_id gnl|my_center|LOCUS_20840 46059 46958 gene locus_tag LOCUS_20850 46059 46958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 47179 47871 gene locus_tag LOCUS_20860 47179 47871 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272099.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence15 2185 413 gene locus_tag LOCUS_20870 2185 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3203 2334 gene locus_tag LOCUS_20880 gene pheA 3203 2334 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 protein_id gnl|my_center|LOCUS_20880 4250 3294 gene locus_tag LOCUS_20890 gene thrB 4250 3294 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_20890 5317 4247 gene locus_tag LOCUS_20900 gene thrC 5317 4247 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_20900 6665 5379 gene locus_tag LOCUS_20910 6665 5379 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659109.1 protein_id gnl|my_center|LOCUS_20910 7161 6724 gene locus_tag LOCUS_20920 7161 6724 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_20920 8639 7326 gene locus_tag LOCUS_20930 gene obgE 8639 7326 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_20930 9395 8655 gene locus_tag LOCUS_20940 9395 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 9936 9625 gene locus_tag LOCUS_20950 gene rpmA 9936 9625 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_20950 10289 9960 gene locus_tag LOCUS_20960 10289 9960 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 protein_id gnl|my_center|LOCUS_20960 10615 10304 gene locus_tag LOCUS_20970 gene rplU 10615 10304 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_20970 12009 10825 gene locus_tag LOCUS_20980 gene rng 12009 10825 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_20980 12918 12055 gene locus_tag LOCUS_20990 gene spoIVFB 12918 12055 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_20990 13867 12911 gene locus_tag LOCUS_21000 13867 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 14856 14059 gene locus_tag LOCUS_21010 gene minD 14856 14059 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_21010 15521 14859 gene locus_tag LOCUS_21020 gene minC 15521 14859 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 protein_id gnl|my_center|LOCUS_21020 16131 15598 gene locus_tag LOCUS_21030 16131 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 17009 16131 gene locus_tag LOCUS_21040 gene mreC 17009 16131 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_21040 18113 17088 gene locus_tag LOCUS_21050 gene mreB 18113 17088 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 protein_id gnl|my_center|LOCUS_21050 18860 18171 gene locus_tag LOCUS_21060 gene radC 18860 18171 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_21060 19566 18952 gene locus_tag LOCUS_21070 19566 18952 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_21070 21121 19796 gene locus_tag LOCUS_21080 21121 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 22700 21324 gene locus_tag LOCUS_21090 gene murC 22700 21324 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_21090 24076 22706 gene locus_tag LOCUS_21100 gene folC 24076 22706 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_21100 26760 24088 gene locus_tag LOCUS_21110 gene valS 26760 24088 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_21110 28913 27282 gene locus_tag LOCUS_21120 gene spoVID 28913 27282 CDS product spore coat morphogenetic protein SpoVID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246083.1 protein_id gnl|my_center|LOCUS_21120 29940 29101 gene locus_tag LOCUS_21130 29940 29101 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 protein_id gnl|my_center|LOCUS_21130 31322 30021 gene locus_tag LOCUS_21140 gene hemL 31322 30021 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_21140 32401 31400 gene locus_tag LOCUS_21150 gene hemB 32401 31400 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087062.1 protein_id gnl|my_center|LOCUS_21150 33964 32426 gene locus_tag LOCUS_21160 gene cobA 33964 32426 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_21160 34927 33971 gene locus_tag LOCUS_21170 gene hemC 34927 33971 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226416.1 protein_id gnl|my_center|LOCUS_21170 35577 34933 gene locus_tag LOCUS_21180 35577 34933 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_21180 36412 35585 gene locus_tag LOCUS_21190 36412 35585 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 protein_id gnl|my_center|LOCUS_21190 37809 36427 gene locus_tag LOCUS_21200 gene hemA 37809 36427 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547860.1 protein_id gnl|my_center|LOCUS_21200 38637 38029 gene locus_tag LOCUS_21210 gene ysxC 38637 38029 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 protein_id gnl|my_center|LOCUS_21210 41007 38671 gene locus_tag LOCUS_21220 gene lon 41007 38671 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_21220 42939 41209 gene locus_tag LOCUS_21230 gene lonB 42939 41209 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816883.1 protein_id gnl|my_center|LOCUS_21230 44244 43126 gene locus_tag LOCUS_21240 gene ispG 44244 43126 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_21240 45625 44369 gene locus_tag LOCUS_21250 gene clpX 45625 44369 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_21250 46229 45642 gene locus_tag LOCUS_21260 gene clpP 46229 45642 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_21260 47846 46542 gene locus_tag LOCUS_21270 gene tig 47846 46542 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_21270 48901 48056 gene locus_tag LOCUS_21280 48901 48056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 49131 49207 gene locus_tag LOCUS_t00290 49131 49207 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 3574 3903 gene locus_tag LOCUS_21290 3574 3903 CDS product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393373.1 protein_id gnl|my_center|LOCUS_21290 3907 4392 gene locus_tag LOCUS_21300 3907 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 5738 4401 gene locus_tag LOCUS_21310 5738 4401 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201572.1 protein_id gnl|my_center|LOCUS_21310 6213 5908 gene locus_tag LOCUS_21320 6213 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6656 6309 gene locus_tag LOCUS_21330 6656 6309 CDS product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024629.1 protein_id gnl|my_center|LOCUS_21330 6855 8225 gene locus_tag LOCUS_21340 6855 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 8271 9464 gene locus_tag LOCUS_21350 gene spaC 8271 9464 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_21350 9540 10919 gene locus_tag LOCUS_21360 gene yheD 9540 10919 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_21360 10916 12031 gene locus_tag LOCUS_21370 gene yheD 10916 12031 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_21370 12047 12514 gene locus_tag LOCUS_21380 12047 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 12565 13680 gene locus_tag LOCUS_21390 12565 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 14436 13738 gene locus_tag LOCUS_21400 14436 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 15270 14548 gene locus_tag LOCUS_21410 15270 14548 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_21410 15565 16608 gene locus_tag LOCUS_21420 15565 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 17317 16748 gene locus_tag LOCUS_21430 gene cotJC 17317 16748 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_21430 17636 17367 gene locus_tag LOCUS_21440 gene cotJB 17636 17367 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_21440 17858 17640 gene locus_tag LOCUS_21450 17858 17640 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362188.1 protein_id gnl|my_center|LOCUS_21450 19503 18139 gene locus_tag LOCUS_21460 19503 18139 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_21460 20653 19520 gene locus_tag LOCUS_21470 gene yfkAB 20653 19520 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 protein_id gnl|my_center|LOCUS_21470 21886 20804 gene locus_tag LOCUS_21480 21886 20804 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_21480 22780 21950 gene locus_tag LOCUS_21490 gene uppP 22780 21950 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796238.1 protein_id gnl|my_center|LOCUS_21490 24319 22850 gene locus_tag LOCUS_21500 24319 22850 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 protein_id gnl|my_center|LOCUS_21500 24420 25145 gene locus_tag LOCUS_21510 24420 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 25226 26281 gene locus_tag LOCUS_21520 25226 26281 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_21520 26616 26389 gene locus_tag LOCUS_21530 26616 26389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 26858 27298 gene locus_tag LOCUS_21540 26858 27298 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137628160.1 protein_id gnl|my_center|LOCUS_21540 27314 27799 gene locus_tag LOCUS_21550 27314 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 28340 27876 gene locus_tag LOCUS_21560 28340 27876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 29931 28534 gene locus_tag LOCUS_21570 gene sufB 29931 28534 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_21570 30358 29945 gene locus_tag LOCUS_21580 30358 29945 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 protein_id gnl|my_center|LOCUS_21580 31572 30358 gene locus_tag LOCUS_21590 gene sufS 31572 30358 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_21590 32867 31569 gene locus_tag LOCUS_21600 gene sufD 32867 31569 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 protein_id gnl|my_center|LOCUS_21600 33676 32888 gene locus_tag LOCUS_21610 gene sufC 33676 32888 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_21610 34507 33923 gene locus_tag LOCUS_21620 34507 33923 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_21620 35002 34529 gene locus_tag LOCUS_21630 35002 34529 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_21630 35321 35809 gene locus_tag LOCUS_21640 35321 35809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 36248 35868 gene locus_tag LOCUS_21650 36248 35868 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_21650 36425 36856 gene locus_tag LOCUS_21660 36425 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 36908 37756 gene locus_tag LOCUS_21670 36908 37756 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_21670 37770 38489 gene locus_tag LOCUS_21680 37770 38489 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_21680 39134 38571 gene locus_tag LOCUS_21690 39134 38571 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721773.1 protein_id gnl|my_center|LOCUS_21690 39446 41143 gene locus_tag LOCUS_21700 39446 41143 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_21700 42294 41260 gene locus_tag LOCUS_21710 gene mnmH 42294 41260 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_21710 43282 42320 gene locus_tag LOCUS_21720 gene selD 43282 42320 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_21720 43534 44607 gene locus_tag LOCUS_21730 43534 44607 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_21730 44831 44757 gene locus_tag LOCUS_t00300 44831 44757 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44919 44844 gene locus_tag LOCUS_t00310 44919 44844 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 45062 44988 gene locus_tag LOCUS_t00320 45062 44988 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45150 45075 gene locus_tag LOCUS_t00330 45150 45075 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 45236 45163 gene locus_tag LOCUS_t00340 45236 45163 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45326 45251 gene locus_tag LOCUS_t00350 45326 45251 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45499 45423 gene locus_tag LOCUS_t00360 45499 45423 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 1396 647 gene locus_tag LOCUS_21740 gene gpmA 1396 647 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_21740 1607 2281 gene locus_tag LOCUS_21750 1607 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2803 2354 gene locus_tag LOCUS_21760 2803 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3551 2877 gene locus_tag LOCUS_21770 gene rpiA 3551 2877 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049992.1 protein_id gnl|my_center|LOCUS_21770 3646 3846 gene locus_tag LOCUS_21780 3646 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 5215 3968 gene locus_tag LOCUS_21790 5215 3968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 protein_id gnl|my_center|LOCUS_21790 7666 5300 gene locus_tag LOCUS_21800 gene helD 7666 5300 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 protein_id gnl|my_center|LOCUS_21800 8893 7871 gene locus_tag LOCUS_21810 8893 7871 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 protein_id gnl|my_center|LOCUS_21810 9057 9653 gene locus_tag LOCUS_21820 9057 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 11277 9724 gene locus_tag LOCUS_21830 gene gntK 11277 9724 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_21830 11392 11225 gene locus_tag LOCUS_21840 11392 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 12528 11437 gene locus_tag LOCUS_21850 12528 11437 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166018.1 protein_id gnl|my_center|LOCUS_21850 12987 14066 gene locus_tag LOCUS_21860 12987 14066 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 protein_id gnl|my_center|LOCUS_21860 15065 14196 gene locus_tag LOCUS_21870 15065 14196 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_21870 16216 15137 gene locus_tag LOCUS_21880 gene pgl 16216 15137 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_21880 17321 16317 gene locus_tag LOCUS_21890 17321 16317 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_21890 18282 17419 gene locus_tag LOCUS_21900 18282 17419 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_21900 18525 18310 gene locus_tag LOCUS_21910 18525 18310 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_21910 19015 18536 gene locus_tag LOCUS_21920 19015 18536 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965845.1 protein_id gnl|my_center|LOCUS_21920 19246 19809 gene locus_tag LOCUS_21930 19246 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 19802 20794 gene locus_tag LOCUS_21940 19802 20794 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_21940 22368 20872 gene locus_tag LOCUS_21950 gene xylB 22368 20872 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_21950 23732 22416 gene locus_tag LOCUS_21960 gene xylA 23732 22416 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 protein_id gnl|my_center|LOCUS_21960 23969 25156 gene locus_tag LOCUS_21970 23969 25156 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_21970 25245 25571 gene locus_tag LOCUS_21980 25245 25571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 26701 25706 gene locus_tag LOCUS_21990 26701 25706 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_21990 26815 27723 gene locus_tag LOCUS_22000 26815 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 29007 27748 gene locus_tag LOCUS_22010 29007 27748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_22010 29703 29074 gene locus_tag LOCUS_22020 29703 29074 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_22020 29858 30769 gene locus_tag LOCUS_22030 29858 30769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 32439 30919 gene locus_tag LOCUS_22040 32439 30919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_22040 32895 32446 gene locus_tag LOCUS_22050 32895 32446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942998.1 protein_id gnl|my_center|LOCUS_22050 33085 33396 gene locus_tag LOCUS_22060 33085 33396 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_22060 33752 34696 gene locus_tag LOCUS_22070 33752 34696 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 protein_id gnl|my_center|LOCUS_22070 36289 36026 gene locus_tag LOCUS_22080 36289 36026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 37325 36303 gene locus_tag LOCUS_22090 37325 36303 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674646.1 protein_id gnl|my_center|LOCUS_22090 37674 37351 gene locus_tag LOCUS_22100 37674 37351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076614581.1 protein_id gnl|my_center|LOCUS_22100 38305 37691 gene locus_tag LOCUS_22110 38305 37691 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080210.1 protein_id gnl|my_center|LOCUS_22110 38591 38430 gene locus_tag LOCUS_22120 38591 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 40408 38588 gene locus_tag LOCUS_22130 40408 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 40614 40405 gene locus_tag LOCUS_22140 40614 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 40933 40580 gene locus_tag LOCUS_22150 40933 40580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22150 42022 40994 gene locus_tag LOCUS_22160 42022 40994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22160 42377 42673 gene locus_tag LOCUS_22170 42377 42673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 42657 42863 gene locus_tag LOCUS_22180 42657 42863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 42809 43156 gene locus_tag LOCUS_22190 42809 43156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22190 43059 43412 gene locus_tag LOCUS_22200 43059 43412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22200 43579 43506 gene locus_tag LOCUS_t00370 43579 43506 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43666 43590 gene locus_tag LOCUS_t00380 43666 43590 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43761 43676 gene locus_tag LOCUS_t00390 43761 43676 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43869 43793 gene locus_tag LOCUS_t00400 43869 43793 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43955 43881 gene locus_tag LOCUS_t00410 43955 43881 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44101 43989 gene locus_tag LOCUS_r00030 44101 43989 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence18 875 612 gene locus_tag LOCUS_22210 875 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1180 872 gene locus_tag LOCUS_22220 1180 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2063 1404 gene locus_tag LOCUS_22230 gene recR 2063 1404 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_22230 2448 2137 gene locus_tag LOCUS_22240 2448 2137 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_22240 4293 2509 gene locus_tag LOCUS_22250 gene dnaX 4293 2509 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 protein_id gnl|my_center|LOCUS_22250 5206 5009 gene locus_tag LOCUS_22260 gene rpmE 5206 5009 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_22260 6603 5326 gene locus_tag LOCUS_22270 6603 5326 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_22270 8023 6665 gene locus_tag LOCUS_22280 gene rho 8023 6665 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 protein_id gnl|my_center|LOCUS_22280 9469 8216 gene locus_tag LOCUS_22290 9469 8216 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_22290 10505 9651 gene locus_tag LOCUS_22300 10505 9651 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 protein_id gnl|my_center|LOCUS_22300 11121 10699 gene locus_tag LOCUS_22310 gene spo0F 11121 10699 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_22310 12931 11324 gene locus_tag LOCUS_22320 gene pyrG 12931 11324 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170458.1 protein_id gnl|my_center|LOCUS_22320 13936 13373 gene locus_tag LOCUS_22330 13936 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 14403 15572 gene locus_tag LOCUS_22340 14403 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 17396 15714 gene locus_tag LOCUS_22350 gene argS 17396 15714 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_22350 17833 17399 gene locus_tag LOCUS_22360 17833 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 19280 18060 gene locus_tag LOCUS_22370 19280 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 19457 21517 gene locus_tag LOCUS_22380 19457 21517 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 protein_id gnl|my_center|LOCUS_22380 22111 21602 gene locus_tag LOCUS_22390 22111 21602 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_22390 22235 24235 gene locus_tag LOCUS_22400 22235 24235 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_22400 24249 25073 gene locus_tag LOCUS_22410 24249 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 25466 25960 gene locus_tag LOCUS_22420 25466 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 26411 26887 gene locus_tag LOCUS_22430 26411 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 27037 26846 gene locus_tag LOCUS_22440 27037 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 27304 27813 gene locus_tag LOCUS_22450 27304 27813 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_22450 28260 27961 gene locus_tag LOCUS_22460 28260 27961 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979543.1 protein_id gnl|my_center|LOCUS_22460 28636 28343 gene locus_tag LOCUS_22470 28636 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 28815 29615 gene locus_tag LOCUS_22480 gene motA 28815 29615 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_22480 29599 30429 gene locus_tag LOCUS_22490 29599 30429 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_22490 31283 30579 gene locus_tag LOCUS_22500 gene rluF 31283 30579 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 protein_id gnl|my_center|LOCUS_22500 33585 31288 gene locus_tag LOCUS_22510 33585 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 33918 34409 gene locus_tag LOCUS_22520 gene tadA 33918 34409 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_22520 35407 34493 gene locus_tag LOCUS_22530 35407 34493 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_22530 35881 35738 gene locus_tag LOCUS_22540 35881 35738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 36175 36087 gene locus_tag LOCUS_t00420 36175 36087 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37529 36246 gene locus_tag LOCUS_22550 gene serS 37529 36246 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 protein_id gnl|my_center|LOCUS_22550 38222 37653 gene locus_tag LOCUS_22560 gene pdxT 38222 37653 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 protein_id gnl|my_center|LOCUS_22560 39154 38273 gene locus_tag LOCUS_22570 gene pdxS 39154 38273 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_22570 40747 39308 gene locus_tag LOCUS_22580 gene dacA 40747 39308 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053075.1 protein_id gnl|my_center|LOCUS_22580 42331 40874 gene locus_tag LOCUS_22590 gene guaB 42331 40874 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_22590 42932 42821 gene locus_tag LOCUS_r00040 42932 42821 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence19 529 143 gene locus_tag LOCUS_22600 529 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 594 1133 gene locus_tag LOCUS_22610 594 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2752 1091 gene locus_tag LOCUS_22620 2752 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3828 2947 gene locus_tag LOCUS_22630 3828 2947 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_22630 4627 3863 gene locus_tag LOCUS_22640 4627 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 4917 4624 gene locus_tag LOCUS_22650 4917 4624 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_22650 5156 5761 gene locus_tag LOCUS_22660 5156 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7074 6112 gene locus_tag LOCUS_22670 gene corA 7074 6112 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_22670 8195 7197 gene locus_tag LOCUS_22680 8195 7197 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_22680 8824 8213 gene locus_tag LOCUS_22690 8824 8213 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231449.1 protein_id gnl|my_center|LOCUS_22690 10033 9239 gene locus_tag LOCUS_22700 10033 9239 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982899.1 protein_id gnl|my_center|LOCUS_22700 11006 10176 gene locus_tag LOCUS_22710 11006 10176 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_22710 11176 12183 gene locus_tag LOCUS_22720 11176 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 12529 12314 gene locus_tag LOCUS_22730 12529 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 12666 13445 gene locus_tag LOCUS_22740 12666 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 14261 13572 gene locus_tag LOCUS_22750 14261 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 15022 14258 gene locus_tag LOCUS_22760 15022 14258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 protein_id gnl|my_center|LOCUS_22760 15395 15006 gene locus_tag LOCUS_22770 15395 15006 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_22770 18027 15601 gene locus_tag LOCUS_22780 18027 15601 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_22780 19500 18217 gene locus_tag LOCUS_22790 gene ilvA 19500 18217 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 protein_id gnl|my_center|LOCUS_22790 20582 19638 gene locus_tag LOCUS_22800 20582 19638 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_22800 22073 20802 gene locus_tag LOCUS_22810 gene purD 22073 20802 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_22810 23758 22211 gene locus_tag LOCUS_22820 gene purH 23758 22211 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_22820 24645 24034 gene locus_tag LOCUS_22830 gene purN 24645 24034 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 protein_id gnl|my_center|LOCUS_22830 25688 24645 gene locus_tag LOCUS_22840 gene purM 25688 24645 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_22840 27829 26351 gene locus_tag LOCUS_22850 gene purF 27829 26351 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879025.1 protein_id gnl|my_center|LOCUS_22850 30060 27814 gene locus_tag LOCUS_22860 gene purL 30060 27814 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 protein_id gnl|my_center|LOCUS_22860 30727 30038 gene locus_tag LOCUS_22870 gene purQ 30727 30038 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 protein_id gnl|my_center|LOCUS_22870 30978 30733 gene locus_tag LOCUS_22880 gene purS 30978 30733 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_22880 32138 31245 gene locus_tag LOCUS_22890 32138 31245 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_22890 33582 32284 gene locus_tag LOCUS_22900 gene purB 33582 32284 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_22900 34907 33579 gene locus_tag LOCUS_22910 gene purK 34907 33579 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_22910 35404 34904 gene locus_tag LOCUS_22920 gene purE 35404 34904 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_22920 36275 35844 gene locus_tag LOCUS_22930 36275 35844 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_22930 36631 36368 gene locus_tag LOCUS_22940 36631 36368 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944263.1 protein_id gnl|my_center|LOCUS_22940 36962 36831 gene locus_tag LOCUS_22950 36962 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 39200 37062 gene locus_tag LOCUS_22960 39200 37062 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_22960 39332 39592 gene locus_tag LOCUS_22970 39332 39592 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638306.1 protein_id gnl|my_center|LOCUS_22970 40504 39677 gene locus_tag LOCUS_22980 40504 39677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 41478 40729 gene locus_tag LOCUS_22990 41478 40729 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_22990 41918 41806 gene locus_tag LOCUS_r00050 41918 41806 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence20 27 457 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactccatgtgagtgcgtggattgaaat 938 1117 gene locus_tag LOCUS_23000 938 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1110 1715 gene locus_tag LOCUS_23010 1110 1715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_23010 1818 2015 gene locus_tag LOCUS_23020 1818 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2669 2031 gene locus_tag LOCUS_23030 2669 2031 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 protein_id gnl|my_center|LOCUS_23030 3171 2737 gene locus_tag LOCUS_23040 3171 2737 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886424.1 protein_id gnl|my_center|LOCUS_23040 3425 4366 gene locus_tag LOCUS_23050 3425 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4363 5178 gene locus_tag LOCUS_23060 4363 5178 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168914.1 protein_id gnl|my_center|LOCUS_23060 6353 5262 gene locus_tag LOCUS_23070 6353 5262 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_23070 6666 8282 gene locus_tag LOCUS_23080 6666 8282 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_23080 8285 8980 gene locus_tag LOCUS_23090 8285 8980 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_23090 9024 10445 gene locus_tag LOCUS_23100 gene araA 9024 10445 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 protein_id gnl|my_center|LOCUS_23100 11502 10621 gene locus_tag LOCUS_23110 11502 10621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102088.1 protein_id gnl|my_center|LOCUS_23110 11656 12681 gene locus_tag LOCUS_23120 11656 12681 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_23120 12708 14018 gene locus_tag LOCUS_23130 gene celB 12708 14018 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_23130 14065 15309 gene locus_tag LOCUS_23140 14065 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102087.1 protein_id gnl|my_center|LOCUS_23140 15349 16602 gene locus_tag LOCUS_23150 15349 16602 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102086.1 protein_id gnl|my_center|LOCUS_23150 16648 16956 gene locus_tag LOCUS_23160 16648 16956 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023567.1 protein_id gnl|my_center|LOCUS_23160 16992 17294 gene locus_tag LOCUS_23170 16992 17294 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989050.1 protein_id gnl|my_center|LOCUS_23170 17408 17917 gene locus_tag LOCUS_23180 17408 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911276.1 protein_id gnl|my_center|LOCUS_23180 18302 19363 gene locus_tag LOCUS_23190 18302 19363 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 protein_id gnl|my_center|LOCUS_23190 19360 20391 gene locus_tag LOCUS_23200 19360 20391 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260757.1 protein_id gnl|my_center|LOCUS_23200 20412 21392 gene locus_tag LOCUS_23210 20412 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 21459 22253 gene locus_tag LOCUS_23220 21459 22253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 protein_id gnl|my_center|LOCUS_23220 22256 23407 gene locus_tag LOCUS_23230 22256 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 23485 24546 gene locus_tag LOCUS_23240 23485 24546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 24606 24857 gene locus_tag LOCUS_23250 24606 24857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 25417 25701 gene locus_tag LOCUS_23260 25417 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23260 25743 26375 gene locus_tag LOCUS_23270 25743 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23270 26396 26536 gene locus_tag LOCUS_23280 26396 26536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 27690 27022 gene locus_tag LOCUS_23290 27690 27022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 27847 27704 gene locus_tag LOCUS_23300 27847 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 28329 27856 gene locus_tag LOCUS_23310 28329 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 28719 30140 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcactcacgtagagtgcgac >Feature sequence21 25 1591 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcactcacatggagtgcgac 2537 2725 gene locus_tag LOCUS_23320 2537 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2752 2928 gene locus_tag LOCUS_23330 2752 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3098 3460 gene locus_tag LOCUS_23340 3098 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4247 3783 gene locus_tag LOCUS_23350 4247 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4522 4815 gene locus_tag LOCUS_23360 4522 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 4878 5450 gene locus_tag LOCUS_23370 4878 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5464 5919 gene locus_tag LOCUS_23380 5464 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6612 6148 gene locus_tag LOCUS_23390 6612 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7839 6994 gene locus_tag LOCUS_23400 gene rhaD 7839 6994 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363003.1 protein_id gnl|my_center|LOCUS_23400 9131 7875 gene locus_tag LOCUS_23410 gene rhaA 9131 7875 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387675.1 protein_id gnl|my_center|LOCUS_23410 10627 9161 gene locus_tag LOCUS_23420 gene rhaB 10627 9161 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476556.1 protein_id gnl|my_center|LOCUS_23420 12223 10712 gene locus_tag LOCUS_23430 12223 10712 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102178.1 protein_id gnl|my_center|LOCUS_23430 13241 12339 gene locus_tag LOCUS_23440 13241 12339 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_23440 14119 13238 gene locus_tag LOCUS_23450 14119 13238 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055566.1 protein_id gnl|my_center|LOCUS_23450 15549 14209 gene locus_tag LOCUS_23460 15549 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 15722 17545 gene locus_tag LOCUS_23470 15722 17545 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_23470 17538 19085 gene locus_tag LOCUS_23480 17538 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 19963 19265 gene locus_tag LOCUS_23490 gene sigK 19963 19265 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_23490 20233 22287 gene locus_tag LOCUS_23500 20233 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 24343 22394 gene locus_tag LOCUS_23510 24343 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 25411 24368 gene locus_tag LOCUS_23520 25411 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 25754 25684 gene locus_tag LOCUS_t00430 25754 25684 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25841 25765 gene locus_tag LOCUS_t00440 25841 25765 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26099 25987 gene locus_tag LOCUS_r00060 26099 25987 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence22 698 1207 gene locus_tag LOCUS_23530 698 1207 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_23530 1259 1432 gene locus_tag LOCUS_23540 gene rpmF 1259 1432 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_23540 1371 1532 gene locus_tag LOCUS_23550 1371 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1893 2456 gene locus_tag LOCUS_23560 gene fapR 1893 2456 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 protein_id gnl|my_center|LOCUS_23560 2440 3438 gene locus_tag LOCUS_23570 gene plsX 2440 3438 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_23570 3435 4421 gene locus_tag LOCUS_23580 3435 4421 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_23580 4532 5470 gene locus_tag LOCUS_23590 gene fabD 4532 5470 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515899.1 protein_id gnl|my_center|LOCUS_23590 5565 6311 gene locus_tag LOCUS_23600 gene fabG 5565 6311 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_23600 6394 6627 gene locus_tag LOCUS_23610 gene acpP 6394 6627 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_23610 6767 8005 gene locus_tag LOCUS_23620 gene fabF 6767 8005 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_23620 8020 8721 gene locus_tag LOCUS_23630 gene rncS 8020 8721 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_23630 8949 12497 gene locus_tag LOCUS_23640 gene smc 8949 12497 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_23640 12619 13638 gene locus_tag LOCUS_23650 gene ftsY 12619 13638 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_23650 13708 14355 gene locus_tag LOCUS_23660 13708 14355 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_23660 14499 14852 gene locus_tag LOCUS_23670 14499 14852 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 protein_id gnl|my_center|LOCUS_23670 14950 16335 gene locus_tag LOCUS_23680 gene ffh 14950 16335 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_23680 16412 16684 gene locus_tag LOCUS_23690 gene rpsP 16412 16684 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_23690 16707 16937 gene locus_tag LOCUS_23700 16707 16937 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_23700 17124 17642 gene locus_tag LOCUS_23710 gene rimM 17124 17642 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_23710 17646 18455 gene locus_tag LOCUS_23720 gene trmD 17646 18455 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_23720 18657 18812 gene locus_tag LOCUS_23730 18657 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 19141 18926 gene locus_tag LOCUS_23740 19141 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 19639 19983 gene locus_tag LOCUS_23750 gene rplS 19639 19983 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_23750 20106 20723 gene locus_tag LOCUS_23760 gene lepB 20106 20723 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662493.1 protein_id gnl|my_center|LOCUS_23760 20760 21626 gene locus_tag LOCUS_23770 gene ylqF 20760 21626 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_23770 21973 22593 gene locus_tag LOCUS_23780 21973 22593 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence23 1671 805 gene locus_tag LOCUS_23790 gene sdaAA 1671 805 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739226.1 protein_id gnl|my_center|LOCUS_23790 2387 1668 gene locus_tag LOCUS_23800 gene sdaAB 2387 1668 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_23800 4122 2512 gene locus_tag LOCUS_23810 4122 2512 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 protein_id gnl|my_center|LOCUS_23810 4368 5528 gene locus_tag LOCUS_23820 gene yhbH 4368 5528 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 protein_id gnl|my_center|LOCUS_23820 5992 5624 gene locus_tag LOCUS_23830 5992 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 6420 6256 gene locus_tag LOCUS_23840 6420 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 6669 6478 gene locus_tag LOCUS_23850 6669 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9870 6814 gene locus_tag LOCUS_23860 9870 6814 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_23860 11745 9886 gene locus_tag LOCUS_23870 11745 9886 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_23870 11877 12263 gene locus_tag LOCUS_23880 11877 12263 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279278.1 protein_id gnl|my_center|LOCUS_23880 12956 12303 gene locus_tag LOCUS_23890 12956 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 16210 12956 gene locus_tag LOCUS_23900 16210 12956 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_23900 19541 16239 gene locus_tag LOCUS_23910 19541 16239 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_23910 22368 19534 gene locus_tag LOCUS_23920 22368 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 23322 22522 gene locus_tag LOCUS_23930 23322 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 24612 23365 gene locus_tag LOCUS_23940 24612 23365 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922235.1 protein_id gnl|my_center|LOCUS_23940 25726 24776 gene locus_tag LOCUS_23950 25726 24776 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_23950 26251 25955 gene locus_tag LOCUS_23960 26251 25955 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689616.1 protein_id gnl|my_center|LOCUS_23960 27017 26253 gene locus_tag LOCUS_23970 27017 26253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_23970 27247 28212 gene locus_tag LOCUS_23980 27247 28212 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645284.1 protein_id gnl|my_center|LOCUS_23980 28543 30033 gene locus_tag LOCUS_23990 28543 30033 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_23990 32580 30235 gene locus_tag LOCUS_24000 32580 30235 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139603260.1 protein_id gnl|my_center|LOCUS_24000 33441 32923 gene locus_tag LOCUS_24010 33441 32923 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_24010 34992 33529 gene locus_tag LOCUS_24020 34992 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 35164 34979 gene locus_tag LOCUS_24030 35164 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 35249 36703 gene locus_tag LOCUS_24040 gene spoVR 35249 36703 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 protein_id gnl|my_center|LOCUS_24040 36924 37964 gene locus_tag LOCUS_24050 36924 37964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 38225 38587 gene locus_tag LOCUS_24060 38225 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 40713 38818 gene locus_tag LOCUS_24070 gene prkA 40713 38818 CDS product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 protein_id gnl|my_center|LOCUS_24070 40970 41716 gene locus_tag LOCUS_24080 40970 41716 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_24080 42898 41759 gene locus_tag LOCUS_24090 42898 41759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 43246 43527 gene locus_tag LOCUS_24100 43246 43527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 43524 44597 gene locus_tag LOCUS_24110 43524 44597 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_24110 44948 44694 gene locus_tag LOCUS_24120 44948 44694 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047831.1 protein_id gnl|my_center|LOCUS_24120 45681 45217 gene locus_tag LOCUS_24130 gene trmL 45681 45217 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_24130 46915 45827 gene locus_tag LOCUS_24140 gene serC 46915 45827 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_24140 48540 47116 gene locus_tag LOCUS_24150 gene glnA 48540 47116 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125190.1 protein_id gnl|my_center|LOCUS_24150 49883 48825 gene locus_tag LOCUS_24160 gene aroF 49883 48825 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_24160 50110 49913 gene locus_tag LOCUS_24170 50110 49913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 50986 50126 gene locus_tag LOCUS_24180 50986 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 52167 51205 gene locus_tag LOCUS_24190 gene ispH 52167 51205 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_24190 53723 52248 gene locus_tag LOCUS_24200 53723 52248 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_24200 54414 53725 gene locus_tag LOCUS_24210 54414 53725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_24210 56376 54520 gene locus_tag LOCUS_24220 56376 54520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 57242 56583 gene locus_tag LOCUS_24230 gene liaR 57242 56583 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_24230 58276 57239 gene locus_tag LOCUS_24240 gene liaS 58276 57239 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_24240 59246 58281 gene locus_tag LOCUS_24250 gene liaF 59246 58281 CDS product LiaRS two-component regulatory system accessory protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242605.1 protein_id gnl|my_center|LOCUS_24250 59773 59540 gene locus_tag LOCUS_24260 59773 59540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 60684 59866 gene locus_tag LOCUS_24270 60684 59866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 62698 60761 gene locus_tag LOCUS_24280 gene thrS 62698 60761 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786083.1 protein_id gnl|my_center|LOCUS_24280 63970 63095 gene locus_tag LOCUS_24290 63970 63095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 65262 64126 gene locus_tag LOCUS_24300 gene mqnC 65262 64126 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_24300 66622 65435 gene locus_tag LOCUS_24310 gene metC 66622 65435 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_24310 67860 66625 gene locus_tag LOCUS_24320 gene metI 67860 66625 CDS product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103910.1 protein_id gnl|my_center|LOCUS_24320 68831 67875 gene locus_tag LOCUS_24330 gene metA 68831 67875 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_24330 69335 69466 gene locus_tag LOCUS_24340 69335 69466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 69518 70453 gene locus_tag LOCUS_24350 gene corA 69518 70453 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_24350 71541 70531 gene locus_tag LOCUS_24360 71541 70531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 71812 72114 gene locus_tag LOCUS_24370 71812 72114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 73274 72123 gene locus_tag LOCUS_24380 73274 72123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 74158 73271 gene locus_tag LOCUS_24390 gene exnP 74158 73271 CDS product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 protein_id gnl|my_center|LOCUS_24390 74597 74238 gene locus_tag LOCUS_24400 74597 74238 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_24400 75595 74603 gene locus_tag LOCUS_24410 75595 74603 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_24410 76133 75567 gene locus_tag LOCUS_24420 76133 75567 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781294.1 protein_id gnl|my_center|LOCUS_24420 76523 76251 gene locus_tag LOCUS_24430 76523 76251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 77932 76721 gene locus_tag LOCUS_24440 77932 76721 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_24440 78446 77946 gene locus_tag LOCUS_24450 78446 77946 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_24450 78963 78601 gene locus_tag LOCUS_24460 78963 78601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 79220 78984 gene locus_tag LOCUS_24470 79220 78984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 79388 80623 gene locus_tag LOCUS_24480 79388 80623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 protein_id gnl|my_center|LOCUS_24480 81283 80687 gene locus_tag LOCUS_24490 81283 80687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 81758 81309 gene locus_tag LOCUS_24500 81758 81309 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_24500 84102 81742 gene locus_tag LOCUS_24510 84102 81742 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_24510 84322 84678 gene locus_tag LOCUS_24520 84322 84678 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_24520 85780 84752 gene locus_tag LOCUS_24530 85780 84752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 86107 86487 gene locus_tag LOCUS_24540 86107 86487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 88502 86544 gene locus_tag LOCUS_24550 88502 86544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 91127 88686 gene locus_tag LOCUS_24560 gene pheT 91127 88686 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_24560 92198 91164 gene locus_tag LOCUS_24570 gene pheS 92198 91164 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_24570 93165 92695 gene locus_tag LOCUS_24580 93165 92695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 94296 93334 gene locus_tag LOCUS_24590 gene nupQ 94296 93334 CDS product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 protein_id gnl|my_center|LOCUS_24590 95373 94297 gene locus_tag LOCUS_24600 95373 94297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_24600 96904 95366 gene locus_tag LOCUS_24610 96904 95366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_24610 98097 97057 gene locus_tag LOCUS_24620 98097 97057 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_24620 99948 98410 gene locus_tag LOCUS_24630 99948 98410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 101061 100153 gene locus_tag LOCUS_24640 101061 100153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 102742 101222 gene locus_tag LOCUS_24650 102742 101222 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 protein_id gnl|my_center|LOCUS_24650 103956 102856 gene locus_tag LOCUS_24660 103956 102856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 104743 104339 gene locus_tag LOCUS_24670 104743 104339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 105490 104951 gene locus_tag LOCUS_24680 gene ahpA 105490 104951 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_24680 106715 105639 gene locus_tag LOCUS_24690 gene leuB 106715 105639 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_24690 107903 106911 gene locus_tag LOCUS_24700 gene ilvC 107903 106911 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_24700 108589 108098 gene locus_tag LOCUS_24710 gene ilvN 108589 108098 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_24710 110331 108586 gene locus_tag LOCUS_24720 gene ilvB 110331 108586 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_24720 110887 111345 gene locus_tag LOCUS_24730 110887 111345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 111668 111342 gene locus_tag LOCUS_24740 111668 111342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 112205 111846 gene locus_tag LOCUS_24750 gene rplT 112205 111846 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355799.1 protein_id gnl|my_center|LOCUS_24750 112443 112243 gene locus_tag LOCUS_24760 gene rpmI 112443 112243 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_24760 112971 112477 gene locus_tag LOCUS_24770 gene infC 112971 112477 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_24770 114512 113274 gene locus_tag LOCUS_24780 114512 113274 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_24780 114926 115111 gene locus_tag LOCUS_24790 114926 115111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 115196 115726 gene locus_tag LOCUS_24800 115196 115726 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868582.1 protein_id gnl|my_center|LOCUS_24800 115780 116937 gene locus_tag LOCUS_24810 115780 116937 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_24810 117804 117082 gene locus_tag LOCUS_24820 gene trmB 117804 117082 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262605.1 protein_id gnl|my_center|LOCUS_24820 118329 119213 gene locus_tag LOCUS_24830 118329 119213 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 protein_id gnl|my_center|LOCUS_24830 119213 119803 gene locus_tag LOCUS_24840 119213 119803 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_24840 119845 120240 gene locus_tag LOCUS_24850 119845 120240 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145288.1 protein_id gnl|my_center|LOCUS_24850 120285 121349 gene locus_tag LOCUS_24860 120285 121349 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_24860 123237 121447 gene locus_tag LOCUS_24870 123237 121447 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_24870 125195 123291 gene locus_tag LOCUS_24880 gene recQ 125195 123291 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_24880 125395 126918 gene locus_tag LOCUS_24890 gene rlmD 125395 126918 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 protein_id gnl|my_center|LOCUS_24890 127509 128069 gene locus_tag LOCUS_24900 127509 128069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 128248 131322 gene locus_tag LOCUS_24910 128248 131322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 131529 133220 gene locus_tag LOCUS_24920 131529 133220 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_24920 134345 133320 gene locus_tag LOCUS_24930 gene rhaT 134345 133320 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_24930 135504 134527 gene locus_tag LOCUS_24940 135504 134527 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_24940 138862 135773 gene locus_tag LOCUS_24950 138862 135773 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477902.1 protein_id gnl|my_center|LOCUS_24950 140708 138969 gene locus_tag LOCUS_24960 140708 138969 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761079.1 protein_id gnl|my_center|LOCUS_24960 141208 141621 gene locus_tag LOCUS_24970 141208 141621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 145085 141726 gene locus_tag LOCUS_24980 145085 141726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 146169 145417 gene locus_tag LOCUS_24990 gene cobA 146169 145417 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 protein_id gnl|my_center|LOCUS_24990 147092 146223 gene locus_tag LOCUS_25000 147092 146223 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_25000 147453 147124 gene locus_tag LOCUS_25010 gene nirD 147453 147124 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_25010 149955 147532 gene locus_tag LOCUS_25020 gene nasD 149955 147532 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_25020 150239 150841 gene locus_tag LOCUS_25030 150239 150841 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006699921.1 protein_id gnl|my_center|LOCUS_25030 150861 151910 gene locus_tag LOCUS_25040 gene trpD 150861 151910 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 protein_id gnl|my_center|LOCUS_25040 152440 152078 gene locus_tag LOCUS_25050 152440 152078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 152780 153655 gene locus_tag LOCUS_25060 152780 153655 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713634.1 protein_id gnl|my_center|LOCUS_25060 153973 154641 gene locus_tag LOCUS_25070 gene queC 153973 154641 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 protein_id gnl|my_center|LOCUS_25070 154638 155138 gene locus_tag LOCUS_25080 gene queD 154638 155138 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368412.1 protein_id gnl|my_center|LOCUS_25080 155123 155941 gene locus_tag LOCUS_25090 gene queE 155123 155941 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090918384.1 protein_id gnl|my_center|LOCUS_25090 155979 156476 gene locus_tag LOCUS_25100 gene queF 155979 156476 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_25100 156842 156579 gene locus_tag LOCUS_25110 156842 156579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 157050 157778 gene locus_tag LOCUS_25120 157050 157778 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_25120 157793 158878 gene locus_tag LOCUS_25130 gene pepQ 157793 158878 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_25130 159741 159028 gene locus_tag LOCUS_25140 159741 159028 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 protein_id gnl|my_center|LOCUS_25140 160054 161742 gene locus_tag LOCUS_25150 160054 161742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 161868 161638 gene locus_tag LOCUS_25160 161868 161638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 162653 161865 gene locus_tag LOCUS_25170 162653 161865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_25170 163696 162650 gene locus_tag LOCUS_25180 163696 162650 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_25180 164712 163693 gene locus_tag LOCUS_25190 164712 163693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_25190 165362 166363 gene locus_tag LOCUS_25200 gene lplJ 165362 166363 CDS product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 protein_id gnl|my_center|LOCUS_25200 166470 167270 gene locus_tag LOCUS_25210 166470 167270 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_25210 168137 167358 gene locus_tag LOCUS_25220 168137 167358 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_25220 169344 168283 gene locus_tag LOCUS_25230 169344 168283 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729898.1 protein_id gnl|my_center|LOCUS_25230 170151 169561 gene locus_tag LOCUS_25240 170151 169561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 170787 170155 gene locus_tag LOCUS_25250 170787 170155 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_25250 172348 170993 gene locus_tag LOCUS_25260 172348 170993 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_25260 172533 173435 gene locus_tag LOCUS_25270 172533 173435 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_25270 175620 173596 gene locus_tag LOCUS_25280 gene tkt 175620 173596 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_25280 176920 175937 gene locus_tag LOCUS_25290 gene purU 176920 175937 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_25290 178170 177061 gene locus_tag LOCUS_25300 178170 177061 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_25300 178509 179414 gene locus_tag LOCUS_25310 178509 179414 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019638483.1 protein_id gnl|my_center|LOCUS_25310 181229 179457 gene locus_tag LOCUS_25320 181229 179457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 181753 181241 gene locus_tag LOCUS_25330 181753 181241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 182914 181799 gene locus_tag LOCUS_25340 182914 181799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 185120 182883 gene locus_tag LOCUS_25350 185120 182883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 185880 185218 gene locus_tag LOCUS_25360 185880 185218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 186074 185880 gene locus_tag LOCUS_25370 186074 185880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 186978 186106 gene locus_tag LOCUS_25380 186978 186106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 187541 186990 gene locus_tag LOCUS_25390 187541 186990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 189096 187795 gene locus_tag LOCUS_25400 189096 187795 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_25400 190237 189071 gene locus_tag LOCUS_25410 190237 189071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 190857 190390 gene locus_tag LOCUS_25420 190857 190390 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_25420 191283 190882 gene locus_tag LOCUS_25430 191283 190882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 191722 191441 gene locus_tag LOCUS_25440 191722 191441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 192321 191899 gene locus_tag LOCUS_25450 192321 191899 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_25450 192628 193977 gene locus_tag LOCUS_25460 192628 193977 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_25460 194240 194156 gene locus_tag LOCUS_t00450 194240 194156 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 194705 194334 gene locus_tag LOCUS_25470 194705 194334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 194857 195489 gene locus_tag LOCUS_25480 194857 195489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 195742 195658 gene locus_tag LOCUS_t00460 195742 195658 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 195821 195747 gene locus_tag LOCUS_t00470 195821 195747 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 196051 196608 gene locus_tag LOCUS_25490 196051 196608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25490 196592 196843 gene locus_tag LOCUS_25500 196592 196843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25500 196840 197709 gene locus_tag LOCUS_25510 gene ywpJ 196840 197709 CDS product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 protein_id gnl|my_center|LOCUS_25510 197910 197820 gene locus_tag LOCUS_t00480 197910 197820 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 197994 197919 gene locus_tag LOCUS_t00490 197994 197919 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 198266 198042 gene locus_tag LOCUS_25520 198266 198042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 198805 198329 gene locus_tag LOCUS_25530 198805 198329 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640904.1 protein_id gnl|my_center|LOCUS_25530 198907 199284 gene locus_tag LOCUS_25540 198907 199284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 199353 199496 gene locus_tag LOCUS_25550 199353 199496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 201868 199625 gene locus_tag LOCUS_25560 201868 199625 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477896.1 protein_id gnl|my_center|LOCUS_25560 202410 202060 gene locus_tag LOCUS_25570 gene ndoA 202410 202060 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_25570 202695 202414 gene locus_tag LOCUS_25580 202695 202414 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393653.1 protein_id gnl|my_center|LOCUS_25580 204240 202981 gene locus_tag LOCUS_25590 gene alr 204240 202981 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_25590 205457 204375 gene locus_tag LOCUS_25600 205457 204375 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_25600 207360 205729 gene locus_tag LOCUS_25610 207360 205729 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836509.1 protein_id gnl|my_center|LOCUS_25610 208950 207478 gene locus_tag LOCUS_25620 gene pnbA 208950 207478 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_25620 209182 209721 gene locus_tag LOCUS_25630 209182 209721 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723476.1 protein_id gnl|my_center|LOCUS_25630 211258 209849 gene locus_tag LOCUS_25640 gene dgt 211258 209849 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185138301.1 protein_id gnl|my_center|LOCUS_25640 211520 211732 gene locus_tag LOCUS_25650 211520 211732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 211752 212603 gene locus_tag LOCUS_25660 211752 212603 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_25660 213504 212806 gene locus_tag LOCUS_25670 gene narI 213504 212806 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969212.1 protein_id gnl|my_center|LOCUS_25670 214174 213518 gene locus_tag LOCUS_25680 214174 213518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 215670 214171 gene locus_tag LOCUS_25690 gene narH 215670 214171 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_25690 219343 215660 gene locus_tag LOCUS_25700 219343 215660 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_25700 219623 219372 gene locus_tag LOCUS_25710 219623 219372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 220016 219636 gene locus_tag LOCUS_25720 220016 219636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 220434 219967 gene locus_tag LOCUS_25730 220434 219967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 221933 220437 gene locus_tag LOCUS_25740 gene narK 221933 220437 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841841.1 protein_id gnl|my_center|LOCUS_25740 222461 227581 gene locus_tag LOCUS_25750 222461 227581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 227825 230491 gene locus_tag LOCUS_25760 227825 230491 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745011.1 protein_id gnl|my_center|LOCUS_25760 230680 232722 gene locus_tag LOCUS_25770 gene mcpB 230680 232722 CDS product methyl-accepting chemotaxis protein McpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243461.1 protein_id gnl|my_center|LOCUS_25770 232879 235125 gene locus_tag LOCUS_25780 232879 235125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 235128 236033 gene locus_tag LOCUS_25790 235128 236033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 236147 238207 gene locus_tag LOCUS_25800 236147 238207 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517290.1 protein_id gnl|my_center|LOCUS_25800 238427 239185 gene locus_tag LOCUS_25810 238427 239185 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_25810 240231 239320 gene locus_tag LOCUS_25820 240231 239320 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181430.1 protein_id gnl|my_center|LOCUS_25820 242111 240564 gene locus_tag LOCUS_25830 242111 240564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 242278 243867 gene locus_tag LOCUS_25840 242278 243867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 244657 243965 gene locus_tag LOCUS_25850 244657 243965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 245113 244661 gene locus_tag LOCUS_25860 245113 244661 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245242.1 protein_id gnl|my_center|LOCUS_25860 245967 245230 gene locus_tag LOCUS_25870 245967 245230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 246331 247314 gene locus_tag LOCUS_25880 246331 247314 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_25880 247394 248422 gene locus_tag LOCUS_25890 247394 248422 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 protein_id gnl|my_center|LOCUS_25890 248422 249435 gene locus_tag LOCUS_25900 248422 249435 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983751.1 protein_id gnl|my_center|LOCUS_25900 249605 250297 gene locus_tag LOCUS_25910 249605 250297 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_25910 251177 250494 gene locus_tag LOCUS_25920 251177 250494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 253220 251286 gene locus_tag LOCUS_25930 gene bceB 253220 251286 CDS product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 protein_id gnl|my_center|LOCUS_25930 253971 253210 gene locus_tag LOCUS_25940 gene bceA 253971 253210 CDS product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 protein_id gnl|my_center|LOCUS_25940 255159 254155 gene locus_tag LOCUS_25950 gene bceS 255159 254155 CDS product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 protein_id gnl|my_center|LOCUS_25950 255845 255156 gene locus_tag LOCUS_25960 gene bceR 255845 255156 CDS product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 protein_id gnl|my_center|LOCUS_25960 257127 255892 gene locus_tag LOCUS_25970 257127 255892 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 protein_id gnl|my_center|LOCUS_25970 257885 257124 gene locus_tag LOCUS_25980 257885 257124 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_25980 258005 258853 gene locus_tag LOCUS_25990 258005 258853 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 protein_id gnl|my_center|LOCUS_25990 259020 260210 gene locus_tag LOCUS_26000 259020 260210 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_26000 262197 260359 gene locus_tag LOCUS_26010 262197 260359 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732387.1 protein_id gnl|my_center|LOCUS_26010 262549 262220 gene locus_tag LOCUS_26020 262549 262220 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_26020 262868 263881 gene locus_tag LOCUS_26030 gene fabHB 262868 263881 CDS product beta-ketoacyl-ACP synthase III FabHB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233200.1 protein_id gnl|my_center|LOCUS_26030 265194 263947 gene locus_tag LOCUS_26040 265194 263947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 265470 266183 gene locus_tag LOCUS_26050 265470 266183 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_26050 266187 266891 gene locus_tag LOCUS_26060 266187 266891 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_26060 266913 268907 gene locus_tag LOCUS_26070 266913 268907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 269092 269808 gene locus_tag LOCUS_26080 269092 269808 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_26080 269925 270914 gene locus_tag LOCUS_26090 gene iolU 269925 270914 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_26090 271060 272598 gene locus_tag LOCUS_26100 271060 272598 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229620.1 protein_id gnl|my_center|LOCUS_26100 272603 273172 gene locus_tag LOCUS_26110 272603 273172 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 protein_id gnl|my_center|LOCUS_26110 275047 273332 gene locus_tag LOCUS_26120 gene malS 275047 273332 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227639.1 protein_id gnl|my_center|LOCUS_26120 275602 275396 gene locus_tag LOCUS_26130 275602 275396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 275621 276154 gene locus_tag LOCUS_26140 275621 276154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 277368 276160 gene locus_tag LOCUS_26150 277368 276160 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 protein_id gnl|my_center|LOCUS_26150 277649 278284 gene locus_tag LOCUS_26160 277649 278284 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_26160 278296 278835 gene locus_tag LOCUS_26170 278296 278835 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_26170 280287 278986 gene locus_tag LOCUS_26180 280287 278986 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243069.1 protein_id gnl|my_center|LOCUS_26180 281033 280326 gene locus_tag LOCUS_26190 gene deoD 281033 280326 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110703.1 protein_id gnl|my_center|LOCUS_26190 281462 283756 gene locus_tag LOCUS_26200 281462 283756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 284751 283804 gene locus_tag LOCUS_26210 284751 283804 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050612.1 protein_id gnl|my_center|LOCUS_26210 284956 285915 gene locus_tag LOCUS_26220 284956 285915 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_26220 286033 286962 gene locus_tag LOCUS_26230 gene pstC 286033 286962 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 protein_id gnl|my_center|LOCUS_26230 286959 287846 gene locus_tag LOCUS_26240 gene pstA 286959 287846 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_26240 287865 288620 gene locus_tag LOCUS_26250 gene pstB 287865 288620 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990004.1 protein_id gnl|my_center|LOCUS_26250 289765 288680 gene locus_tag LOCUS_26260 289765 288680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 289989 290978 gene locus_tag LOCUS_26270 289989 290978 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_26270 290975 291883 gene locus_tag LOCUS_26280 290975 291883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_26280 291880 292626 gene locus_tag LOCUS_26290 291880 292626 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_26290 293742 292723 gene locus_tag LOCUS_26300 293742 292723 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807839.1 protein_id gnl|my_center|LOCUS_26300 294821 293850 gene locus_tag LOCUS_26310 294821 293850 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_26310 295097 294978 gene locus_tag LOCUS_26320 295097 294978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 295387 296523 gene locus_tag LOCUS_26330 295387 296523 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 protein_id gnl|my_center|LOCUS_26330 297610 296687 gene locus_tag LOCUS_26340 297610 296687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 298808 297705 gene locus_tag LOCUS_26350 298808 297705 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_26350 299098 300675 gene locus_tag LOCUS_26360 gene ppx 299098 300675 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 protein_id gnl|my_center|LOCUS_26360 302716 300635 gene locus_tag LOCUS_26370 302716 300635 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_26370 303389 302889 gene locus_tag LOCUS_26380 gene ybaK 303389 302889 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_26380 <304722 303580 gene locus_tag LOCUS_26390 <304722 303580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232565.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase >Feature sequence24 2713 1568 gene locus_tag LOCUS_26400 2713 1568 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_26400 3818 2739 gene locus_tag LOCUS_26410 3818 2739 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_26410 4226 4050 gene locus_tag LOCUS_26420 4226 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 4780 4475 gene locus_tag LOCUS_26430 4780 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 5133 4777 gene locus_tag LOCUS_26440 5133 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 5471 5184 gene locus_tag LOCUS_26450 5471 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 7016 5634 gene locus_tag LOCUS_26460 7016 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 8101 7031 gene locus_tag LOCUS_26470 8101 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 9039 8308 gene locus_tag LOCUS_26480 9039 8308 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_26480 9801 9055 gene locus_tag LOCUS_26490 9801 9055 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965644.1 protein_id gnl|my_center|LOCUS_26490 10856 9798 gene locus_tag LOCUS_26500 10856 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 11730 11008 gene locus_tag LOCUS_26510 11730 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 13323 12136 gene locus_tag LOCUS_26520 13323 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 13547 14650 gene locus_tag LOCUS_26530 13547 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 14777 15565 gene locus_tag LOCUS_26540 14777 15565 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255010.1 protein_id gnl|my_center|LOCUS_26540 15891 15748 gene locus_tag LOCUS_26550 15891 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 16767 15979 gene locus_tag LOCUS_26560 16767 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 <17902 16917 gene locus_tag LOCUS_26570 <17902 16917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224276.1:PLP-dependent aminotransferase family protein >Feature sequence25 73 228 gene locus_tag LOCUS_26580 73 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 397 509 gene locus_tag LOCUS_r00070 397 509 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 840 2354 gene locus_tag LOCUS_26590 840 2354 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813543.1 protein_id gnl|my_center|LOCUS_26590 2572 3804 gene locus_tag LOCUS_26600 2572 3804 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_26600 3797 4594 gene locus_tag LOCUS_26610 3797 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4712 5800 gene locus_tag LOCUS_26620 4712 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 6052 6306 gene locus_tag LOCUS_26630 6052 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 6297 6938 gene locus_tag LOCUS_26640 gene rsmD 6297 6938 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 protein_id gnl|my_center|LOCUS_26640 6935 7468 gene locus_tag LOCUS_26650 gene coaD 6935 7468 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_26650 8779 7478 gene locus_tag LOCUS_26660 gene spoVV 8779 7478 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_26660 8937 9962 gene locus_tag LOCUS_26670 8937 9962 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476283.1 protein_id gnl|my_center|LOCUS_26670 <10936 10067 gene locus_tag LOCUS_26680 <10936 10067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930700.1:nucleotidyltransferase >Feature sequence26 782 2794 gene locus_tag LOCUS_26690 gene ligA 782 2794 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_26690 4220 2970 gene locus_tag LOCUS_26700 4220 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence27 14 >1432 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactctacgtgagtgcgtggattgaaat >Feature sequence28 422 347 gene locus_tag LOCUS_t00500 422 347 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 541 465 gene locus_tag LOCUS_t00510 541 465 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 691 580 gene locus_tag LOCUS_r00080 691 580 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence29 637 362 gene locus_tag LOCUS_26710 637 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence30 >Feature sequence31 >Feature sequence32 >Feature sequence33 421 209 gene locus_tag LOCUS_26720 421 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence34 1294 281 gene locus_tag LOCUS_26730 1294 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 4149 1594 gene locus_tag LOCUS_26740 gene gyrA 4149 1594 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_26740 4731 5390 gene locus_tag LOCUS_26750 4731 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 7355 5445 gene locus_tag LOCUS_26760 gene gyrB 7355 5445 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_26760 7694 7446 gene locus_tag LOCUS_26770 gene remB 7694 7446 CDS product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 protein_id gnl|my_center|LOCUS_26770 8823 7711 gene locus_tag LOCUS_26780 gene recF 8823 7711 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_26780 9103 8888 gene locus_tag LOCUS_26790 gene yaaA 9103 8888 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821364.1 protein_id gnl|my_center|LOCUS_26790 10274 9132 gene locus_tag LOCUS_26800 gene dnaN 10274 9132 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_26800 11898 10549 gene locus_tag LOCUS_26810 gene dnaA 11898 10549 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_26810 14169 12592 gene locus_tag LOCUS_26820 gene gntK 14169 12592 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 protein_id gnl|my_center|LOCUS_26820 15632 14271 gene locus_tag LOCUS_26830 15632 14271 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260208.1 protein_id gnl|my_center|LOCUS_26830 16469 15792 gene locus_tag LOCUS_26840 gene gntR 16469 15792 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167470.1 protein_id gnl|my_center|LOCUS_26840 16954 17088 gene locus_tag LOCUS_26850 gene rpmH 16954 17088 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 protein_id gnl|my_center|LOCUS_26850 17349 17696 gene locus_tag LOCUS_26860 gene rnpA 17349 17696 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726628.1 protein_id gnl|my_center|LOCUS_26860 17774 18661 gene locus_tag LOCUS_26870 gene yidC 17774 18661 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723726.1 protein_id gnl|my_center|LOCUS_26870 18658 19377 gene locus_tag LOCUS_26880 18658 19377 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022803.1 protein_id gnl|my_center|LOCUS_26880 19568 20950 gene locus_tag LOCUS_26890 gene mnmE 19568 20950 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831768.1 protein_id gnl|my_center|LOCUS_26890 21110 22999 gene locus_tag LOCUS_26900 gene mnmG 21110 22999 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_26900 23008 23730 gene locus_tag LOCUS_26910 gene rsmG 23008 23730 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_26910 24149 24964 gene locus_tag LOCUS_26920 gene noc 24149 24964 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799028.1 protein_id gnl|my_center|LOCUS_26920 25092 25853 gene locus_tag LOCUS_26930 gene soj 25092 25853 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_26930 25846 26685 gene locus_tag LOCUS_26940 gene spo0J 25846 26685 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_26940 26818 27951 gene locus_tag LOCUS_26950 26818 27951 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_26950 28020 28520 gene locus_tag LOCUS_26960 28020 28520 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966988.1 protein_id gnl|my_center|LOCUS_26960 29103 28495 gene locus_tag LOCUS_26970 gene yyaC 29103 28495 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_26970 29316 29582 gene locus_tag LOCUS_26980 29316 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 29579 30475 gene locus_tag LOCUS_26990 29579 30475 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_26990 30511 30750 gene locus_tag LOCUS_27000 30511 30750 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_27000 30816 30907 gene locus_tag LOCUS_t00520 30816 30907 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31928 31023 gene locus_tag LOCUS_27010 31928 31023 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050603.1 protein_id gnl|my_center|LOCUS_27010 32561 32364 gene locus_tag LOCUS_27020 32561 32364 CDS product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531421.1 protein_id gnl|my_center|LOCUS_27020 32762 33046 gene locus_tag LOCUS_27030 gene rpsF 32762 33046 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_27030 33087 33578 gene locus_tag LOCUS_27040 gene ssb 33087 33578 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_27040 33601 33873 gene locus_tag LOCUS_27050 gene rpsR 33601 33873 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897044.1 protein_id gnl|my_center|LOCUS_27050 34641 36416 gene locus_tag LOCUS_27060 34641 36416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705202.1 protein_id gnl|my_center|LOCUS_27060 36489 37451 gene locus_tag LOCUS_27070 36489 37451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860748.1 protein_id gnl|my_center|LOCUS_27070 37464 38393 gene locus_tag LOCUS_27080 37464 38393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451064.1 protein_id gnl|my_center|LOCUS_27080 38405 39412 gene locus_tag LOCUS_27090 38405 39412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_27090 39409 40374 gene locus_tag LOCUS_27100 39409 40374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294513.1 protein_id gnl|my_center|LOCUS_27100 40657 41739 gene locus_tag LOCUS_27110 gene lytR 40657 41739 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_27110 41906 42328 gene locus_tag LOCUS_27120 41906 42328 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966935.1 protein_id gnl|my_center|LOCUS_27120 42451 42753 gene locus_tag LOCUS_27130 42451 42753 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420530.1 protein_id gnl|my_center|LOCUS_27130 42759 43673 gene locus_tag LOCUS_27140 42759 43673 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814840.1 protein_id gnl|my_center|LOCUS_27140 43686 45662 gene locus_tag LOCUS_27150 43686 45662 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_27150 45659 46105 gene locus_tag LOCUS_27160 gene rplI 45659 46105 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864228.1 protein_id gnl|my_center|LOCUS_27160 46107 47468 gene locus_tag LOCUS_27170 gene dnaB 46107 47468 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_27170 47790 49076 gene locus_tag LOCUS_27180 gene purA 47790 49076 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_27180 50184 49183 gene locus_tag LOCUS_27190 50184 49183 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646402.1 protein_id gnl|my_center|LOCUS_27190 50606 50274 gene locus_tag LOCUS_27200 50606 50274 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426919.1 protein_id gnl|my_center|LOCUS_27200 50871 51929 gene locus_tag LOCUS_27210 gene bcd 50871 51929 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_27210 52976 52050 gene locus_tag LOCUS_27220 52976 52050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 53292 54335 gene locus_tag LOCUS_27230 53292 54335 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_27230 54619 55401 gene locus_tag LOCUS_27240 54619 55401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 55575 57212 gene locus_tag LOCUS_27250 55575 57212 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813688.1 protein_id gnl|my_center|LOCUS_27250 57409 60234 gene locus_tag LOCUS_27260 57409 60234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 60390 61109 gene locus_tag LOCUS_27270 gene yycF 60390 61109 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_27270 61111 62949 gene locus_tag LOCUS_27280 gene walK 61111 62949 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 protein_id gnl|my_center|LOCUS_27280 62946 64223 gene locus_tag LOCUS_27290 62946 64223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 64292 65035 gene locus_tag LOCUS_27300 64292 65035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 65035 65850 gene locus_tag LOCUS_27310 65035 65850 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_27310 66133 65927 gene locus_tag LOCUS_27320 66133 65927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 66708 68054 gene locus_tag LOCUS_27330 66708 68054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 68161 68418 gene locus_tag LOCUS_27340 68161 68418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 68762 69241 gene locus_tag LOCUS_27350 gene rlmH 68762 69241 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 protein_id gnl|my_center|LOCUS_27350 69510 69283 gene locus_tag LOCUS_27360 69510 69283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 69691 70257 gene locus_tag LOCUS_27370 69691 70257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 70698 70390 gene locus_tag LOCUS_27380 70698 70390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 71024 71827 gene locus_tag LOCUS_27390 71024 71827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 72354 71896 gene locus_tag LOCUS_27400 72354 71896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 74031 72382 gene locus_tag LOCUS_27410 74031 72382 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_27410 75663 74110 gene locus_tag LOCUS_27420 75663 74110 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_27420 75833 75693 gene locus_tag LOCUS_27430 75833 75693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 77769 75997 gene locus_tag LOCUS_27440 77769 75997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 78206 77796 gene locus_tag LOCUS_27450 78206 77796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 80079 78319 gene locus_tag LOCUS_27460 80079 78319 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272653.1 protein_id gnl|my_center|LOCUS_27460 81319 80474 gene locus_tag LOCUS_27470 81319 80474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 81439 81918 gene locus_tag LOCUS_27480 81439 81918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 82116 81985 gene locus_tag LOCUS_27490 82116 81985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 82445 82134 gene locus_tag LOCUS_27500 82445 82134 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_27500 82966 82466 gene locus_tag LOCUS_27510 82966 82466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 83405 83028 gene locus_tag LOCUS_27520 83405 83028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 83693 85189 gene locus_tag LOCUS_27530 83693 85189 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_27530 85179 86474 gene locus_tag LOCUS_27540 85179 86474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 86490 89564 gene locus_tag LOCUS_27550 86490 89564 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_27550 89658 90182 gene locus_tag LOCUS_27560 89658 90182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 90179 91252 gene locus_tag LOCUS_27570 90179 91252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 91482 92873 gene locus_tag LOCUS_27580 91482 92873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 93667 93206 gene locus_tag LOCUS_27590 93667 93206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033630773.1 protein_id gnl|my_center|LOCUS_27590 94080 93682 gene locus_tag LOCUS_27600 94080 93682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 94433 94077 gene locus_tag LOCUS_27610 94433 94077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27610 94804 95310 gene locus_tag LOCUS_27620 94804 95310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 95337 95654 gene locus_tag LOCUS_27630 95337 95654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 96476 96994 gene locus_tag LOCUS_27640 96476 96994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 97577 99661 gene locus_tag LOCUS_27650 gene cas3 97577 99661 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_27650 99685 100419 gene locus_tag LOCUS_27660 gene cas5c 99685 100419 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_27660 100416 102200 gene locus_tag LOCUS_27670 gene cas8c 100416 102200 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_27670 102197 103108 gene locus_tag LOCUS_27680 gene cas7c 102197 103108 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_27680 103821 103387 gene locus_tag LOCUS_27690 103821 103387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 104331 103843 gene locus_tag LOCUS_27700 104331 103843 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_27700 105178 105309 gene locus_tag LOCUS_27710 105178 105309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 105990 105349 gene locus_tag LOCUS_27720 105990 105349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 106097 106186 gene locus_tag LOCUS_t00530 106097 106186 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 106402 106551 gene locus_tag LOCUS_27730 106402 106551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 106545 108233 gene locus_tag LOCUS_27740 106545 108233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 109283 108456 gene locus_tag LOCUS_27750 109283 108456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_27750 109399 110067 gene locus_tag LOCUS_27760 109399 110067 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081691.1 protein_id gnl|my_center|LOCUS_27760 110812 110231 gene locus_tag LOCUS_27770 110812 110231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 protein_id gnl|my_center|LOCUS_27770 111012 111878 gene locus_tag LOCUS_27780 111012 111878 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_27780 112154 113125 gene locus_tag LOCUS_27790 112154 113125 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557395.1 protein_id gnl|my_center|LOCUS_27790 113115 113549 gene locus_tag LOCUS_27800 113115 113549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 113895 113638 gene locus_tag LOCUS_27810 113895 113638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 114097 114459 gene locus_tag LOCUS_27820 114097 114459 CDS product nucleotide excision repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228617.1 protein_id gnl|my_center|LOCUS_27820 114460 116007 gene locus_tag LOCUS_27830 114460 116007 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997001.1 protein_id gnl|my_center|LOCUS_27830 116089 116325 gene locus_tag LOCUS_27840 116089 116325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 118045 116330 gene locus_tag LOCUS_27850 118045 116330 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945404.1 protein_id gnl|my_center|LOCUS_27850 118365 118042 gene locus_tag LOCUS_27860 118365 118042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 118541 119104 gene locus_tag LOCUS_27870 118541 119104 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 protein_id gnl|my_center|LOCUS_27870 119171 120199 gene locus_tag LOCUS_27880 119171 120199 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 protein_id gnl|my_center|LOCUS_27880 120839 120393 gene locus_tag LOCUS_27890 120839 120393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 121263 120811 gene locus_tag LOCUS_27900 121263 120811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 121362 121802 gene locus_tag LOCUS_27910 121362 121802 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083574.1 protein_id gnl|my_center|LOCUS_27910 121828 122304 gene locus_tag LOCUS_27920 121828 122304 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246529.1 protein_id gnl|my_center|LOCUS_27920 122285 122728 gene locus_tag LOCUS_27930 122285 122728 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246643.1 protein_id gnl|my_center|LOCUS_27930 122907 123911 gene locus_tag LOCUS_27940 122907 123911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 124087 124770 gene locus_tag LOCUS_27950 124087 124770 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_27950 125603 124842 gene locus_tag LOCUS_27960 125603 124842 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_27960 125808 126485 gene locus_tag LOCUS_27970 gene pnuC 125808 126485 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_27970 126482 127507 gene locus_tag LOCUS_27980 126482 127507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 127605 128489 gene locus_tag LOCUS_27990 127605 128489 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_27990 129579 128599 gene locus_tag LOCUS_28000 129579 128599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 129836 130453 gene locus_tag LOCUS_28010 129836 130453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 130546 131730 gene locus_tag LOCUS_28020 130546 131730 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475872.1 protein_id gnl|my_center|LOCUS_28020 132061 131834 gene locus_tag LOCUS_28030 132061 131834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 132094 132303 gene locus_tag LOCUS_28040 132094 132303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 132506 134809 gene locus_tag LOCUS_28050 132506 134809 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_28050 136474 134798 gene locus_tag LOCUS_28060 136474 134798 CDS product DUF6138 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494815.1 protein_id gnl|my_center|LOCUS_28060 136698 137480 gene locus_tag LOCUS_28070 136698 137480 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_28070 137530 138231 gene locus_tag LOCUS_28080 137530 138231 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_28080 138408 139178 gene locus_tag LOCUS_28090 138408 139178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 139474 141501 gene locus_tag LOCUS_28100 139474 141501 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_28100 142481 141717 gene locus_tag LOCUS_28110 142481 141717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_28110 142657 143916 gene locus_tag LOCUS_28120 142657 143916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965889.1 protein_id gnl|my_center|LOCUS_28120 144048 145187 gene locus_tag LOCUS_28130 144048 145187 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_28130 145450 146868 gene locus_tag LOCUS_28140 145450 146868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 147074 148123 gene locus_tag LOCUS_28150 147074 148123 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936347.1 protein_id gnl|my_center|LOCUS_28150 148120 149277 gene locus_tag LOCUS_28160 148120 149277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 149270 150199 gene locus_tag LOCUS_28170 149270 150199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 150192 151988 gene locus_tag LOCUS_28180 150192 151988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 152055 153260 gene locus_tag LOCUS_28190 152055 153260 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259593.1 protein_id gnl|my_center|LOCUS_28190 153284 154429 gene locus_tag LOCUS_28200 153284 154429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 154528 155292 gene locus_tag LOCUS_28210 154528 155292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 155289 155831 gene locus_tag LOCUS_28220 155289 155831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 157387 155894 gene locus_tag LOCUS_28230 157387 155894 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_28230 158144 157431 gene locus_tag LOCUS_28240 158144 157431 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_28240 158480 158196 gene locus_tag LOCUS_28250 158480 158196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 158584 159210 gene locus_tag LOCUS_28260 158584 159210 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966530.1 protein_id gnl|my_center|LOCUS_28260 159516 160679 gene locus_tag LOCUS_28270 159516 160679 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_28270 160837 162531 gene locus_tag LOCUS_28280 160837 162531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 162575 163267 gene locus_tag LOCUS_28290 162575 163267 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369298.1 protein_id gnl|my_center|LOCUS_28290 164560 163691 gene locus_tag LOCUS_28300 164560 163691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 164661 165356 gene locus_tag LOCUS_28310 164661 165356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 165757 166215 gene locus_tag LOCUS_28320 165757 166215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 166726 170931 gene locus_tag LOCUS_28330 166726 170931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 171321 172844 gene locus_tag LOCUS_28340 171321 172844 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 protein_id gnl|my_center|LOCUS_28340 173018 175924 gene locus_tag LOCUS_28350 173018 175924 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582726.1 protein_id gnl|my_center|LOCUS_28350 176879 176022 gene locus_tag LOCUS_28360 176879 176022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_28360 177347 176901 gene locus_tag LOCUS_28370 177347 176901 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102120.1 protein_id gnl|my_center|LOCUS_28370 177621 178667 gene locus_tag LOCUS_28380 177621 178667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 179952 178825 gene locus_tag LOCUS_28390 gene nspC 179952 178825 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_28390 181203 179953 gene locus_tag LOCUS_28400 181203 179953 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_28400 181858 182334 gene locus_tag LOCUS_28410 181858 182334 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902435.1 protein_id gnl|my_center|LOCUS_28410 183234 182392 gene locus_tag LOCUS_28420 183234 182392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 183965 183324 gene locus_tag LOCUS_28430 183965 183324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 187405 184088 gene locus_tag LOCUS_28440 187405 184088 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011074.1 protein_id gnl|my_center|LOCUS_28440 187621 188676 gene locus_tag LOCUS_28450 187621 188676 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_28450 188897 190150 gene locus_tag LOCUS_28460 188897 190150 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012262.1 protein_id gnl|my_center|LOCUS_28460 192331 190316 gene locus_tag LOCUS_28470 gene tlpB 192331 190316 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 protein_id gnl|my_center|LOCUS_28470 192584 192736 gene locus_tag LOCUS_28480 192584 192736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 192721 192936 gene locus_tag LOCUS_28490 192721 192936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 192964 193917 gene locus_tag LOCUS_28500 192964 193917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 193914 195107 gene locus_tag LOCUS_28510 193914 195107 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287856.1 protein_id gnl|my_center|LOCUS_28510 195108 195749 gene locus_tag LOCUS_28520 195108 195749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 195746 196138 gene locus_tag LOCUS_28530 195746 196138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 196169 197185 gene locus_tag LOCUS_28540 196169 197185 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124219794.1 protein_id gnl|my_center|LOCUS_28540 198064 197345 gene locus_tag LOCUS_28550 198064 197345 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236030.1 protein_id gnl|my_center|LOCUS_28550 198844 198110 gene locus_tag LOCUS_28560 198844 198110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_28560 199375 199031 gene locus_tag LOCUS_28570 199375 199031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 204352 199433 gene locus_tag LOCUS_28580 204352 199433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 204990 204622 gene locus_tag LOCUS_28590 204990 204622 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156908.1 protein_id gnl|my_center|LOCUS_28590 205263 206321 gene locus_tag LOCUS_28600 205263 206321 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 protein_id gnl|my_center|LOCUS_28600 206536 207495 gene locus_tag LOCUS_28610 206536 207495 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964530.1 protein_id gnl|my_center|LOCUS_28610 207564 208490 gene locus_tag LOCUS_28620 207564 208490 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_28620 209596 208550 gene locus_tag LOCUS_28630 209596 208550 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_28630 209747 210175 gene locus_tag LOCUS_28640 209747 210175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 210401 210856 gene locus_tag LOCUS_28650 210401 210856 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963594.1 protein_id gnl|my_center|LOCUS_28650 210874 212127 gene locus_tag LOCUS_28660 gene fabF 210874 212127 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_28660 212163 213818 gene locus_tag LOCUS_28670 212163 213818 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_28670 214040 215371 gene locus_tag LOCUS_28680 214040 215371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 215773 217365 gene locus_tag LOCUS_28690 215773 217365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 218747 217437 gene locus_tag LOCUS_28700 218747 217437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 219764 218925 gene locus_tag LOCUS_28710 219764 218925 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_28710 220648 219764 gene locus_tag LOCUS_28720 220648 219764 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_28720 220779 222821 gene locus_tag LOCUS_28730 220779 222821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 222818 224452 gene locus_tag LOCUS_28740 222818 224452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 225288 225515 gene locus_tag LOCUS_28750 225288 225515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 225533 226729 gene locus_tag LOCUS_28760 225533 226729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 226716 227960 gene locus_tag LOCUS_28770 226716 227960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 227944 229635 gene locus_tag LOCUS_28780 227944 229635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 230078 230383 gene locus_tag LOCUS_28790 230078 230383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 230421 230609 gene locus_tag LOCUS_28800 230421 230609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 231209 230973 gene locus_tag LOCUS_28810 231209 230973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28810 231392 232321 gene locus_tag LOCUS_28820 231392 232321 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 protein_id gnl|my_center|LOCUS_28820 232583 232750 gene locus_tag LOCUS_28830 232583 232750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 232699 233505 gene locus_tag LOCUS_28840 232699 233505 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733114.1 protein_id gnl|my_center|LOCUS_28840 234181 233579 gene locus_tag LOCUS_28850 234181 233579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619237.1 protein_id gnl|my_center|LOCUS_28850 235317 234178 gene locus_tag LOCUS_28860 235317 234178 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570606.1 protein_id gnl|my_center|LOCUS_28860 236065 235319 gene locus_tag LOCUS_28870 236065 235319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 protein_id gnl|my_center|LOCUS_28870 236992 236069 gene locus_tag LOCUS_28880 236992 236069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 protein_id gnl|my_center|LOCUS_28880 237504 237229 gene locus_tag LOCUS_28890 237504 237229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 237680 237949 gene locus_tag LOCUS_28900 237680 237949 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_28900 238052 239410 gene locus_tag LOCUS_28910 238052 239410 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_28910 239747 242476 gene locus_tag LOCUS_28920 239747 242476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 242504 244153 gene locus_tag LOCUS_28930 242504 244153 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_28930 244773 244252 gene locus_tag LOCUS_28940 244773 244252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890708.1 protein_id gnl|my_center|LOCUS_28940 245693 244905 gene locus_tag LOCUS_28950 245693 244905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 246791 245835 gene locus_tag LOCUS_28960 246791 245835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 247073 248374 gene locus_tag LOCUS_28970 247073 248374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 248584 249615 gene locus_tag LOCUS_28980 248584 249615 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_28980 249582 250253 gene locus_tag LOCUS_28990 249582 250253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 250290 251345 gene locus_tag LOCUS_29000 250290 251345 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_29000 251348 252703 gene locus_tag LOCUS_29010 251348 252703 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_29010 252731 253312 gene locus_tag LOCUS_29020 252731 253312 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_29020 253316 254440 gene locus_tag LOCUS_29030 253316 254440 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 protein_id gnl|my_center|LOCUS_29030 254447 256306 gene locus_tag LOCUS_29040 254447 256306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 256336 258066 gene locus_tag LOCUS_29050 256336 258066 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582954.1 protein_id gnl|my_center|LOCUS_29050 258075 259466 gene locus_tag LOCUS_29060 258075 259466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 259463 260761 gene locus_tag LOCUS_29070 259463 260761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 260712 261899 gene locus_tag LOCUS_29080 260712 261899 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_29080 261799 263169 gene locus_tag LOCUS_29090 261799 263169 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_29090 263166 264707 gene locus_tag LOCUS_29100 263166 264707 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_29100 264810 265982 gene locus_tag LOCUS_29110 264810 265982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 266026 267045 gene locus_tag LOCUS_29120 266026 267045 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_29120 267316 268740 gene locus_tag LOCUS_29130 267316 268740 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_29130 268913 269410 gene locus_tag LOCUS_29140 268913 269410 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_29140 269819 270877 gene locus_tag LOCUS_29150 gene rlmN 269819 270877 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_29150 271356 273962 gene locus_tag LOCUS_29160 271356 273962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 273974 274216 gene locus_tag LOCUS_29170 273974 274216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 274817 274464 gene locus_tag LOCUS_29180 274817 274464 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279278.1 protein_id gnl|my_center|LOCUS_29180 274956 275237 gene locus_tag LOCUS_29190 274956 275237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 275221 275667 gene locus_tag LOCUS_29200 275221 275667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 275782 276222 gene locus_tag LOCUS_29210 275782 276222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 277049 276828 gene locus_tag LOCUS_29220 277049 276828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 277260 278042 gene locus_tag LOCUS_29230 277260 278042 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504233.1 protein_id gnl|my_center|LOCUS_29230 278054 278308 gene locus_tag LOCUS_29240 278054 278308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 278442 278933 gene locus_tag LOCUS_29250 278442 278933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29250 279026 279682 gene locus_tag LOCUS_29260 279026 279682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29260 279763 280329 gene locus_tag LOCUS_29270 279763 280329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 280340 280843 gene locus_tag LOCUS_29280 280340 280843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 281802 281290 gene locus_tag LOCUS_29290 281802 281290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 281979 282272 gene locus_tag LOCUS_29300 281979 282272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 282540 282388 gene locus_tag LOCUS_29310 282540 282388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 283236 282868 gene locus_tag LOCUS_29320 283236 282868 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_29320 283447 283926 gene locus_tag LOCUS_29330 gene greA 283447 283926 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_29330 284038 284202 gene locus_tag LOCUS_29340 284038 284202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 284286 284432 gene locus_tag LOCUS_29350 284286 284432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 284377 285078 gene locus_tag LOCUS_29360 284377 285078 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 protein_id gnl|my_center|LOCUS_29360 285075 286010 gene locus_tag LOCUS_29370 285075 286010 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 protein_id gnl|my_center|LOCUS_29370 287060 286050 gene locus_tag LOCUS_29380 gene ansA 287060 286050 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_29380 288556 287213 gene locus_tag LOCUS_29390 288556 287213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 289031 288771 gene locus_tag LOCUS_29400 289031 288771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 289054 291213 gene locus_tag LOCUS_29410 289054 291213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 <292840 291283 gene locus_tag LOCUS_29420 <292840 291283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963676.1:glycosyltransferase 87 family protein >Feature sequence35 172 247 gene locus_tag LOCUS_t00540 172 247 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 >Feature sequence37 >Feature sequence38 >Feature sequence39 >Feature sequence40 >Feature sequence41 >Feature sequence42 >Feature sequence43 >Feature sequence44 >Feature sequence45 <1 596 gene locus_tag LOCUS_29430 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000997695.1:IS256-like element ISEf1 family transposase 805 2130 gene locus_tag LOCUS_29440 805 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2135 4159 gene locus_tag LOCUS_29450 2135 4159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 protein_id gnl|my_center|LOCUS_29450 4143 5990 gene locus_tag LOCUS_29460 4143 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 6542 6261 gene locus_tag LOCUS_29470 6542 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 6542 6919 gene locus_tag LOCUS_29480 6542 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 7147 8430 gene locus_tag LOCUS_29490 7147 8430 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 protein_id gnl|my_center|LOCUS_29490 8489 8704 gene locus_tag LOCUS_29500 8489 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 8676 9497 gene locus_tag LOCUS_29510 8676 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 9864 9661 gene locus_tag LOCUS_29520 9864 9661 CDS product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 protein_id gnl|my_center|LOCUS_29520 10629 9949 gene locus_tag LOCUS_29530 10629 9949 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_29530 11356 10646 gene locus_tag LOCUS_29540 11356 10646 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_29540 14504 11358 gene locus_tag LOCUS_29550 14504 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 15910 14480 gene locus_tag LOCUS_29560 gene pelF 15910 14480 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_29560 17759 15927 gene locus_tag LOCUS_29570 17759 15927 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_29570 18660 17770 gene locus_tag LOCUS_29580 18660 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 20836 18653 gene locus_tag LOCUS_29590 20836 18653 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964049.1 protein_id gnl|my_center|LOCUS_29590 20986 22365 gene locus_tag LOCUS_29600 20986 22365 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_29600 23438 22545 gene locus_tag LOCUS_29610 23438 22545 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_29610 24347 23457 gene locus_tag LOCUS_29620 24347 23457 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_29620 26196 24451 gene locus_tag LOCUS_29630 26196 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 27977 26397 gene locus_tag LOCUS_29640 27977 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 29743 27974 gene locus_tag LOCUS_29650 29743 27974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 30813 29953 gene locus_tag LOCUS_29660 30813 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 32110 30800 gene locus_tag LOCUS_29670 32110 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 32722 33837 gene locus_tag LOCUS_29680 32722 33837 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_29680 33902 34696 gene locus_tag LOCUS_29690 33902 34696 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_29690 35687 34884 gene locus_tag LOCUS_29700 35687 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 35809 36318 gene locus_tag LOCUS_29710 35809 36318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 36349 37275 gene locus_tag LOCUS_29720 36349 37275 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_29720 37562 37350 gene locus_tag LOCUS_29730 37562 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 37503 37658 gene locus_tag LOCUS_29740 37503 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 37720 38172 gene locus_tag LOCUS_29750 37720 38172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 38389 40221 gene locus_tag LOCUS_29760 gene kinA 38389 40221 CDS product sporulation kinase KinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245779.1 protein_id gnl|my_center|LOCUS_29760 40439 41326 gene locus_tag LOCUS_29770 40439 41326 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_29770 41482 42330 gene locus_tag LOCUS_29780 gene tcyK 41482 42330 CDS product sulfur-containing amino acid ABC transporter substrate-binding protein TcyK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399116.1 protein_id gnl|my_center|LOCUS_29780 42447 43244 gene locus_tag LOCUS_29790 42447 43244 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722587.1 protein_id gnl|my_center|LOCUS_29790 43241 43951 gene locus_tag LOCUS_29800 43241 43951 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722586.1 protein_id gnl|my_center|LOCUS_29800 43948 44700 gene locus_tag LOCUS_29810 gene tcyN 43948 44700 CDS product sulfur-containing amino-acid ABC transporter ATP-binding protein TcyN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398701.1 protein_id gnl|my_center|LOCUS_29810 44737 45771 gene locus_tag LOCUS_29820 44737 45771 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187562.1 protein_id gnl|my_center|LOCUS_29820 45840 47027 gene locus_tag LOCUS_29830 45840 47027 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_29830 47185 47658 gene locus_tag LOCUS_29840 47185 47658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 47741 49099 gene locus_tag LOCUS_29850 47741 49099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 49414 50268 gene locus_tag LOCUS_29860 49414 50268 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_29860 51267 50410 gene locus_tag LOCUS_29870 51267 50410 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_29870 52322 51264 gene locus_tag LOCUS_29880 52322 51264 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_29880 52447 53373 gene locus_tag LOCUS_29890 52447 53373 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_29890 53420 53596 gene locus_tag LOCUS_29900 53420 53596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 53800 54150 gene locus_tag LOCUS_29910 53800 54150 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 protein_id gnl|my_center|LOCUS_29910 54198 54869 gene locus_tag LOCUS_29920 gene bshB2 54198 54869 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 protein_id gnl|my_center|LOCUS_29920 55841 54978 gene locus_tag LOCUS_29930 55841 54978 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747495.1 protein_id gnl|my_center|LOCUS_29930 56736 57482 gene locus_tag LOCUS_29940 gene map 56736 57482 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586860.1 protein_id gnl|my_center|LOCUS_29940 59073 57574 gene locus_tag LOCUS_29950 59073 57574 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_29950 60936 59116 gene locus_tag LOCUS_29960 60936 59116 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109466.1 protein_id gnl|my_center|LOCUS_29960 61222 63102 gene locus_tag LOCUS_29970 gene htpG 61222 63102 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_29970 63258 64715 gene locus_tag LOCUS_29980 63258 64715 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_29980 64962 65291 gene locus_tag LOCUS_29990 64962 65291 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017149794.1 protein_id gnl|my_center|LOCUS_29990 65288 66139 gene locus_tag LOCUS_30000 65288 66139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30000 66642 68111 gene locus_tag LOCUS_30010 66642 68111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 68139 68774 gene locus_tag LOCUS_30020 gene yhcZ 68139 68774 CDS product two-component system response regulator YhcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245647.1 protein_id gnl|my_center|LOCUS_30020 69194 69934 gene locus_tag LOCUS_30030 69194 69934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 69918 70556 gene locus_tag LOCUS_30040 69918 70556 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_30040 70580 71473 gene locus_tag LOCUS_30050 gene galU 70580 71473 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_30050 71489 72196 gene locus_tag LOCUS_30060 71489 72196 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643206.1 protein_id gnl|my_center|LOCUS_30060 72264 73196 gene locus_tag LOCUS_30070 72264 73196 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_30070 73212 74552 gene locus_tag LOCUS_30080 73212 74552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 74567 75364 gene locus_tag LOCUS_30090 74567 75364 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_30090 75357 75878 gene locus_tag LOCUS_30100 75357 75878 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701534.1 protein_id gnl|my_center|LOCUS_30100 75878 77365 gene locus_tag LOCUS_30110 75878 77365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_30110 77331 78710 gene locus_tag LOCUS_30120 77331 78710 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107349.1 protein_id gnl|my_center|LOCUS_30120 78730 79581 gene locus_tag LOCUS_30130 78730 79581 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_30130 79568 80752 gene locus_tag LOCUS_30140 79568 80752 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_30140 80749 81891 gene locus_tag LOCUS_30150 80749 81891 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113399.1 protein_id gnl|my_center|LOCUS_30150 81921 83030 gene locus_tag LOCUS_30160 81921 83030 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_30160 83027 84367 gene locus_tag LOCUS_30170 gene tuaD 83027 84367 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_30170 84372 85757 gene locus_tag LOCUS_30180 84372 85757 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_30180 85938 87443 gene locus_tag LOCUS_30190 85938 87443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 87539 90169 gene locus_tag LOCUS_30200 87539 90169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 90274 90429 gene locus_tag LOCUS_30210 90274 90429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 90611 91792 gene locus_tag LOCUS_30220 90611 91792 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948295.1 protein_id gnl|my_center|LOCUS_30220 91984 92955 gene locus_tag LOCUS_30230 91984 92955 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_30230 93110 93880 gene locus_tag LOCUS_30240 93110 93880 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243977.1 protein_id gnl|my_center|LOCUS_30240 94073 95287 gene locus_tag LOCUS_30250 94073 95287 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704717.1 protein_id gnl|my_center|LOCUS_30250 95348 95824 gene locus_tag LOCUS_30260 95348 95824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331629.1 protein_id gnl|my_center|LOCUS_30260 96030 96461 gene locus_tag LOCUS_30270 96030 96461 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_30270 96468 98471 gene locus_tag LOCUS_30280 96468 98471 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_30280 98528 100120 gene locus_tag LOCUS_30290 98528 100120 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_30290 100231 100929 gene locus_tag LOCUS_30300 100231 100929 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_30300 102673 101057 gene locus_tag LOCUS_30310 gene pucR 102673 101057 CDS product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 protein_id gnl|my_center|LOCUS_30310 102911 104500 gene locus_tag LOCUS_30320 gene ggt 102911 104500 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_30320 104749 106017 gene locus_tag LOCUS_30330 104749 106017 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_30330 106029 106886 gene locus_tag LOCUS_30340 106029 106886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 106944 107492 gene locus_tag LOCUS_30350 gene uraD 106944 107492 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_30350 107486 108457 gene locus_tag LOCUS_30360 107486 108457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30360 108460 108882 gene locus_tag LOCUS_30370 gene uraH 108460 108882 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 protein_id gnl|my_center|LOCUS_30370 108936 110336 gene locus_tag LOCUS_30380 108936 110336 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_30380 110333 111853 gene locus_tag LOCUS_30390 110333 111853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 112300 113736 gene locus_tag LOCUS_30400 112300 113736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 114532 113753 gene locus_tag LOCUS_30410 114532 113753 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_30410 115130 114603 gene locus_tag LOCUS_30420 115130 114603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 115533 118574 gene locus_tag LOCUS_30430 115533 118574 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375538.1 protein_id gnl|my_center|LOCUS_30430 118807 119622 gene locus_tag LOCUS_30440 118807 119622 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_30440 119619 120461 gene locus_tag LOCUS_30450 119619 120461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 protein_id gnl|my_center|LOCUS_30450 120609 121460 gene locus_tag LOCUS_30460 120609 121460 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038711.1 protein_id gnl|my_center|LOCUS_30460 121669 123459 gene locus_tag LOCUS_30470 121669 123459 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231425.1 protein_id gnl|my_center|LOCUS_30470 123665 124255 gene locus_tag LOCUS_30480 123665 124255 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398656.1 protein_id gnl|my_center|LOCUS_30480 125113 124382 gene locus_tag LOCUS_30490 125113 124382 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_30490 125343 126344 gene locus_tag LOCUS_30500 125343 126344 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_30500 126361 126927 gene locus_tag LOCUS_30510 126361 126927 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227761.1 protein_id gnl|my_center|LOCUS_30510 127661 127140 gene locus_tag LOCUS_30520 127661 127140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954998.1 protein_id gnl|my_center|LOCUS_30520 128181 127705 gene locus_tag LOCUS_30530 128181 127705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 128356 128787 gene locus_tag LOCUS_30540 128356 128787 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_30540 128903 130000 gene locus_tag LOCUS_30550 128903 130000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 131400 130129 gene locus_tag LOCUS_30560 131400 130129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 131606 132409 gene locus_tag LOCUS_30570 131606 132409 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722832.1 protein_id gnl|my_center|LOCUS_30570 132427 134226 gene locus_tag LOCUS_30580 132427 134226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 protein_id gnl|my_center|LOCUS_30580 134207 136078 gene locus_tag LOCUS_30590 134207 136078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_30590 136716 137978 gene locus_tag LOCUS_30600 gene hflX 136716 137978 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391877.1 protein_id gnl|my_center|LOCUS_30600 138376 138831 gene locus_tag LOCUS_30610 138376 138831 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_30610 138880 139179 gene locus_tag LOCUS_30620 138880 139179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 140189 139299 gene locus_tag LOCUS_30630 140189 139299 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_30630 140880 140194 gene locus_tag LOCUS_30640 140880 140194 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_30640 141430 141029 gene locus_tag LOCUS_30650 141430 141029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 141570 142577 gene locus_tag LOCUS_30660 141570 142577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 142790 143266 gene locus_tag LOCUS_30670 gene chrS 142790 143266 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_30670 143322 143870 gene locus_tag LOCUS_30680 143322 143870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 144152 144511 gene locus_tag LOCUS_30690 gene nrdI 144152 144511 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959447.1 protein_id gnl|my_center|LOCUS_30690 144498 146582 gene locus_tag LOCUS_30700 gene nrdE 144498 146582 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_30700 146678 147637 gene locus_tag LOCUS_30710 gene nrdF 146678 147637 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_30710 147912 152378 gene locus_tag LOCUS_30720 147912 152378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 152978 153808 gene locus_tag LOCUS_30730 gene thiM 152978 153808 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056115.1 protein_id gnl|my_center|LOCUS_30730 153792 154616 gene locus_tag LOCUS_30740 gene thiD 153792 154616 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 protein_id gnl|my_center|LOCUS_30740 154849 155286 gene locus_tag LOCUS_30750 154849 155286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 156531 155413 gene locus_tag LOCUS_30760 156531 155413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 156753 157322 gene locus_tag LOCUS_30770 156753 157322 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_30770 157334 157453 gene locus_tag LOCUS_30780 157334 157453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 157501 157833 gene locus_tag LOCUS_30790 157501 157833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 158764 157973 gene locus_tag LOCUS_30800 158764 157973 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392440.1 protein_id gnl|my_center|LOCUS_30800 159054 160397 gene locus_tag LOCUS_30810 159054 160397 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_30810 161710 160502 gene locus_tag LOCUS_30820 161710 160502 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_30820 161956 163578 gene locus_tag LOCUS_30830 161956 163578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 163919 163722 gene locus_tag LOCUS_30840 163919 163722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 165027 164071 gene locus_tag LOCUS_30850 165027 164071 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712215.1 protein_id gnl|my_center|LOCUS_30850 165233 166123 gene locus_tag LOCUS_30860 gene modA 165233 166123 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_30860 166130 166816 gene locus_tag LOCUS_30870 gene modB 166130 166816 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 protein_id gnl|my_center|LOCUS_30870 167982 167002 gene locus_tag LOCUS_30880 167982 167002 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 protein_id gnl|my_center|LOCUS_30880 168646 168206 gene locus_tag LOCUS_30890 168646 168206 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808679.1 protein_id gnl|my_center|LOCUS_30890 169420 168662 gene locus_tag LOCUS_30900 169420 168662 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 protein_id gnl|my_center|LOCUS_30900 169795 170790 gene locus_tag LOCUS_30910 gene cyoA 169795 170790 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266528.1 protein_id gnl|my_center|LOCUS_30910 170813 172780 gene locus_tag LOCUS_30920 gene qoxB 170813 172780 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 protein_id gnl|my_center|LOCUS_30920 172780 173397 gene locus_tag LOCUS_30930 172780 173397 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_30930 173398 173727 gene locus_tag LOCUS_30940 173398 173727 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_30940 173909 174196 gene locus_tag LOCUS_30950 173909 174196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 174761 174324 gene locus_tag LOCUS_30960 174761 174324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 175708 174923 gene locus_tag LOCUS_30970 175708 174923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 175918 177906 gene locus_tag LOCUS_30980 gene mcpB 175918 177906 CDS product methyl-accepting chemotaxis protein McpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243461.1 protein_id gnl|my_center|LOCUS_30980 178402 177980 gene locus_tag LOCUS_30990 178402 177980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 178665 178489 gene locus_tag LOCUS_31000 178665 178489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 178961 180745 gene locus_tag LOCUS_31010 178961 180745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 181050 180793 gene locus_tag LOCUS_31020 181050 180793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 182109 181147 gene locus_tag LOCUS_31030 182109 181147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 182929 182318 gene locus_tag LOCUS_31040 gene ytaF 182929 182318 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100738.1 protein_id gnl|my_center|LOCUS_31040 183083 183292 gene locus_tag LOCUS_31050 183083 183292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 183462 183842 gene locus_tag LOCUS_31060 183462 183842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 184075 184530 gene locus_tag LOCUS_31070 184075 184530 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_31070 184738 184905 gene locus_tag LOCUS_31080 184738 184905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 185034 185366 gene locus_tag LOCUS_31090 gene gsiB 185034 185366 CDS product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 protein_id gnl|my_center|LOCUS_31090 185977 186597 gene locus_tag LOCUS_31100 185977 186597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 186799 187380 gene locus_tag LOCUS_31110 186799 187380 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963381.1 protein_id gnl|my_center|LOCUS_31110 187444 189630 gene locus_tag LOCUS_31120 187444 189630 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676329.1 protein_id gnl|my_center|LOCUS_31120 190297 194892 gene locus_tag LOCUS_31130 gene gltB 190297 194892 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_31130 195077 195991 gene locus_tag LOCUS_31140 195077 195991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_31140 195984 196754 gene locus_tag LOCUS_31150 195984 196754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_31150 196758 197006 gene locus_tag LOCUS_31160 196758 197006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 198088 196910 gene locus_tag LOCUS_31170 198088 196910 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_31170 199854 198085 gene locus_tag LOCUS_31180 199854 198085 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_31180 200777 199938 gene locus_tag LOCUS_31190 200777 199938 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_31190 201688 200795 gene locus_tag LOCUS_31200 201688 200795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_31200 203121 201778 gene locus_tag LOCUS_31210 203121 201778 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_31210 203754 203350 gene locus_tag LOCUS_31220 203754 203350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 204811 203798 gene locus_tag LOCUS_31230 204811 203798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 204985 206409 gene locus_tag LOCUS_31240 204985 206409 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_31240 207352 206465 gene locus_tag LOCUS_31250 gene ligD 207352 206465 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_31250 207448 208596 gene locus_tag LOCUS_31260 gene ligD 207448 208596 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_31260 209791 208640 gene locus_tag LOCUS_31270 209791 208640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 210081 210563 gene locus_tag LOCUS_31280 gene tsaE 210081 210563 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_31280 210606 211397 gene locus_tag LOCUS_31290 gene tsaB 210606 211397 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865764.1 protein_id gnl|my_center|LOCUS_31290 211410 212030 gene locus_tag LOCUS_31300 211410 212030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 212027 213118 gene locus_tag LOCUS_31310 gene tsaD 212027 213118 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_31310 213233 214171 gene locus_tag LOCUS_31320 213233 214171 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_31320 214104 214301 gene locus_tag LOCUS_31330 214104 214301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 214294 215025 gene locus_tag LOCUS_31340 214294 215025 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357656.1 protein_id gnl|my_center|LOCUS_31340 216463 215159 gene locus_tag LOCUS_31350 216463 215159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_31350 216890 216546 gene locus_tag LOCUS_31360 216890 216546 CDS product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793376.1 protein_id gnl|my_center|LOCUS_31360 217398 217018 gene locus_tag LOCUS_31370 217398 217018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 219754 217790 gene locus_tag LOCUS_31380 219754 217790 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 protein_id gnl|my_center|LOCUS_31380 220028 220666 gene locus_tag LOCUS_31390 220028 220666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 220722 221153 gene locus_tag LOCUS_31400 gene moaC 220722 221153 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 protein_id gnl|my_center|LOCUS_31400 221200 221688 gene locus_tag LOCUS_31410 221200 221688 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_31410 221720 222478 gene locus_tag LOCUS_31420 gene tatC 221720 222478 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_31420 222748 223029 gene locus_tag LOCUS_31430 gene groES 222748 223029 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_31430 223127 224752 gene locus_tag LOCUS_31440 gene groL 223127 224752 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_31440 225978 224917 gene locus_tag LOCUS_31450 225978 224917 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989793.1 protein_id gnl|my_center|LOCUS_31450 226358 227038 gene locus_tag LOCUS_31460 226358 227038 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence46 >Feature sequence47 1190 327 gene locus_tag LOCUS_31470 1190 327 CDS product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 protein_id gnl|my_center|LOCUS_31470 3098 1383 gene locus_tag LOCUS_31480 3098 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3651 3226 gene locus_tag LOCUS_31490 gene perR 3651 3226 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_31490 5644 3779 gene locus_tag LOCUS_31500 5644 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 6747 5824 gene locus_tag LOCUS_31510 gene menA 6747 5824 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_31510 8505 7063 gene locus_tag LOCUS_31520 gene gatB 8505 7063 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_31520 9975 8524 gene locus_tag LOCUS_31530 gene gatA 9975 8524 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 protein_id gnl|my_center|LOCUS_31530 10293 10006 gene locus_tag LOCUS_31540 gene gatC 10293 10006 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_31540 10872 10492 gene locus_tag LOCUS_31550 10872 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 11229 11005 gene locus_tag LOCUS_31560 11229 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 12068 11436 gene locus_tag LOCUS_31570 12068 11436 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_31570 12674 12096 gene locus_tag LOCUS_31580 12674 12096 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 protein_id gnl|my_center|LOCUS_31580 13279 12671 gene locus_tag LOCUS_31590 13279 12671 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254817.1 protein_id gnl|my_center|LOCUS_31590 13428 13778 gene locus_tag LOCUS_31600 13428 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 16406 14130 gene locus_tag LOCUS_31610 16406 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 18266 17064 gene locus_tag LOCUS_31620 18266 17064 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_31620 19138 18314 gene locus_tag LOCUS_31630 19138 18314 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_31630 19895 19239 gene locus_tag LOCUS_31640 19895 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 20827 20033 gene locus_tag LOCUS_31650 20827 20033 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_31650 21458 20916 gene locus_tag LOCUS_31660 21458 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 21659 21886 gene locus_tag LOCUS_31670 21659 21886 CDS product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366197.1 protein_id gnl|my_center|LOCUS_31670 22736 22017 gene locus_tag LOCUS_31680 22736 22017 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_31680 22958 23434 gene locus_tag LOCUS_31690 22958 23434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 23540 23860 gene locus_tag LOCUS_31700 23540 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 23926 24150 gene locus_tag LOCUS_31710 23926 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 25204 24230 gene locus_tag LOCUS_31720 gene corA 25204 24230 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399136.1 protein_id gnl|my_center|LOCUS_31720 26083 25313 gene locus_tag LOCUS_31730 gene sigB 26083 25313 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 protein_id gnl|my_center|LOCUS_31730 26529 26080 gene locus_tag LOCUS_31740 gene rsbW 26529 26080 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970573.1 protein_id gnl|my_center|LOCUS_31740 26887 26549 gene locus_tag LOCUS_31750 26887 26549 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_31750 28632 26959 gene locus_tag LOCUS_31760 28632 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 28537 28734 gene locus_tag LOCUS_31770 28537 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 29605 28727 gene locus_tag LOCUS_31780 29605 28727 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_31780 33397 29723 gene locus_tag LOCUS_31790 33397 29723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 34562 33387 gene locus_tag LOCUS_31800 34562 33387 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_31800 35162 34815 gene locus_tag LOCUS_31810 35162 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 35930 35358 gene locus_tag LOCUS_31820 35930 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 36453 35956 gene locus_tag LOCUS_31830 36453 35956 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 protein_id gnl|my_center|LOCUS_31830 36742 36915 gene locus_tag LOCUS_31840 36742 36915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 37681 37106 gene locus_tag LOCUS_31850 37681 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 37830 38195 gene locus_tag LOCUS_31860 37830 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 39417 38359 gene locus_tag LOCUS_31870 39417 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 39835 40032 gene locus_tag LOCUS_31880 39835 40032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 41781 40147 gene locus_tag LOCUS_31890 41781 40147 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_31890 42833 41895 gene locus_tag LOCUS_31900 42833 41895 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 protein_id gnl|my_center|LOCUS_31900 43014 44153 gene locus_tag LOCUS_31910 43014 44153 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_31910 45363 44233 gene locus_tag LOCUS_31920 45363 44233 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520822.1 protein_id gnl|my_center|LOCUS_31920 45839 45603 gene locus_tag LOCUS_31930 45839 45603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 46831 45884 gene locus_tag LOCUS_31940 gene trxB 46831 45884 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_31940 48943 46961 gene locus_tag LOCUS_31950 gene pfeT 48943 46961 CDS product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 protein_id gnl|my_center|LOCUS_31950 49877 49203 gene locus_tag LOCUS_31960 gene deoC 49877 49203 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_31960 50559 49981 gene locus_tag LOCUS_31970 gene def 50559 49981 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_31970 51039 51599 gene locus_tag LOCUS_31980 51039 51599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 51565 51765 gene locus_tag LOCUS_31990 51565 51765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 52558 51989 gene locus_tag LOCUS_32000 52558 51989 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074910.1 protein_id gnl|my_center|LOCUS_32000 53282 52551 gene locus_tag LOCUS_32010 53282 52551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242338.1 protein_id gnl|my_center|LOCUS_32010 53684 53421 gene locus_tag LOCUS_32020 53684 53421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 54917 53700 gene locus_tag LOCUS_32030 54917 53700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521091.1 protein_id gnl|my_center|LOCUS_32030 56348 55095 gene locus_tag LOCUS_32040 56348 55095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_32040 56856 56335 gene locus_tag LOCUS_32050 56856 56335 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_32050 59189 57054 gene locus_tag LOCUS_32060 59189 57054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 60426 59494 gene locus_tag LOCUS_32070 gene ppaC 60426 59494 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_32070 61097 60567 gene locus_tag LOCUS_32080 gene bstA 61097 60567 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_32080 61770 61210 gene locus_tag LOCUS_32090 61770 61210 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163971.1 protein_id gnl|my_center|LOCUS_32090 62335 61790 gene locus_tag LOCUS_32100 62335 61790 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963411.1 protein_id gnl|my_center|LOCUS_32100 62978 62514 gene locus_tag LOCUS_32110 62978 62514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 66242 63159 gene locus_tag LOCUS_32120 66242 63159 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_32120 67111 66287 gene locus_tag LOCUS_32130 67111 66287 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_32130 67998 67108 gene locus_tag LOCUS_32140 67998 67108 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_32140 69398 68106 gene locus_tag LOCUS_32150 69398 68106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289133.1 protein_id gnl|my_center|LOCUS_32150 71388 69598 gene locus_tag LOCUS_32160 71388 69598 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015253363.1 protein_id gnl|my_center|LOCUS_32160 72992 71385 gene locus_tag LOCUS_32170 72992 71385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 73210 74070 gene locus_tag LOCUS_32180 73210 74070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 74104 74784 gene locus_tag LOCUS_32190 74104 74784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_32190 74829 75512 gene locus_tag LOCUS_32200 74829 75512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 79468 75650 gene locus_tag LOCUS_32210 79468 75650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 79961 80695 gene locus_tag LOCUS_32220 79961 80695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224938.1 protein_id gnl|my_center|LOCUS_32220 81490 80885 gene locus_tag LOCUS_32230 81490 80885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 82952 81477 gene locus_tag LOCUS_32240 82952 81477 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 protein_id gnl|my_center|LOCUS_32240 84239 83055 gene locus_tag LOCUS_32250 84239 83055 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 protein_id gnl|my_center|LOCUS_32250 85466 84300 gene locus_tag LOCUS_32260 85466 84300 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_32260 87087 85552 gene locus_tag LOCUS_32270 87087 85552 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_32270 88022 87084 gene locus_tag LOCUS_32280 88022 87084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 89187 87982 gene locus_tag LOCUS_32290 89187 87982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 90257 89184 gene locus_tag LOCUS_32300 90257 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 91168 90383 gene locus_tag LOCUS_32310 91168 90383 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_32310 92465 91200 gene locus_tag LOCUS_32320 92465 91200 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_32320 93664 92483 gene locus_tag LOCUS_32330 93664 92483 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_32330 94338 93679 gene locus_tag LOCUS_32340 94338 93679 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_32340 94963 94331 gene locus_tag LOCUS_32350 94963 94331 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_32350 97021 95090 gene locus_tag LOCUS_32360 97021 95090 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_32360 97853 97185 gene locus_tag LOCUS_32370 97853 97185 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 protein_id gnl|my_center|LOCUS_32370 98589 97837 gene locus_tag LOCUS_32380 gene tkmA 98589 97837 CDS product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 protein_id gnl|my_center|LOCUS_32380 102159 98854 gene locus_tag LOCUS_32390 102159 98854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 103032 102430 gene locus_tag LOCUS_32400 103032 102430 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_32400 103929 108560 gene locus_tag LOCUS_32410 103929 108560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 109830 108787 gene locus_tag LOCUS_32420 109830 108787 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_32420 110981 109998 gene locus_tag LOCUS_32430 110981 109998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 112016 111036 gene locus_tag LOCUS_32440 112016 111036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583038.1 protein_id gnl|my_center|LOCUS_32440 112992 112006 gene locus_tag LOCUS_32450 112992 112006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082281.1 protein_id gnl|my_center|LOCUS_32450 113893 112994 gene locus_tag LOCUS_32460 113893 112994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583036.1 protein_id gnl|my_center|LOCUS_32460 114905 113943 gene locus_tag LOCUS_32470 114905 113943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082279.1 protein_id gnl|my_center|LOCUS_32470 117143 114978 gene locus_tag LOCUS_32480 117143 114978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082278.1 protein_id gnl|my_center|LOCUS_32480 118127 117636 gene locus_tag LOCUS_32490 118127 117636 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203348.1 protein_id gnl|my_center|LOCUS_32490 118818 118138 gene locus_tag LOCUS_32500 118818 118138 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 protein_id gnl|my_center|LOCUS_32500 119492 118866 gene locus_tag LOCUS_32510 119492 118866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975492.1 protein_id gnl|my_center|LOCUS_32510 120450 119494 gene locus_tag LOCUS_32520 120450 119494 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412735.1 protein_id gnl|my_center|LOCUS_32520 120863 121288 gene locus_tag LOCUS_32530 120863 121288 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 protein_id gnl|my_center|LOCUS_32530 121289 121687 gene locus_tag LOCUS_32540 121289 121687 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_32540 122313 121795 gene locus_tag LOCUS_32550 122313 121795 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_32550 122514 123119 gene locus_tag LOCUS_32560 122514 123119 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 protein_id gnl|my_center|LOCUS_32560 123324 123647 gene locus_tag LOCUS_32570 123324 123647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 124413 123838 gene locus_tag LOCUS_32580 124413 123838 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_32580 125685 124432 gene locus_tag LOCUS_32590 125685 124432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_32590 126776 125745 gene locus_tag LOCUS_32600 126776 125745 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298109.1 protein_id gnl|my_center|LOCUS_32600 127294 126959 gene locus_tag LOCUS_32610 127294 126959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 128750 127296 gene locus_tag LOCUS_32620 gene hydA 128750 127296 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_32620 130041 128752 gene locus_tag LOCUS_32630 gene preA 130041 128752 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_32630 131473 130082 gene locus_tag LOCUS_32640 gene gltA 131473 130082 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_32640 131833 133710 gene locus_tag LOCUS_32650 131833 133710 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270376.1 protein_id gnl|my_center|LOCUS_32650 135067 133676 gene locus_tag LOCUS_32660 135067 133676 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850979.1 protein_id gnl|my_center|LOCUS_32660 136559 135090 gene locus_tag LOCUS_32670 136559 135090 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_32670 137812 136715 gene locus_tag LOCUS_32680 137812 136715 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 protein_id gnl|my_center|LOCUS_32680 139207 138413 gene locus_tag LOCUS_32690 139207 138413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_32690 139320 139168 gene locus_tag LOCUS_32700 139320 139168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 140217 139405 gene locus_tag LOCUS_32710 140217 139405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_32710 141005 140223 gene locus_tag LOCUS_32720 141005 140223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 protein_id gnl|my_center|LOCUS_32720 141403 142986 gene locus_tag LOCUS_32730 141403 142986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 144850 143087 gene locus_tag LOCUS_32740 144850 143087 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044710.1 protein_id gnl|my_center|LOCUS_32740 145254 146261 gene locus_tag LOCUS_32750 gene ccpA 145254 146261 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_32750 146922 146296 gene locus_tag LOCUS_32760 146922 146296 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582735.1 protein_id gnl|my_center|LOCUS_32760 147911 146925 gene locus_tag LOCUS_32770 147911 146925 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582734.1 protein_id gnl|my_center|LOCUS_32770 148757 148209 gene locus_tag LOCUS_32780 148757 148209 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890104.1 protein_id gnl|my_center|LOCUS_32780 149846 148821 gene locus_tag LOCUS_32790 149846 148821 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_32790 150125 152716 gene locus_tag LOCUS_32800 150125 152716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 153766 152849 gene locus_tag LOCUS_32810 gene rbsB 153766 152849 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 protein_id gnl|my_center|LOCUS_32810 154752 153784 gene locus_tag LOCUS_32820 gene rbsC 154752 153784 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_32820 156235 154754 gene locus_tag LOCUS_32830 gene rbsA 156235 154754 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 protein_id gnl|my_center|LOCUS_32830 156649 156248 gene locus_tag LOCUS_32840 gene rbsD 156649 156248 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 protein_id gnl|my_center|LOCUS_32840 157532 156651 gene locus_tag LOCUS_32850 gene rbsK 157532 156651 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 protein_id gnl|my_center|LOCUS_32850 158517 157534 gene locus_tag LOCUS_32860 158517 157534 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968279.1 protein_id gnl|my_center|LOCUS_32860 158949 158761 gene locus_tag LOCUS_32870 158949 158761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 159266 159003 gene locus_tag LOCUS_32880 159266 159003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 161737 159503 gene locus_tag LOCUS_32890 161737 159503 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_32890 161918 162289 gene locus_tag LOCUS_32900 161918 162289 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_32900 163871 162408 gene locus_tag LOCUS_32910 163871 162408 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_32910 165858 163933 gene locus_tag LOCUS_32920 165858 163933 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990065.1 protein_id gnl|my_center|LOCUS_32920 166823 165990 gene locus_tag LOCUS_32930 166823 165990 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732126.1 protein_id gnl|my_center|LOCUS_32930 167783 167046 gene locus_tag LOCUS_32940 167783 167046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 167900 168367 gene locus_tag LOCUS_32950 167900 168367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_32950 169440 168457 gene locus_tag LOCUS_32960 169440 168457 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_32960 169797 169669 gene locus_tag LOCUS_32970 169797 169669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 169981 170469 gene locus_tag LOCUS_32980 169981 170469 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 protein_id gnl|my_center|LOCUS_32980 171531 170578 gene locus_tag LOCUS_32990 171531 170578 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447171.1 protein_id gnl|my_center|LOCUS_32990 172918 171521 gene locus_tag LOCUS_33000 172918 171521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_33000 174193 173102 gene locus_tag LOCUS_33010 174193 173102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 175165 174317 gene locus_tag LOCUS_33020 175165 174317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_33020 177168 175423 gene locus_tag LOCUS_33030 gene atzF 177168 175423 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268766.1 protein_id gnl|my_center|LOCUS_33030 180854 177168 gene locus_tag LOCUS_33040 gene uca 180854 177168 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_33040 181515 180847 gene locus_tag LOCUS_33050 181515 180847 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_33050 182239 181517 gene locus_tag LOCUS_33060 182239 181517 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_33060 182681 184021 gene locus_tag LOCUS_33070 182681 184021 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_33070 184369 185043 gene locus_tag LOCUS_33080 184369 185043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 187371 185197 gene locus_tag LOCUS_33090 187371 185197 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_33090 187565 188389 gene locus_tag LOCUS_33100 187565 188389 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_33100 188853 188437 gene locus_tag LOCUS_33110 188853 188437 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460578.1 protein_id gnl|my_center|LOCUS_33110 189133 190173 gene locus_tag LOCUS_33120 189133 190173 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_33120 190787 190296 gene locus_tag LOCUS_33130 190787 190296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 191538 190840 gene locus_tag LOCUS_33140 191538 190840 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358755.1 protein_id gnl|my_center|LOCUS_33140 191692 193044 gene locus_tag LOCUS_33150 gene mepA 191692 193044 CDS product multidrug efflux MATE transporter MepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651051.1 protein_id gnl|my_center|LOCUS_33150 194555 193158 gene locus_tag LOCUS_33160 194555 193158 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182545.1 protein_id gnl|my_center|LOCUS_33160 195188 194751 gene locus_tag LOCUS_33170 195188 194751 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_33170 196051 195290 gene locus_tag LOCUS_33180 gene fabG 196051 195290 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_33180 196587 196072 gene locus_tag LOCUS_33190 196587 196072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 196982 197989 gene locus_tag LOCUS_33200 196982 197989 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130389.1 protein_id gnl|my_center|LOCUS_33200 200026 198194 gene locus_tag LOCUS_33210 gene glmS 200026 198194 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_33210 201992 200637 gene locus_tag LOCUS_33220 gene glmM 201992 200637 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_33220 203488 202067 gene locus_tag LOCUS_33230 203488 202067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 204318 203485 gene locus_tag LOCUS_33240 gene cdaA 204318 203485 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_33240 205191 204574 gene locus_tag LOCUS_33250 205191 204574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 205883 205311 gene locus_tag LOCUS_33260 gene sigW 205883 205311 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_33260 208945 206150 gene locus_tag LOCUS_33270 gene ppc 208945 206150 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_33270 209258 209185 gene locus_tag LOCUS_t00550 209258 209185 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 209342 209266 gene locus_tag LOCUS_t00560 209342 209266 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 209438 209362 gene locus_tag LOCUS_t00570 209438 209362 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 209520 209446 gene locus_tag LOCUS_t00580 209520 209446 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 209609 209526 gene locus_tag LOCUS_t00590 209609 209526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 210736 210663 gene locus_tag LOCUS_t00600 210736 210663 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 210820 210746 gene locus_tag LOCUS_t00610 210820 210746 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 210930 210855 gene locus_tag LOCUS_t00620 210930 210855 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 211012 210938 gene locus_tag LOCUS_t00630 211012 210938 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 211101 211026 gene locus_tag LOCUS_t00640 211101 211026 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 211180 211105 gene locus_tag LOCUS_t00650 211180 211105 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 211312 211200 gene locus_tag LOCUS_r00090 211312 211200 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence48 8 1856 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcactccatgcggagtgcgac 2341 2051 gene locus_tag LOCUS_33280 gene cas2 2341 2051 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_33280 3383 2352 gene locus_tag LOCUS_33290 gene cas1c 3383 2352 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_33290 4048 3380 gene locus_tag LOCUS_33300 gene cas4 4048 3380 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_33300 4889 4026 gene locus_tag LOCUS_33310 gene cas7c 4889 4026 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_33310 6775 4895 gene locus_tag LOCUS_33320 6775 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 7491 6772 gene locus_tag LOCUS_33330 gene cas5c 7491 6772 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_33330 9957 7528 gene locus_tag LOCUS_33340 9957 7528 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_33340 11339 10332 gene locus_tag LOCUS_33350 gene uvsE 11339 10332 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961166.1 protein_id gnl|my_center|LOCUS_33350 11679 11359 gene locus_tag LOCUS_33360 11679 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 12810 11713 gene locus_tag LOCUS_33370 12810 11713 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 protein_id gnl|my_center|LOCUS_33370 13871 12858 gene locus_tag LOCUS_33380 13871 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 14090 16807 gene locus_tag LOCUS_33390 gene acnA 14090 16807 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_33390 17081 17485 gene locus_tag LOCUS_33400 17081 17485 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 protein_id gnl|my_center|LOCUS_33400 17482 18594 gene locus_tag LOCUS_33410 17482 18594 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732398.1 protein_id gnl|my_center|LOCUS_33410 19093 18662 gene locus_tag LOCUS_33420 19093 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 19294 20142 gene locus_tag LOCUS_33430 gene licT 19294 20142 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_33430 20267 22168 gene locus_tag LOCUS_33440 20267 22168 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861843.1 protein_id gnl|my_center|LOCUS_33440 22258 23700 gene locus_tag LOCUS_33450 gene bglH 22258 23700 CDS product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 protein_id gnl|my_center|LOCUS_33450 24696 23953 gene locus_tag LOCUS_33460 24696 23953 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_33460 24913 25938 gene locus_tag LOCUS_33470 24913 25938 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_33470 26023 27252 gene locus_tag LOCUS_33480 26023 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 28077 27256 gene locus_tag LOCUS_33490 28077 27256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 28768 28175 gene locus_tag LOCUS_33500 gene folE 28768 28175 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_33500 29059 28814 gene locus_tag LOCUS_33510 29059 28814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 30997 29189 gene locus_tag LOCUS_33520 30997 29189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 31506 31072 gene locus_tag LOCUS_33530 31506 31072 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_33530 31995 32606 gene locus_tag LOCUS_33540 gene sodA 31995 32606 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_33540 34012 32738 gene locus_tag LOCUS_33550 gene mutY 34012 32738 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_33550 34409 34014 gene locus_tag LOCUS_33560 gene acpS 34409 34014 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 protein_id gnl|my_center|LOCUS_33560 34682 35611 gene locus_tag LOCUS_33570 34682 35611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446856.1 protein_id gnl|my_center|LOCUS_33570 36543 35734 gene locus_tag LOCUS_33580 gene nadE 36543 35734 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660553.1 protein_id gnl|my_center|LOCUS_33580 37096 36662 gene locus_tag LOCUS_33590 gene brxA 37096 36662 CDS product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 protein_id gnl|my_center|LOCUS_33590 38923 37217 gene locus_tag LOCUS_33600 38923 37217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 39185 40465 gene locus_tag LOCUS_33610 39185 40465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 protein_id gnl|my_center|LOCUS_33610 42216 40825 gene locus_tag LOCUS_33620 42216 40825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242507.1 protein_id gnl|my_center|LOCUS_33620 42479 42946 gene locus_tag LOCUS_33630 42479 42946 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 protein_id gnl|my_center|LOCUS_33630 43292 43116 gene locus_tag LOCUS_33640 43292 43116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 43659 43315 gene locus_tag LOCUS_33650 43659 43315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 45381 43714 gene locus_tag LOCUS_33660 45381 43714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 45994 45383 gene locus_tag LOCUS_33670 45994 45383 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_33670 47046 46132 gene locus_tag LOCUS_33680 47046 46132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 47627 47049 gene locus_tag LOCUS_33690 47627 47049 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 protein_id gnl|my_center|LOCUS_33690 48050 49108 gene locus_tag LOCUS_33700 48050 49108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819224.1 protein_id gnl|my_center|LOCUS_33700 49587 49357 gene locus_tag LOCUS_33710 49587 49357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 50112 49801 gene locus_tag LOCUS_33720 50112 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 50303 50794 gene locus_tag LOCUS_33730 50303 50794 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_33730 52847 50853 gene locus_tag LOCUS_33740 52847 50853 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890783.1 protein_id gnl|my_center|LOCUS_33740 52896 53084 gene locus_tag LOCUS_33750 52896 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 53452 55326 gene locus_tag LOCUS_33760 gene ltaP 53452 55326 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_33760 55596 56510 gene locus_tag LOCUS_33770 55596 56510 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 protein_id gnl|my_center|LOCUS_33770 56507 57208 gene locus_tag LOCUS_33780 56507 57208 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_33780 57456 58064 gene locus_tag LOCUS_33790 gene sodA 57456 58064 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_33790 59268 58177 gene locus_tag LOCUS_33800 59268 58177 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_33800 62109 59293 gene locus_tag LOCUS_33810 62109 59293 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_33810 63155 62115 gene locus_tag LOCUS_33820 63155 62115 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_33820 64583 63183 gene locus_tag LOCUS_33830 64583 63183 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_33830 65969 64737 gene locus_tag LOCUS_33840 65969 64737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 67769 66147 gene locus_tag LOCUS_33850 67769 66147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_33850 68710 67805 gene locus_tag LOCUS_33860 68710 67805 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_33860 69698 68730 gene locus_tag LOCUS_33870 69698 68730 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_33870 70018 69824 gene locus_tag LOCUS_33880 70018 69824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 70201 72531 gene locus_tag LOCUS_33890 70201 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 73525 72641 gene locus_tag LOCUS_33900 73525 72641 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814405.1 protein_id gnl|my_center|LOCUS_33900 74466 73522 gene locus_tag LOCUS_33910 74466 73522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943953.1 protein_id gnl|my_center|LOCUS_33910 75815 74463 gene locus_tag LOCUS_33920 75815 74463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 76397 75837 gene locus_tag LOCUS_33930 76397 75837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 78086 76662 gene locus_tag LOCUS_33940 78086 76662 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_33940 78250 79128 gene locus_tag LOCUS_33950 78250 79128 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_33950 79306 79749 gene locus_tag LOCUS_33960 79306 79749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 79788 80495 gene locus_tag LOCUS_33970 79788 80495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 81375 80563 gene locus_tag LOCUS_33980 81375 80563 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557606.1 protein_id gnl|my_center|LOCUS_33980 81776 81483 gene locus_tag LOCUS_33990 81776 81483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 82794 82042 gene locus_tag LOCUS_34000 82794 82042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 83344 83009 gene locus_tag LOCUS_34010 83344 83009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 83798 83430 gene locus_tag LOCUS_34020 83798 83430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 84391 83882 gene locus_tag LOCUS_34030 84391 83882 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989708.1 protein_id gnl|my_center|LOCUS_34030 85104 84517 gene locus_tag LOCUS_34040 85104 84517 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_34040 85792 85187 gene locus_tag LOCUS_34050 85792 85187 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_34050 86096 85863 gene locus_tag LOCUS_34060 86096 85863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 87618 86503 gene locus_tag LOCUS_34070 87618 86503 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811688.1 protein_id gnl|my_center|LOCUS_34070 87863 89200 gene locus_tag LOCUS_34080 87863 89200 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_34080 90763 89309 gene locus_tag LOCUS_34090 90763 89309 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229528.1 protein_id gnl|my_center|LOCUS_34090 91372 90902 gene locus_tag LOCUS_34100 91372 90902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 91939 91514 gene locus_tag LOCUS_34110 91939 91514 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_34110 93244 92033 gene locus_tag LOCUS_34120 93244 92033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 protein_id gnl|my_center|LOCUS_34120 93768 93325 gene locus_tag LOCUS_34130 93768 93325 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 protein_id gnl|my_center|LOCUS_34130 96018 94099 gene locus_tag LOCUS_34140 96018 94099 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971472.1 protein_id gnl|my_center|LOCUS_34140 96314 97234 gene locus_tag LOCUS_34150 96314 97234 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915080.1 protein_id gnl|my_center|LOCUS_34150 97387 98157 gene locus_tag LOCUS_34160 gene phnC 97387 98157 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_34160 98154 98984 gene locus_tag LOCUS_34170 gene phnE 98154 98984 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_34170 98981 99775 gene locus_tag LOCUS_34180 gene phnE 98981 99775 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047881.1 protein_id gnl|my_center|LOCUS_34180 100585 99950 gene locus_tag LOCUS_34190 100585 99950 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141357.1 protein_id gnl|my_center|LOCUS_34190 102587 100620 gene locus_tag LOCUS_34200 102587 100620 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 protein_id gnl|my_center|LOCUS_34200 104420 102684 gene locus_tag LOCUS_34210 gene glpD 104420 102684 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_34210 105317 104682 gene locus_tag LOCUS_34220 gene glpP 105317 104682 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 protein_id gnl|my_center|LOCUS_34220 105455 106579 gene locus_tag LOCUS_34230 105455 106579 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_34230 107379 106723 gene locus_tag LOCUS_34240 107379 106723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 108171 107446 gene locus_tag LOCUS_34250 108171 107446 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_34250 109271 108291 gene locus_tag LOCUS_34260 109271 108291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_34260 111102 109429 gene locus_tag LOCUS_34270 111102 109429 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_34270 111569 111168 gene locus_tag LOCUS_34280 111569 111168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 112430 111717 gene locus_tag LOCUS_34290 112430 111717 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522961.1 protein_id gnl|my_center|LOCUS_34290 113613 112558 gene locus_tag LOCUS_34300 113613 112558 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_34300 115955 113880 gene locus_tag LOCUS_34310 115955 113880 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_34310 116982 116104 gene locus_tag LOCUS_34320 116982 116104 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_34320 117895 117005 gene locus_tag LOCUS_34330 117895 117005 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_34330 120229 118538 gene locus_tag LOCUS_34340 120229 118538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 122025 120364 gene locus_tag LOCUS_34350 122025 120364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 123773 122022 gene locus_tag LOCUS_34360 123773 122022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 124504 124016 gene locus_tag LOCUS_34370 124504 124016 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250917.1 protein_id gnl|my_center|LOCUS_34370 124861 124679 gene locus_tag LOCUS_34380 124861 124679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 125045 126025 gene locus_tag LOCUS_34390 125045 126025 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_34390 126093 126290 gene locus_tag LOCUS_34400 126093 126290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 126454 126302 gene locus_tag LOCUS_34410 126454 126302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 126804 126589 gene locus_tag LOCUS_34420 126804 126589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 126698 127789 gene locus_tag LOCUS_34430 126698 127789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_34430 128475 127906 gene locus_tag LOCUS_34440 128475 127906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 129192 128542 gene locus_tag LOCUS_34450 129192 128542 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966699.1 protein_id gnl|my_center|LOCUS_34450 130391 129189 gene locus_tag LOCUS_34460 130391 129189 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966700.1 protein_id gnl|my_center|LOCUS_34460 130649 132865 gene locus_tag LOCUS_34470 130649 132865 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_34470 134863 133007 gene locus_tag LOCUS_34480 gene ltaP 134863 133007 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_34480 136646 135243 gene locus_tag LOCUS_34490 136646 135243 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_34490 137061 138317 gene locus_tag LOCUS_34500 137061 138317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104352.1 protein_id gnl|my_center|LOCUS_34500 139352 138492 gene locus_tag LOCUS_34510 139352 138492 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_34510 141614 139461 gene locus_tag LOCUS_34520 141614 139461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 143260 141758 gene locus_tag LOCUS_34530 143260 141758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 143961 143257 gene locus_tag LOCUS_34540 143961 143257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_34540 144213 145637 gene locus_tag LOCUS_34550 gene bsdC 144213 145637 CDS product phenolic acid decarboxylase BsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246683.1 protein_id gnl|my_center|LOCUS_34550 145649 145876 gene locus_tag LOCUS_34560 gene bsdD 145649 145876 CDS product phenolic acid decarboxylase subunit BsdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886405.1 protein_id gnl|my_center|LOCUS_34560 145836 146063 gene locus_tag LOCUS_34570 145836 146063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 146558 146379 gene locus_tag LOCUS_34580 146558 146379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 146780 147691 gene locus_tag LOCUS_34590 146780 147691 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_34590 149017 147731 gene locus_tag LOCUS_34600 149017 147731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_34600 149915 149010 gene locus_tag LOCUS_34610 149915 149010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_34610 150823 149915 gene locus_tag LOCUS_34620 150823 149915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_34620 151233 150820 gene locus_tag LOCUS_34630 151233 150820 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_34630 152004 151276 gene locus_tag LOCUS_34640 152004 151276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 153012 152257 gene locus_tag LOCUS_34650 gene map 153012 152257 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_34650 153389 153201 gene locus_tag LOCUS_34660 153389 153201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 153883 155106 gene locus_tag LOCUS_34670 153883 155106 CDS product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594708.1 protein_id gnl|my_center|LOCUS_34670 155294 155638 gene locus_tag LOCUS_34680 155294 155638 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_34680 156775 155642 gene locus_tag LOCUS_34690 156775 155642 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583096.1 protein_id gnl|my_center|LOCUS_34690 157354 156785 gene locus_tag LOCUS_34700 157354 156785 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 protein_id gnl|my_center|LOCUS_34700 157868 157557 gene locus_tag LOCUS_34710 157868 157557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 158862 158122 gene locus_tag LOCUS_34720 158862 158122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 159122 159838 gene locus_tag LOCUS_34730 gene ywaC 159122 159838 CDS product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 protein_id gnl|my_center|LOCUS_34730 161291 159951 gene locus_tag LOCUS_34740 161291 159951 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 protein_id gnl|my_center|LOCUS_34740 162221 161352 gene locus_tag LOCUS_34750 162221 161352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_34750 163015 162221 gene locus_tag LOCUS_34760 163015 162221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432117.1 protein_id gnl|my_center|LOCUS_34760 164136 163045 gene locus_tag LOCUS_34770 164136 163045 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276908.1 protein_id gnl|my_center|LOCUS_34770 164935 164171 gene locus_tag LOCUS_34780 164935 164171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 protein_id gnl|my_center|LOCUS_34780 165727 165125 gene locus_tag LOCUS_34790 165727 165125 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066429.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence49 2307 2576 gene locus_tag LOCUS_34800 2307 2576 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_34800 2761 3789 gene locus_tag LOCUS_34810 2761 3789 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_34810 3834 4709 gene locus_tag LOCUS_34820 gene aguB 3834 4709 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_34820 4929 6611 gene locus_tag LOCUS_34830 4929 6611 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_34830 6608 7828 gene locus_tag LOCUS_34840 gene gerKC 6608 7828 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_34840 7891 8985 gene locus_tag LOCUS_34850 7891 8985 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890707.1 protein_id gnl|my_center|LOCUS_34850 9027 10100 gene locus_tag LOCUS_34860 9027 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 10103 11104 gene locus_tag LOCUS_34870 10103 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 11433 11278 gene locus_tag LOCUS_34880 11433 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 11648 12448 gene locus_tag LOCUS_34890 11648 12448 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243563.1 protein_id gnl|my_center|LOCUS_34890 12497 13000 gene locus_tag LOCUS_34900 12497 13000 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969257.1 protein_id gnl|my_center|LOCUS_34900 13180 15486 gene locus_tag LOCUS_34910 13180 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 15511 17346 gene locus_tag LOCUS_34920 15511 17346 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731998.1 protein_id gnl|my_center|LOCUS_34920 17339 18889 gene locus_tag LOCUS_34930 17339 18889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_34930 19172 20662 gene locus_tag LOCUS_34940 19172 20662 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_34940 20764 21693 gene locus_tag LOCUS_34950 20764 21693 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_34950 21720 22673 gene locus_tag LOCUS_34960 21720 22673 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_34960 22718 25030 gene locus_tag LOCUS_34970 22718 25030 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_34970 25030 28254 gene locus_tag LOCUS_34980 25030 28254 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_34980 28329 29648 gene locus_tag LOCUS_34990 28329 29648 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_34990 29645 32824 gene locus_tag LOCUS_35000 29645 32824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 33106 35925 gene locus_tag LOCUS_35010 33106 35925 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 protein_id gnl|my_center|LOCUS_35010 36614 36201 gene locus_tag LOCUS_35020 36614 36201 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633867.1 protein_id gnl|my_center|LOCUS_35020 36709 37554 gene locus_tag LOCUS_35030 36709 37554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_35030 38479 37730 gene locus_tag LOCUS_35040 38479 37730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837831.1 protein_id gnl|my_center|LOCUS_35040 39241 38480 gene locus_tag LOCUS_35050 39241 38480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_35050 39761 39423 gene locus_tag LOCUS_35060 39761 39423 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379381.1 protein_id gnl|my_center|LOCUS_35060 40101 39748 gene locus_tag LOCUS_35070 40101 39748 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429487.1 protein_id gnl|my_center|LOCUS_35070 42118 40328 gene locus_tag LOCUS_35080 42118 40328 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 protein_id gnl|my_center|LOCUS_35080 42295 42624 gene locus_tag LOCUS_35090 42295 42624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 42753 43367 gene locus_tag LOCUS_35100 42753 43367 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_35100 43483 44640 gene locus_tag LOCUS_35110 43483 44640 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 protein_id gnl|my_center|LOCUS_35110 46668 44998 gene locus_tag LOCUS_35120 gene malL 46668 44998 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_35120 49020 46702 gene locus_tag LOCUS_35130 49020 46702 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_35130 49773 49108 gene locus_tag LOCUS_35140 gene pgmB 49773 49108 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_35140 50963 49929 gene locus_tag LOCUS_35150 gene malR 50963 49929 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_35150 52780 51035 gene locus_tag LOCUS_35160 52780 51035 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 protein_id gnl|my_center|LOCUS_35160 53306 54628 gene locus_tag LOCUS_35170 53306 54628 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_35170 54721 56022 gene locus_tag LOCUS_35180 54721 56022 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_35180 56019 56864 gene locus_tag LOCUS_35190 gene malD 56019 56864 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_35190 57036 59147 gene locus_tag LOCUS_35200 57036 59147 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966776.1 protein_id gnl|my_center|LOCUS_35200 59298 59729 gene locus_tag LOCUS_35210 59298 59729 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741984.1 protein_id gnl|my_center|LOCUS_35210 59732 60664 gene locus_tag LOCUS_35220 59732 60664 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226263.1 protein_id gnl|my_center|LOCUS_35220 61619 60948 gene locus_tag LOCUS_35230 61619 60948 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_35230 61891 61673 gene locus_tag LOCUS_35240 61891 61673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 62134 62709 gene locus_tag LOCUS_35250 62134 62709 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497633.1 protein_id gnl|my_center|LOCUS_35250 63502 62807 gene locus_tag LOCUS_35260 63502 62807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 65216 63567 gene locus_tag LOCUS_35270 65216 63567 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114302.1 protein_id gnl|my_center|LOCUS_35270 65579 65911 gene locus_tag LOCUS_35280 65579 65911 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_35280 65942 66142 gene locus_tag LOCUS_35290 gene copZ 65942 66142 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542561.1 protein_id gnl|my_center|LOCUS_35290 66475 67554 gene locus_tag LOCUS_35300 66475 67554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715571.1 protein_id gnl|my_center|LOCUS_35300 67815 68108 gene locus_tag LOCUS_35310 67815 68108 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655666.1 protein_id gnl|my_center|LOCUS_35310 68105 68881 gene locus_tag LOCUS_35320 68105 68881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_35320 68974 69837 gene locus_tag LOCUS_35330 68974 69837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_35330 69834 70613 gene locus_tag LOCUS_35340 69834 70613 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871089.1 protein_id gnl|my_center|LOCUS_35340 71343 70717 gene locus_tag LOCUS_35350 71343 70717 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_35350 71573 72013 gene locus_tag LOCUS_35360 71573 72013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 72013 73356 gene locus_tag LOCUS_35370 72013 73356 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948370.1 protein_id gnl|my_center|LOCUS_35370 73831 74463 gene locus_tag LOCUS_35380 73831 74463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_35380 74510 75412 gene locus_tag LOCUS_35390 gene tcyJ 74510 75412 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365902.1 protein_id gnl|my_center|LOCUS_35390 75503 76147 gene locus_tag LOCUS_35400 gene tcyL 75503 76147 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403129.1 protein_id gnl|my_center|LOCUS_35400 76168 76917 gene locus_tag LOCUS_35410 76168 76917 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616927.1 protein_id gnl|my_center|LOCUS_35410 76933 77376 gene locus_tag LOCUS_35420 76933 77376 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_35420 77877 77455 gene locus_tag LOCUS_35430 77877 77455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 78023 79882 gene locus_tag LOCUS_35440 78023 79882 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_35440 80766 79972 gene locus_tag LOCUS_35450 80766 79972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 80889 82430 gene locus_tag LOCUS_35460 80889 82430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 82623 83501 gene locus_tag LOCUS_35470 82623 83501 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_35470 83504 84331 gene locus_tag LOCUS_35480 83504 84331 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_35480 84361 85338 gene locus_tag LOCUS_35490 84361 85338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 85325 86608 gene locus_tag LOCUS_35500 85325 86608 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_35500 86649 87878 gene locus_tag LOCUS_35510 86649 87878 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_35510 88017 89348 gene locus_tag LOCUS_35520 88017 89348 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_35520 90021 89503 gene locus_tag LOCUS_35530 90021 89503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 90280 90543 gene locus_tag LOCUS_35540 90280 90543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 90565 90816 gene locus_tag LOCUS_35550 90565 90816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35550 91468 92004 gene locus_tag LOCUS_35560 91468 92004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 92648 92103 gene locus_tag LOCUS_35570 92648 92103 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181842.1 protein_id gnl|my_center|LOCUS_35570 93554 92802 gene locus_tag LOCUS_35580 gene nfsA 93554 92802 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_35580 93987 94187 gene locus_tag LOCUS_35590 gene cspB 93987 94187 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_35590 94264 94497 gene locus_tag LOCUS_35600 94264 94497 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 protein_id gnl|my_center|LOCUS_35600 95072 94569 gene locus_tag LOCUS_35610 95072 94569 CDS product cytochrome c biogenesis protein CcdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028639.1 protein_id gnl|my_center|LOCUS_35610 95273 96355 gene locus_tag LOCUS_35620 95273 96355 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_35620 96554 97594 gene locus_tag LOCUS_35630 96554 97594 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_35630 97651 98490 gene locus_tag LOCUS_35640 gene cysT 97651 98490 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_35640 98514 99380 gene locus_tag LOCUS_35650 gene cysW 98514 99380 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_35650 100372 99542 gene locus_tag LOCUS_35660 100372 99542 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_35660 101244 100372 gene locus_tag LOCUS_35670 101244 100372 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_35670 102653 101331 gene locus_tag LOCUS_35680 102653 101331 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775660.1 protein_id gnl|my_center|LOCUS_35680 102855 104672 gene locus_tag LOCUS_35690 102855 104672 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_35690 104736 106292 gene locus_tag LOCUS_35700 104736 106292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 107341 106400 gene locus_tag LOCUS_35710 107341 106400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 107455 108165 gene locus_tag LOCUS_35720 107455 108165 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015965.1 protein_id gnl|my_center|LOCUS_35720 108433 109266 gene locus_tag LOCUS_35730 108433 109266 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_35730 109269 109697 gene locus_tag LOCUS_35740 109269 109697 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 protein_id gnl|my_center|LOCUS_35740 109821 110312 gene locus_tag LOCUS_35750 109821 110312 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459634.1 protein_id gnl|my_center|LOCUS_35750 110473 111756 gene locus_tag LOCUS_35760 110473 111756 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 protein_id gnl|my_center|LOCUS_35760 111851 112489 gene locus_tag LOCUS_35770 111851 112489 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526504.1 protein_id gnl|my_center|LOCUS_35770 112517 114208 gene locus_tag LOCUS_35780 112517 114208 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_35780 114354 114091 gene locus_tag LOCUS_35790 114354 114091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 114782 116485 gene locus_tag LOCUS_35800 114782 116485 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_35800 117635 116733 gene locus_tag LOCUS_35810 117635 116733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964732.1 protein_id gnl|my_center|LOCUS_35810 117864 119651 gene locus_tag LOCUS_35820 117864 119651 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_35820 119777 120574 gene locus_tag LOCUS_35830 119777 120574 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_35830 121424 120732 gene locus_tag LOCUS_35840 121424 120732 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842726.1 protein_id gnl|my_center|LOCUS_35840 122034 121516 gene locus_tag LOCUS_35850 gene nrdG 122034 121516 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108083.1 protein_id gnl|my_center|LOCUS_35850 124007 122031 gene locus_tag LOCUS_35860 124007 122031 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940078.1 protein_id gnl|my_center|LOCUS_35860 124380 124679 gene locus_tag LOCUS_35870 124380 124679 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_35870 124884 124958 gene locus_tag LOCUS_t00660 124884 124958 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 126227 125847 gene locus_tag LOCUS_35880 126227 125847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 126481 126254 gene locus_tag LOCUS_35890 126481 126254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 127816 126656 gene locus_tag LOCUS_35900 127816 126656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890734.1 protein_id gnl|my_center|LOCUS_35900 128778 127984 gene locus_tag LOCUS_35910 128778 127984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 129492 128845 gene locus_tag LOCUS_35920 129492 128845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722300.1 protein_id gnl|my_center|LOCUS_35920 129656 130414 gene locus_tag LOCUS_35930 129656 130414 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_35930 130494 130850 gene locus_tag LOCUS_35940 130494 130850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 131162 132043 gene locus_tag LOCUS_35950 131162 132043 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_35950 132040 132885 gene locus_tag LOCUS_35960 132040 132885 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_35960 132892 134193 gene locus_tag LOCUS_35970 132892 134193 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_35970 135175 134381 gene locus_tag LOCUS_35980 135175 134381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966921.1 protein_id gnl|my_center|LOCUS_35980 135994 136575 gene locus_tag LOCUS_35990 gene eetB 135994 136575 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_35990 136572 137465 gene locus_tag LOCUS_36000 136572 137465 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014407975.1 protein_id gnl|my_center|LOCUS_36000 137441 138394 gene locus_tag LOCUS_36010 137441 138394 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406535.1 protein_id gnl|my_center|LOCUS_36010 138391 139185 gene locus_tag LOCUS_36020 138391 139185 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_36020 139269 141254 gene locus_tag LOCUS_36030 139269 141254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 141251 142573 gene locus_tag LOCUS_36040 141251 142573 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_36040 142578 143450 gene locus_tag LOCUS_36050 gene ubiA 142578 143450 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_36050 144502 143624 gene locus_tag LOCUS_36060 144502 143624 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550464.1 protein_id gnl|my_center|LOCUS_36060 144699 145310 gene locus_tag LOCUS_36070 144699 145310 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_36070 146374 145394 gene locus_tag LOCUS_36080 gene hepT 146374 145394 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_36080 146882 146406 gene locus_tag LOCUS_36090 146882 146406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 149033 147075 gene locus_tag LOCUS_36100 149033 147075 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726299.1 protein_id gnl|my_center|LOCUS_36100 150880 149252 gene locus_tag LOCUS_36110 150880 149252 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_36110 151105 152607 gene locus_tag LOCUS_36120 151105 152607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 152806 153006 gene locus_tag LOCUS_36130 152806 153006 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_36130 153149 153310 gene locus_tag LOCUS_36140 153149 153310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 153565 154977 gene locus_tag LOCUS_36150 153565 154977 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173227432.1 protein_id gnl|my_center|LOCUS_36150 155037 155417 gene locus_tag LOCUS_36160 155037 155417 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_36160 156384 155569 gene locus_tag LOCUS_36170 156384 155569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_36170 156583 159699 gene locus_tag LOCUS_36180 156583 159699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence50 906 1523 gene locus_tag LOCUS_36190 906 1523 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_36190 1617 2918 gene locus_tag LOCUS_36200 1617 2918 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_36200 3218 3673 gene locus_tag LOCUS_36210 3218 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 5018 3795 gene locus_tag LOCUS_36220 gene ecsB 5018 3795 CDS product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 protein_id gnl|my_center|LOCUS_36220 5764 5015 gene locus_tag LOCUS_36230 gene ecsA 5764 5015 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292612.1 protein_id gnl|my_center|LOCUS_36230 7326 5857 gene locus_tag LOCUS_36240 7326 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 8257 7484 gene locus_tag LOCUS_36250 8257 7484 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_36250 8799 8344 gene locus_tag LOCUS_36260 8799 8344 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167022.1 protein_id gnl|my_center|LOCUS_36260 9085 9987 gene locus_tag LOCUS_36270 9085 9987 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_36270 10019 10828 gene locus_tag LOCUS_36280 10019 10828 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_36280 11764 11117 gene locus_tag LOCUS_36290 11764 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 12534 11851 gene locus_tag LOCUS_36300 12534 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 13439 12678 gene locus_tag LOCUS_36310 gene sdhB 13439 12678 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_36310 15204 13456 gene locus_tag LOCUS_36320 gene sdhA 15204 13456 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 protein_id gnl|my_center|LOCUS_36320 15891 15220 gene locus_tag LOCUS_36330 gene sdhC 15891 15220 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_36330 16157 17077 gene locus_tag LOCUS_36340 16157 17077 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207332.1 protein_id gnl|my_center|LOCUS_36340 17811 17131 gene locus_tag LOCUS_36350 17811 17131 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_36350 19170 17842 gene locus_tag LOCUS_36360 19170 17842 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_36360 19351 21030 gene locus_tag LOCUS_36370 19351 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 22243 21137 gene locus_tag LOCUS_36380 22243 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 22540 22325 gene locus_tag LOCUS_36390 22540 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 23634 22537 gene locus_tag LOCUS_36400 23634 22537 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583075.1 protein_id gnl|my_center|LOCUS_36400 24605 23634 gene locus_tag LOCUS_36410 24605 23634 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_36410 27069 24922 gene locus_tag LOCUS_36420 27069 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 27612 27301 gene locus_tag LOCUS_36430 gene trxA 27612 27301 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830148.1 protein_id gnl|my_center|LOCUS_36430 28934 27984 gene locus_tag LOCUS_36440 gene dnaI 28934 27984 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_36440 30496 28982 gene locus_tag LOCUS_36450 30496 28982 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 protein_id gnl|my_center|LOCUS_36450 30801 31550 gene locus_tag LOCUS_36460 30801 31550 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_36460 31908 31651 gene locus_tag LOCUS_36470 31908 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 33101 31908 gene locus_tag LOCUS_36480 33101 31908 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241220.1 protein_id gnl|my_center|LOCUS_36480 33517 34518 gene locus_tag LOCUS_36490 33517 34518 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 protein_id gnl|my_center|LOCUS_36490 34838 34695 gene locus_tag LOCUS_36500 34838 34695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 35200 35012 gene locus_tag LOCUS_36510 35200 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 35798 35136 gene locus_tag LOCUS_36520 35798 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 36629 36273 gene locus_tag LOCUS_36530 36629 36273 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_36530 36986 38092 gene locus_tag LOCUS_36540 gene mqnE 36986 38092 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_36540 38189 39250 gene locus_tag LOCUS_36550 38189 39250 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_36550 39584 39324 gene locus_tag LOCUS_36560 39584 39324 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068337.1 protein_id gnl|my_center|LOCUS_36560 39675 39920 gene locus_tag LOCUS_36570 39675 39920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 40901 40125 gene locus_tag LOCUS_36580 40901 40125 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 protein_id gnl|my_center|LOCUS_36580 41962 41099 gene locus_tag LOCUS_36590 41962 41099 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_36590 42698 42030 gene locus_tag LOCUS_36600 42698 42030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_36600 43735 42701 gene locus_tag LOCUS_36610 43735 42701 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 protein_id gnl|my_center|LOCUS_36610 44799 44062 gene locus_tag LOCUS_36620 44799 44062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 46623 44842 gene locus_tag LOCUS_36630 46623 44842 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871433.1 protein_id gnl|my_center|LOCUS_36630 47793 46861 gene locus_tag LOCUS_36640 gene ctaA 47793 46861 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_36640 48347 47997 gene locus_tag LOCUS_36650 48347 47997 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_36650 48463 49803 gene locus_tag LOCUS_36660 48463 49803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 51533 49899 gene locus_tag LOCUS_36670 51533 49899 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_36670 52121 51630 gene locus_tag LOCUS_36680 52121 51630 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_36680 52872 52126 gene locus_tag LOCUS_36690 52872 52126 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 protein_id gnl|my_center|LOCUS_36690 55114 53033 gene locus_tag LOCUS_36700 55114 53033 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903316.1 protein_id gnl|my_center|LOCUS_36700 57400 55400 gene locus_tag LOCUS_36710 57400 55400 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903316.1 protein_id gnl|my_center|LOCUS_36710 58763 57624 gene locus_tag LOCUS_36720 58763 57624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 59284 58826 gene locus_tag LOCUS_36730 59284 58826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 59465 59677 gene locus_tag LOCUS_36740 59465 59677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 59890 61059 gene locus_tag LOCUS_36750 59890 61059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 61122 61478 gene locus_tag LOCUS_36760 61122 61478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 62529 61597 gene locus_tag LOCUS_36770 gene cyoE 62529 61597 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 protein_id gnl|my_center|LOCUS_36770 62827 62675 gene locus_tag LOCUS_36780 62827 62675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 63842 62856 gene locus_tag LOCUS_36790 gene trpS 63842 62856 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_36790 64336 65316 gene locus_tag LOCUS_36800 gene galM 64336 65316 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_36800 65441 65656 gene locus_tag LOCUS_36810 gene sspA 65441 65656 CDS product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 protein_id gnl|my_center|LOCUS_36810 66213 65818 gene locus_tag LOCUS_36820 66213 65818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 68327 66516 gene locus_tag LOCUS_36830 68327 66516 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_36830 68432 68593 gene locus_tag LOCUS_36840 68432 68593 CDS product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242786.1 protein_id gnl|my_center|LOCUS_36840 68590 68820 gene locus_tag LOCUS_36850 68590 68820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 69546 68848 gene locus_tag LOCUS_36860 69546 68848 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_36860 69982 69590 gene locus_tag LOCUS_36870 69982 69590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 protein_id gnl|my_center|LOCUS_36870 70194 70015 gene locus_tag LOCUS_36880 70194 70015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 70425 71720 gene locus_tag LOCUS_36890 gene spoVV 70425 71720 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_36890 71909 73099 gene locus_tag LOCUS_36900 71909 73099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 73400 74203 gene locus_tag LOCUS_36910 73400 74203 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 protein_id gnl|my_center|LOCUS_36910 75143 74343 gene locus_tag LOCUS_36920 75143 74343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 75339 76403 gene locus_tag LOCUS_36930 gene lytH 75339 76403 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_36930 77440 76412 gene locus_tag LOCUS_36940 77440 76412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 78314 77580 gene locus_tag LOCUS_36950 gene treR 78314 77580 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 protein_id gnl|my_center|LOCUS_36950 80416 78386 gene locus_tag LOCUS_36960 80416 78386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 82242 80536 gene locus_tag LOCUS_36970 gene treC 82242 80536 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656120.1 protein_id gnl|my_center|LOCUS_36970 83075 82548 gene locus_tag LOCUS_36980 83075 82548 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182765.1 protein_id gnl|my_center|LOCUS_36980 83637 83104 gene locus_tag LOCUS_36990 83637 83104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 84660 83704 gene locus_tag LOCUS_37000 84660 83704 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 protein_id gnl|my_center|LOCUS_37000 84808 85443 gene locus_tag LOCUS_37010 84808 85443 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_37010 85633 87051 gene locus_tag LOCUS_37020 85633 87051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_37020 88922 87162 gene locus_tag LOCUS_37030 88922 87162 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_37030 90236 89046 gene locus_tag LOCUS_37040 90236 89046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 91039 90233 gene locus_tag LOCUS_37050 91039 90233 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_37050 91929 91036 gene locus_tag LOCUS_37060 91929 91036 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089403226.1 protein_id gnl|my_center|LOCUS_37060 93464 92052 gene locus_tag LOCUS_37070 93464 92052 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 protein_id gnl|my_center|LOCUS_37070 94604 93663 gene locus_tag LOCUS_37080 94604 93663 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975882.1 protein_id gnl|my_center|LOCUS_37080 95805 94864 gene locus_tag LOCUS_37090 95805 94864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 95959 96840 gene locus_tag LOCUS_37100 95959 96840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 97304 97155 gene locus_tag LOCUS_37110 97304 97155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 97564 97259 gene locus_tag LOCUS_37120 97564 97259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37120 98246 97665 gene locus_tag LOCUS_37130 98246 97665 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106090.1 protein_id gnl|my_center|LOCUS_37130 98688 98278 gene locus_tag LOCUS_37140 98688 98278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053186.1 protein_id gnl|my_center|LOCUS_37140 99540 98812 gene locus_tag LOCUS_37150 99540 98812 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_37150 101101 100520 gene locus_tag LOCUS_37160 101101 100520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 101362 101222 gene locus_tag LOCUS_37170 101362 101222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 101762 101580 gene locus_tag LOCUS_37180 101762 101580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 102139 101774 gene locus_tag LOCUS_37190 102139 101774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 103370 102939 gene locus_tag LOCUS_37200 103370 102939 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_37200 104045 103650 gene locus_tag LOCUS_37210 104045 103650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 104351 104611 gene locus_tag LOCUS_37220 104351 104611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 104792 104995 gene locus_tag LOCUS_37230 104792 104995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 105580 105185 gene locus_tag LOCUS_37240 105580 105185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 106242 105820 gene locus_tag LOCUS_37250 106242 105820 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189956.1 protein_id gnl|my_center|LOCUS_37250 106940 106464 gene locus_tag LOCUS_37260 106940 106464 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682186.1 protein_id gnl|my_center|LOCUS_37260 108039 107389 gene locus_tag LOCUS_37270 108039 107389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 111276 108706 gene locus_tag LOCUS_37280 111276 108706 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_37280 113187 111574 gene locus_tag LOCUS_37290 113187 111574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_37290 114211 113252 gene locus_tag LOCUS_37300 114211 113252 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_37300 115159 114227 gene locus_tag LOCUS_37310 115159 114227 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_37310 115719 117587 gene locus_tag LOCUS_37320 115719 117587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 117603 119447 gene locus_tag LOCUS_37330 117603 119447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 119789 119667 gene locus_tag LOCUS_37340 119789 119667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 122569 120602 gene locus_tag LOCUS_37350 122569 120602 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192966.1 protein_id gnl|my_center|LOCUS_37350 124241 122562 gene locus_tag LOCUS_37360 124241 122562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 124937 124317 gene locus_tag LOCUS_37370 124937 124317 CDS product papain-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047147.1 protein_id gnl|my_center|LOCUS_37370 127283 125928 gene locus_tag LOCUS_37380 127283 125928 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_37380 128446 127316 gene locus_tag LOCUS_37390 gene ald 128446 127316 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_37390 129230 128475 gene locus_tag LOCUS_37400 129230 128475 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_37400 130682 129264 gene locus_tag LOCUS_37410 130682 129264 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_37410 131627 130848 gene locus_tag LOCUS_37420 gene phnF 131627 130848 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_37420 132884 131634 gene locus_tag LOCUS_37430 132884 131634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087075.1 protein_id gnl|my_center|LOCUS_37430 134572 132923 gene locus_tag LOCUS_37440 134572 132923 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_37440 134933 134637 gene locus_tag LOCUS_37450 134933 134637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 135311 135964 gene locus_tag LOCUS_37460 135311 135964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 136161 136364 gene locus_tag LOCUS_37470 136161 136364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 136411 136644 gene locus_tag LOCUS_37480 136411 136644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 138171 137380 gene locus_tag LOCUS_37490 138171 137380 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_37490 138897 138223 gene locus_tag LOCUS_37500 138897 138223 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_37500 139144 139371 gene locus_tag LOCUS_37510 139144 139371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 141157 139517 gene locus_tag LOCUS_37520 141157 139517 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_37520 143005 141455 gene locus_tag LOCUS_37530 gene zwf 143005 141455 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_37530 143982 143173 gene locus_tag LOCUS_37540 143982 143173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 144831 144181 gene locus_tag LOCUS_37550 144831 144181 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598707.1 protein_id gnl|my_center|LOCUS_37550 145894 144821 gene locus_tag LOCUS_37560 gene liaS 145894 144821 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_37560 146566 145913 gene locus_tag LOCUS_37570 146566 145913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 147465 146752 gene locus_tag LOCUS_37580 147465 146752 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_37580 148022 147468 gene locus_tag LOCUS_37590 148022 147468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 148701 148027 gene locus_tag LOCUS_37600 148701 148027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 149093 148785 gene locus_tag LOCUS_37610 149093 148785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 149529 150806 gene locus_tag LOCUS_37620 149529 150806 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_37620 151057 150978 gene locus_tag LOCUS_t00670 151057 150978 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 151152 151076 gene locus_tag LOCUS_t00680 151152 151076 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 151246 151173 gene locus_tag LOCUS_t00690 151246 151173 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 151327 151253 gene locus_tag LOCUS_t00700 151327 151253 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 151408 151334 gene locus_tag LOCUS_t00710 151408 151334 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 151506 151431 gene locus_tag LOCUS_t00720 151506 151431 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 151610 151537 gene locus_tag LOCUS_t00730 151610 151537 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 151703 151618 gene locus_tag LOCUS_t00740 151703 151618 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 151789 151714 gene locus_tag LOCUS_t00750 151789 151714 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 151882 151807 gene locus_tag LOCUS_t00760 151882 151807 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 151966 151890 gene locus_tag LOCUS_t00770 151966 151890 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 152119 152046 gene locus_tag LOCUS_t00780 152119 152046 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 152222 152147 gene locus_tag LOCUS_t00790 152222 152147 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 152362 152289 gene locus_tag LOCUS_t00800 152362 152289 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 152470 152379 gene locus_tag LOCUS_t00810 152470 152379 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 152549 152474 gene locus_tag LOCUS_t00820 152549 152474 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38